Starting /dee2/code/volunteer_pipeline.sh SRR6958155 current disk space = 1550595534848 free memory = 1603440516 SRR6958155 SRAfilesize 12470dba931fd4da3d494a59642f1345 SRR6958155.sra SRR6958155.sra file validated SRR6958155 is paired end SRR6958155 is conventional basespace SRR6958155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.87175 32.0 25.0 33.0 2.0 33.0 2 26.2245 28.0 18.0 31.0 18.0 33.0 3 28.8245 29.0 27.0 31.0 25.0 33.0 4 30.675 31.0 29.0 33.0 27.0 33.0 5 31.694 33.0 31.0 33.0 29.0 33.0 6 35.442 37.0 35.0 38.0 31.0 38.0 7 36.14175 38.0 36.0 38.0 33.0 38.0 8 36.8815 38.0 37.0 38.0 35.0 38.0 9 37.191 38.0 38.0 38.0 36.0 38.0 10-14 37.3117 38.0 38.0 38.0 36.8 38.0 15-19 37.4988 38.0 38.0 38.0 37.4 38.0 20-24 37.494899999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.2116 38.0 38.0 38.0 36.6 38.0 30-34 37.383900000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.01625 38.0 38.0 38.0 35.8 38.0 40-44 37.5409 38.0 38.0 38.0 37.8 38.0 45-49 37.3112 38.0 38.0 38.0 37.0 38.0 50-54 37.2413 38.0 38.0 38.0 36.6 38.0 55-59 37.179899999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.324850000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.4143 38.0 38.0 38.0 37.0 38.0 70-74 37.2752 38.0 38.0 38.0 37.0 38.0 75-79 37.233250000000005 38.0 38.0 38.0 36.4 38.0 80-84 37.1819 38.0 38.0 38.0 36.2 38.0 85-89 36.7101 38.0 38.0 38.0 35.0 38.0 90-94 36.022 38.0 37.4 38.0 32.2 38.0 95-99 34.49975 38.0 34.0 38.0 25.8 38.0 100-104 35.7329 38.0 37.0 38.0 30.6 38.0 105-109 35.6616 38.0 36.6 38.0 30.6 38.0 110-114 35.388250000000006 38.0 36.0 38.0 29.4 38.0 115-119 35.603750000000005 38.0 36.4 38.0 31.0 38.0 120-124 35.4303 38.0 36.0 38.0 29.8 38.0 125-129 35.26535 38.0 36.0 38.0 29.6 38.0 130-134 34.90495 38.0 35.8 38.0 27.6 38.0 135-139 34.22615 38.0 34.2 38.0 25.8 38.0 140-144 32.87205 38.0 32.2 38.0 18.8 38.0 145-149 32.093149999999994 38.0 32.6 38.0 10.6 38.0 150-151 26.091375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 4.0 20 2.0 21 4.0 22 4.0 23 14.0 24 11.0 25 16.0 26 28.0 27 22.0 28 31.0 29 48.0 30 49.0 31 82.0 32 104.0 33 154.0 34 229.0 35 421.0 36 991.0 37 1780.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.90593918726911 10.201761864165956 5.967604433077579 34.92469451548735 2 26.275 12.65 32.2 28.875 3 22.400000000000002 19.375 24.075 34.150000000000006 4 26.8 26.075 19.7 27.425 5 26.05 29.25 22.975 21.725 6 21.725 31.75 24.4 22.125 7 17.724999999999998 23.724999999999998 38.800000000000004 19.75 8 20.9 23.200000000000003 28.225 27.675 9 19.55 20.75 33.725 25.974999999999998 10-14 23.24 25.85 25.745 25.165 15-19 23.735 25.34 25.545 25.380000000000003 20-24 23.630000000000003 25.09 25.97 25.31 25-29 23.315 25.509999999999998 25.755 25.419999999999998 30-34 22.78 25.490000000000002 26.179999999999996 25.55 35-39 23.57 25.064999999999998 25.795 25.569999999999997 40-44 23.255 25.71 25.86 25.174999999999997 45-49 23.189999999999998 24.959999999999997 25.480000000000004 26.369999999999997 50-54 23.765 24.68 26.295 25.259999999999998 55-59 23.345 25.169999999999998 26.095000000000002 25.39 60-64 23.419999999999998 25.235000000000003 25.155 26.19 65-69 23.66 25.490000000000002 25.174999999999997 25.674999999999997 70-74 23.385 25.53 25.674999999999997 25.41 75-79 23.78 24.62 25.295 26.305 80-84 23.335 25.83 25.485000000000003 25.35 85-89 23.34 25.014999999999997 25.69 25.955000000000002 90-94 23.955000000000002 24.154999999999998 25.94 25.95 95-99 23.51 24.995 25.55 25.945 100-104 24.349999999999998 24.709999999999997 25.55 25.39 105-109 23.57 24.68 26.040000000000003 25.71 110-114 23.119999999999997 25.34 25.55 25.990000000000002 115-119 23.61 24.895 25.480000000000004 26.015 120-124 23.064999999999998 25.71 24.895 26.33 125-129 23.995 25.085 25.005 25.915 130-134 24.15 24.75 25.259999999999998 25.840000000000003 135-139 23.244999999999997 24.925 25.215 26.615 140-144 23.76 25.165 25.105 25.97 145-149 22.82 24.925 25.365 26.889999999999997 150-151 24.337500000000002 23.8875 25.412499999999998 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 2.0 30 3.5 31 8.0 32 13.0 33 14.5 34 15.5 35 29.0 36 51.5 37 57.5 38 71.0 39 95.5 40 106.5 41 146.5 42 189.0 43 194.5 44 200.5 45 211.0 46 213.0 47 201.5 48 179.5 49 182.0 50 176.5 51 153.5 52 154.5 53 142.5 54 114.5 55 105.5 56 105.5 57 92.0 58 78.5 59 74.5 60 70.5 61 74.0 62 67.0 63 54.5 64 58.0 65 52.0 66 41.5 67 39.5 68 32.5 69 29.5 70 26.0 71 19.0 72 14.0 73 8.5 74 6.0 75 6.0 76 5.5 77 3.5 78 2.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.4 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.475 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91775 33.0 33.0 34.0 32.0 34.0 2 33.09825 34.0 33.0 34.0 32.0 34.0 3 33.0255 34.0 33.0 34.0 32.0 34.0 4 33.0395 34.0 33.0 34.0 33.0 34.0 5 32.9205 34.0 33.0 34.0 32.0 34.0 6 37.1605 38.0 38.0 38.0 37.0 38.0 7 37.09275 38.0 38.0 38.0 37.0 38.0 8 36.79475 38.0 38.0 38.0 36.0 38.0 9 37.0125 38.0 38.0 38.0 36.0 38.0 10-14 36.774649999999994 38.0 38.0 38.0 35.6 38.0 15-19 36.806 38.0 38.0 38.0 35.6 38.0 20-24 36.8355 38.0 38.0 38.0 35.8 38.0 25-29 36.98465 38.0 38.0 38.0 36.4 38.0 30-34 37.045 38.0 38.0 38.0 36.8 38.0 35-39 37.17445 38.0 38.0 38.0 37.0 38.0 40-44 35.0687 38.0 35.0 38.0 28.0 38.0 45-49 35.2745 38.0 35.4 38.0 28.6 38.0 50-54 34.86755000000001 38.0 34.6 38.0 27.0 38.0 55-59 35.16355 38.0 35.6 38.0 28.8 38.0 60-64 36.3946 38.0 37.8 38.0 34.0 38.0 65-69 36.0106 38.0 37.4 38.0 32.4 38.0 70-74 35.92735 38.0 37.4 38.0 31.8 38.0 75-79 36.0231 38.0 38.0 38.0 33.2 38.0 80-84 35.924600000000005 38.0 37.8 38.0 32.6 38.0 85-89 35.75685 38.0 37.4 38.0 31.4 38.0 90-94 35.58344999999999 38.0 37.2 38.0 30.6 38.0 95-99 35.843199999999996 38.0 37.6 38.0 32.8 38.0 100-104 33.744899999999994 37.4 32.0 38.0 24.4 38.0 105-109 35.6246 38.0 37.0 38.0 31.2 38.0 110-114 35.3272 38.0 36.8 38.0 31.0 38.0 115-119 34.646249999999995 38.0 36.0 38.0 26.8 38.0 120-124 30.258850000000002 34.2 25.8 38.0 15.0 38.0 125-129 29.015800000000002 34.4 20.4 38.0 12.2 38.0 130-134 29.40305 34.2 22.6 38.0 12.2 38.0 135-139 31.8401 37.6 31.4 38.0 13.0 38.0 140-144 30.5351 36.8 28.4 38.0 9.4 38.0 145-149 29.00725 36.2 24.4 38.0 2.0 38.0 150-151 23.214875 28.5 14.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 2.0 12 3.0 13 1.0 14 4.0 15 5.0 16 0.0 17 5.0 18 10.0 19 22.0 20 21.0 21 17.0 22 16.0 23 30.0 24 29.0 25 28.0 26 41.0 27 42.0 28 52.0 29 72.0 30 82.0 31 128.0 32 146.0 33 227.0 34 358.0 35 587.0 36 1106.0 37 942.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.675 18.425 10.0 30.9 2 28.599999999999998 23.9 27.1 20.4 3 22.35 27.250000000000004 27.975 22.425 4 25.825 32.625 19.2 22.35 5 26.650000000000002 32.475 20.45 20.424999999999997 6 23.724999999999998 33.2 21.725 21.349999999999998 7 21.475 20.474999999999998 34.35 23.7 8 23.425 22.725 24.349999999999998 29.5 9 23.599999999999998 22.675 27.85 25.874999999999996 10-14 25.990000000000002 25.91 23.54 24.560000000000002 15-19 26.52 24.84 24.07 24.57 20-24 25.28 25.935000000000002 24.315 24.47 25-29 25.71 26.27 23.935000000000002 24.085 30-34 25.77 25.96 24.32 23.95 35-39 25.995 25.72 24.05 24.235 40-44 25.990000000000002 25.380000000000003 24.525 24.104999999999997 45-49 26.51 24.995 24.85 23.645 50-54 25.775 25.869999999999997 24.545 23.810000000000002 55-59 26.090000000000003 25.53 24.51 23.87 60-64 26.090000000000003 25.28 24.474999999999998 24.154999999999998 65-69 25.89 25.83 24.275 24.005000000000003 70-74 26.69 24.79 24.64 23.880000000000003 75-79 26.355 24.83 24.87 23.945 80-84 26.1 25.27 24.965 23.665 85-89 25.6 25.365 25.0 24.035 90-94 26.595000000000002 25.509999999999998 24.435000000000002 23.46 95-99 26.575 25.115 24.75 23.56 100-104 25.900000000000002 25.6 24.465 24.035 105-109 25.535000000000004 25.924999999999997 24.779999999999998 23.76 110-114 26.165 25.765 24.39 23.68 115-119 26.33 25.91 24.240000000000002 23.52 120-124 25.965 25.495 25.019999999999996 23.52 125-129 26.002600260026004 26.17761776177618 24.482448244824482 23.337333733373335 130-134 26.21 25.919999999999998 24.4 23.47 135-139 26.295 25.88 24.985 22.84 140-144 26.5 25.264999999999997 24.79 23.445 145-149 26.41 25.955000000000002 23.855 23.78 150-151 26.3 25.7625 24.5375 23.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 4.5 30 5.5 31 8.0 32 9.5 33 12.0 34 20.0 35 30.5 36 41.0 37 58.0 38 71.0 39 82.0 40 104.0 41 135.0 42 163.5 43 177.0 44 182.5 45 187.0 46 190.0 47 194.0 48 188.0 49 172.0 50 164.0 51 157.5 52 149.5 53 128.5 54 108.5 55 117.5 56 119.0 57 108.0 58 95.5 59 89.5 60 81.0 61 71.5 62 80.5 63 75.0 64 61.0 65 53.0 66 50.5 67 51.0 68 46.0 69 34.0 70 30.5 71 27.0 72 17.0 73 11.5 74 9.0 75 8.0 76 6.0 77 4.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.757002271006813 1.5 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7625000000000002 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.725 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCTGG 10 0.006830828 145.0 9 >>END_MODULE Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005297 spots for SRR6958155.sra Written 1005297 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra Read 1005293 spots for SRR6958155.sra Written 1005293 spots for SRR6958155.sra SRR ids: ['SRR6958155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pcv602u4 SRR6958155.sra spots: 20105864 blocks: [[1, 1005293], [1005294, 2010586], [2010587, 3015879], [3015880, 4021172], [4021173, 5026465], [5026466, 6031758], [6031759, 7037051], [7037052, 8042344], [8042345, 9047637], [9047638, 10052930], [10052931, 11058223], [11058224, 12063516], [12063517, 13068809], [13068810, 14074102], [14074103, 15079395], [15079396, 16084688], [16084689, 17089981], [17089982, 18095274], [18095275, 19100567], [19100568, 20105864]] SRR6958155 file size 6791517 SRR6958155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958155 SRR6958155_1.fastq SRR6958155_2.fastq Input file: SRR6958155_1.fastq Paired file: SRR6958155_2.fastq trimmed: SRR6958155-trimmed-pair1.fastq, SRR6958155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:24:07 2024 >> started Fri Dec 6 14:24:28 2024 >> done (21.181s) 20105864 read pairs processed; of these: 18954 ( 0.09%) short read pairs filtered out after trimming by size control 14044 ( 0.07%) empty read pairs filtered out after trimming by size control 20072866 (99.84%) read pairs available; of these: 8998880 (44.83%) trimmed read pairs available after processing 11073986 (55.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 7 0.00% 26 7 0.00% 27 4 0.00% 28 7 0.00% 29 5 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 14 0.00% 34 12 0.00% 35 8 0.00% 36 6 0.00% 37 11 0.00% 38 13 0.00% 39 14 0.00% 40 14 0.00% 41 18 0.00% 42 21 0.00% 43 20 0.00% 44 25 0.00% 45 20 0.00% 46 13 0.00% 47 26 0.00% 48 36 0.00% 49 29 0.00% 50 49 0.00% 51 66 0.00% 52 62 0.00% 53 41 0.00% 54 79 0.00% 55 53 0.00% 56 82 0.00% 57 95 0.00% 58 100 0.00% 59 124 0.00% 60 176 0.00% 61 160 0.00% 62 211 0.00% 63 234 0.00% 64 256 0.00% 65 301 0.00% 66 330 0.00% 67 372 0.00% 68 442 0.00% 69 536 0.00% 70 578 0.00% 71 659 0.00% 72 805 0.00% 73 874 0.00% 74 995 0.00% 75 1132 0.01% 76 1225 0.01% 77 1363 0.01% 78 1472 0.01% 79 1673 0.01% 80 1850 0.01% 81 2102 0.01% 82 2374 0.01% 83 2829 0.01% 84 3817 0.02% 85 4458 0.02% 86 4630 0.02% 87 4958 0.02% 88 5188 0.03% 89 5529 0.03% 90 5739 0.03% 91 6209 0.03% 92 6720 0.03% 93 7265 0.04% 94 7953 0.04% 95 8332 0.04% 96 8832 0.04% 97 9174 0.05% 98 9713 0.05% 99 10153 0.05% 100 10953 0.05% 101 11414 0.06% 102 12305 0.06% 103 13006 0.06% 104 14086 0.07% 105 14931 0.07% 106 15501 0.08% 107 15699 0.08% 108 16598 0.08% 109 17408 0.09% 110 17939 0.09% 111 18910 0.09% 112 20205 0.10% 113 21013 0.10% 114 22199 0.11% 115 23842 0.12% 116 24823 0.12% 117 25658 0.13% 118 26698 0.13% 119 27376 0.14% 120 28324 0.14% 121 29631 0.15% 122 30989 0.15% 123 32790 0.16% 124 34748 0.17% 125 36725 0.18% 126 38265 0.19% 127 39892 0.20% 128 41378 0.21% 129 43283 0.22% 130 45039 0.22% 131 47224 0.24% 132 50958 0.25% 133 53062 0.26% 134 56360 0.28% 135 60270 0.30% 136 64659 0.32% 137 66772 0.33% 138 70786 0.35% 139 76396 0.38% 140 80883 0.40% 141 88275 0.44% 142 98024 0.49% 143 110718 0.55% 144 126769 0.63% 145 151399 0.75% 146 189511 0.94% 147 260529 1.30% 148 401576 2.00% 149 823679 4.10% 150 5216667 25.99% 151 11073986 55.17% 20072866 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=17 prefix-density=0.82 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=33.71 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=44.24 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958155 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:25:56 Started mapping on | Dec 06 14:25:56 Finished on | Dec 06 14:27:41 Mapping speed, Million of reads per hour | 688.21 Number of input reads | 20072866 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19003431 Uniquely mapped reads % | 94.67% Average mapped length | 295.86 Number of splices: Total | 21852449 Number of splices: Annotated (sjdb) | 20602461 Number of splices: GT/AG | 21555303 Number of splices: GC/AG | 260921 Number of splices: AT/AC | 8068 Number of splices: Non-canonical | 28157 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304701 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 61992 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 1.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 776915 776915 776915 N_multimapping 304701 304701 304701 N_noFeature 718723 18478766 868803 N_ambiguous 452998 2633 79812 UnstrandedReadsAssigned:17831710 PositiveStrandReadsAssigned:522032 NegativeStrandReadsAssigned:18054816 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958155-trimmed-pair1.fastq SRR6958155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,072,866 reads, 18,126,651 reads pseudoaligned [quant] estimated average fragment length: 262.002 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR6958155.ke.tsv 35125 SRR6958155.se.tsv 88098 total ==> SRR6958155.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.505 0 0 PNS24247 1044 782.998 70.313 7.32425 PNS24249 1928 1667 38.8685 1.90174 PNS24246 1044 782.998 70.313 7.32425 PNS24248 1044 782.998 70.313 7.32425 PNS24244 1471 1210 30.1924 2.03517 PNS24243 293 86.3651 0 0 KQK14069 1603 1342 5497.46 334.117 KQK14071 474 228.033 79.3402 28.3781 ==> SRR6958155.se.tsv <== BRADI_1g14170v3 6174 BRADI_1g53295v3 165 BRADI_1g59795v3 262 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 225 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 251 BRADI_1g48960v3 0 SRR6958155 completed mapping pipeline successfully