Starting /dee2/code/volunteer_pipeline.sh SRR6958156 current disk space = 1550579757056 free memory = 1601635120 SRR6958156 SRAfilesize 45722b98547f354da56bbe400ec0611a SRR6958156.sra SRR6958156.sra file validated SRR6958156 is paired end SRR6958156 is conventional basespace SRR6958156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3215 32.0 25.0 33.0 18.0 33.0 2 29.136 31.0 27.0 33.0 18.0 33.0 3 31.051 33.0 30.0 33.0 27.0 33.0 4 32.0245 33.0 32.0 33.0 31.0 34.0 5 32.37475 33.0 33.0 33.0 32.0 34.0 6 36.19075 38.0 36.0 38.0 33.0 38.0 7 36.91125 38.0 37.0 38.0 35.0 38.0 8 37.112 38.0 38.0 38.0 36.0 38.0 9 37.3275 38.0 38.0 38.0 37.0 38.0 10-14 37.3273 38.0 38.0 38.0 36.8 38.0 15-19 37.225649999999995 38.0 38.0 38.0 36.4 38.0 20-24 37.39065 38.0 38.0 38.0 37.0 38.0 25-29 37.28505 38.0 38.0 38.0 36.8 38.0 30-34 37.16535 38.0 38.0 38.0 36.2 38.0 35-39 37.08385 38.0 38.0 38.0 36.0 38.0 40-44 36.97705 38.0 38.0 38.0 35.8 38.0 45-49 37.053250000000006 38.0 38.0 38.0 35.8 38.0 50-54 37.04665 38.0 38.0 38.0 35.8 38.0 55-59 36.767700000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.78445000000001 38.0 38.0 38.0 34.8 38.0 65-69 36.811099999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.881299999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.7719 38.0 38.0 38.0 34.6 38.0 80-84 36.4437 38.0 37.8 38.0 34.0 38.0 85-89 36.1559 38.0 37.0 38.0 33.0 38.0 90-94 36.31345 38.0 37.2 38.0 33.6 38.0 95-99 36.28095 38.0 37.0 38.0 33.6 38.0 100-104 36.10415 38.0 37.0 38.0 33.0 38.0 105-109 35.86995 38.0 37.0 38.0 31.6 38.0 110-114 35.622749999999996 38.0 36.0 38.0 31.0 38.0 115-119 35.60725 38.0 36.0 38.0 31.0 38.0 120-124 35.40325 38.0 35.4 38.0 29.6 38.0 125-129 34.8979 38.0 35.0 38.0 27.4 38.0 130-134 34.7541 38.0 35.0 38.0 27.4 38.0 135-139 34.463550000000005 38.0 34.8 38.0 25.6 38.0 140-144 33.951649999999994 38.0 34.0 38.0 23.2 38.0 145-149 32.7359 37.6 33.2 38.0 18.0 38.0 150-151 28.503375 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 2.0 21 3.0 22 6.0 23 3.0 24 11.0 25 12.0 26 16.0 27 16.0 28 40.0 29 47.0 30 70.0 31 89.0 32 105.0 33 167.0 34 240.0 35 412.0 36 943.0 37 1815.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.225806451612904 7.819354838709677 9.135483870967743 43.81935483870968 2 22.8 11.774999999999999 36.5 28.925 3 18.625 14.224999999999998 27.200000000000003 39.95 4 24.15 23.775 22.3 29.775000000000002 5 25.0 28.375 24.375 22.25 6 22.6 33.0 23.375 21.025 7 16.825000000000003 26.200000000000003 37.9 19.075 8 20.775 23.799999999999997 28.7 26.724999999999998 9 18.6 24.175 33.95 23.275000000000002 10-14 22.205 27.125 26.08 24.59 15-19 22.115000000000002 25.72 26.700000000000003 25.465 20-24 22.36 25.91 26.525 25.205 25-29 22.42 26.224999999999998 25.919999999999998 25.435000000000002 30-34 22.27 26.19 26.155 25.385 35-39 22.115000000000002 26.19 26.474999999999998 25.22 40-44 22.185 26.05 26.064999999999998 25.7 45-49 22.185 25.650000000000002 26.265 25.900000000000002 50-54 22.405 25.235000000000003 26.69 25.669999999999998 55-59 22.384999999999998 26.16 26.150000000000002 25.305 60-64 22.3 26.19 26.1 25.41 65-69 22.535 26.340000000000003 25.295 25.83 70-74 22.895 26.375 25.96 24.77 75-79 22.445 25.82 26.115 25.619999999999997 80-84 22.71 26.275 25.94 25.074999999999996 85-89 23.005 25.275 26.085 25.635 90-94 22.7 25.445 26.064999999999998 25.790000000000003 95-99 22.74 25.3 26.605 25.355 100-104 22.54 26.015 26.32 25.124999999999996 105-109 23.169999999999998 25.855 26.235000000000003 24.740000000000002 110-114 22.475 25.945 26.029999999999998 25.55 115-119 23.025000000000002 25.16 25.924999999999997 25.89 120-124 23.115 25.255 26.419999999999998 25.21 125-129 23.064999999999998 25.724999999999998 25.740000000000002 25.47 130-134 22.985 25.895000000000003 25.97 25.15 135-139 23.275000000000002 25.765 25.465 25.495 140-144 23.13 25.335 25.840000000000003 25.695 145-149 23.395 25.355 25.979999999999997 25.27 150-151 22.7625 24.525 26.450000000000003 26.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.5 27 1.5 28 2.5 29 2.0 30 4.5 31 9.5 32 16.5 33 26.0 34 29.5 35 40.0 36 53.0 37 66.0 38 91.0 39 112.0 40 134.0 41 154.5 42 183.0 43 219.5 44 233.0 45 225.5 46 223.0 47 221.5 48 205.0 49 191.0 50 178.5 51 147.0 52 131.5 53 122.5 54 104.5 55 94.0 56 77.5 57 65.0 58 62.0 59 65.5 60 59.5 61 52.0 62 48.0 63 49.0 64 52.0 65 44.5 66 34.5 67 24.5 68 24.5 69 26.0 70 19.5 71 16.0 72 14.5 73 11.5 74 7.5 75 5.5 76 5.0 77 4.0 78 1.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3875000000000002 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7125000000000004 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90125 33.0 33.0 34.0 32.0 34.0 2 32.89325 33.0 33.0 34.0 32.0 34.0 3 32.88875 34.0 33.0 34.0 32.0 34.0 4 32.82025 34.0 33.0 34.0 32.0 34.0 5 32.824 34.0 33.0 34.0 32.0 34.0 6 36.99725 38.0 38.0 38.0 36.0 38.0 7 36.9405 38.0 38.0 38.0 36.0 38.0 8 36.898 38.0 38.0 38.0 36.0 38.0 9 36.88375 38.0 38.0 38.0 36.0 38.0 10-14 36.7855 38.0 38.0 38.0 35.2 38.0 15-19 36.71660000000001 38.0 38.0 38.0 34.6 38.0 20-24 36.8799 38.0 38.0 38.0 35.8 38.0 25-29 37.00055 38.0 38.0 38.0 36.0 38.0 30-34 37.0211 38.0 38.0 38.0 36.0 38.0 35-39 36.92215 38.0 38.0 38.0 35.6 38.0 40-44 36.859100000000005 38.0 38.0 38.0 35.4 38.0 45-49 36.74265 38.0 38.0 38.0 34.8 38.0 50-54 36.78189999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.822950000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.68845 38.0 38.0 38.0 34.8 38.0 65-69 36.497299999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.37235 38.0 38.0 38.0 33.6 38.0 75-79 36.361149999999995 38.0 38.0 38.0 33.8 38.0 80-84 36.19535 38.0 37.8 38.0 33.0 38.0 85-89 36.0566 38.0 37.0 38.0 32.4 38.0 90-94 35.86065 38.0 37.2 38.0 31.8 38.0 95-99 35.89065 38.0 37.0 38.0 31.8 38.0 100-104 35.7868 38.0 36.8 38.0 31.8 38.0 105-109 35.4543 38.0 36.0 38.0 29.8 38.0 110-114 35.041250000000005 38.0 35.4 38.0 27.6 38.0 115-119 35.05415000000001 38.0 35.0 38.0 28.0 38.0 120-124 34.728899999999996 38.0 35.0 38.0 26.8 38.0 125-129 34.51175 38.0 35.0 38.0 25.6 38.0 130-134 34.235899999999994 38.0 34.6 38.0 23.8 38.0 135-139 33.71315 38.0 34.0 38.0 21.4 38.0 140-144 33.17569999999999 38.0 33.4 38.0 18.6 38.0 145-149 32.3099 38.0 32.4 38.0 12.8 38.0 150-151 26.644875 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 2.0 14 1.0 15 1.0 16 1.0 17 4.0 18 3.0 19 6.0 20 1.0 21 4.0 22 6.0 23 15.0 24 17.0 25 18.0 26 25.0 27 39.0 28 46.0 29 65.0 30 71.0 31 102.0 32 107.0 33 152.0 34 246.0 35 379.0 36 793.0 37 1887.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.95 15.825 13.775 37.45 2 28.675 23.200000000000003 28.375 19.75 3 21.725 25.025 29.275000000000002 23.974999999999998 4 24.7623811905953 30.81540770385193 21.1855927963982 23.23661830915458 5 28.189094547273637 31.240620310155077 20.735367683841922 19.834917458729365 6 21.6 36.475 21.5 20.424999999999997 7 22.475 19.7 34.725 23.1 8 24.65 23.35 25.674999999999997 26.325 9 23.425 22.525000000000002 29.7 24.349999999999998 10-14 25.679999999999996 26.669999999999998 23.685000000000002 23.965 15-19 25.3 26.150000000000002 25.095 23.455000000000002 20-24 25.645 26.27 24.15 23.935000000000002 25-29 25.36 25.775 25.46 23.405 30-34 24.87 25.955000000000002 25.395 23.78 35-39 25.25 26.38 24.66 23.71 40-44 26.1 25.724999999999998 24.975 23.200000000000003 45-49 24.915000000000003 26.779999999999998 25.105 23.200000000000003 50-54 25.845000000000002 25.929999999999996 25.05 23.175 55-59 26.255 25.995 24.740000000000002 23.01 60-64 25.665 25.805 25.259999999999998 23.27 65-69 25.36 26.284999999999997 24.865000000000002 23.49 70-74 26.025 25.585 25.335 23.055 75-79 25.230000000000004 25.840000000000003 25.080000000000002 23.849999999999998 80-84 25.85 25.374999999999996 25.395 23.380000000000003 85-89 25.380000000000003 25.595000000000002 25.645 23.380000000000003 90-94 25.44 26.33 24.975 23.255 95-99 25.14 26.265 25.355 23.24 100-104 25.505 25.86 25.380000000000003 23.255 105-109 25.155 26.02 25.865 22.96 110-114 26.13 26.055 24.975 22.84 115-119 25.785000000000004 25.535000000000004 25.575 23.105 120-124 25.985000000000003 25.785000000000004 25.569999999999997 22.66 125-129 25.09 26.36 25.275 23.275000000000002 130-134 25.655 26.8 25.0 22.545 135-139 25.71 25.825 25.740000000000002 22.725 140-144 26.365 26.305 25.324999999999996 22.005 145-149 26.215 26.029999999999998 25.130000000000003 22.625 150-151 25.687500000000004 26.5375 25.162499999999998 22.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.5 27 3.5 28 6.0 29 6.0 30 10.0 31 12.0 32 12.0 33 18.0 34 25.0 35 38.0 36 46.5 37 53.5 38 74.0 39 96.0 40 125.5 41 166.5 42 195.0 43 191.0 44 188.0 45 209.5 46 220.0 47 205.5 48 190.0 49 182.0 50 165.0 51 140.0 52 125.5 53 122.0 54 108.0 55 107.0 56 99.5 57 85.0 58 81.5 59 77.0 60 74.5 61 67.5 62 56.0 63 49.0 64 49.0 65 47.0 66 50.0 67 41.0 68 28.5 69 31.5 70 32.5 71 24.0 72 16.0 73 15.0 74 11.0 75 5.5 76 4.0 77 1.5 78 2.0 79 2.0 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.7315842583249244 1.4500000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.0875000000000004 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7125000000000004 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135620 spots for SRR6958156.sra Written 1135620 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra Read 1135614 spots for SRR6958156.sra Written 1135614 spots for SRR6958156.sra SRR ids: ['SRR6958156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0qbdvcw0 SRR6958156.sra spots: 22712286 blocks: [[1, 1135614], [1135615, 2271228], [2271229, 3406842], [3406843, 4542456], [4542457, 5678070], [5678071, 6813684], [6813685, 7949298], [7949299, 9084912], [9084913, 10220526], [10220527, 11356140], [11356141, 12491754], [12491755, 13627368], [13627369, 14762982], [14762983, 15898596], [15898597, 17034210], [17034211, 18169824], [18169825, 19305438], [19305439, 20441052], [20441053, 21576666], [21576667, 22712286]] SRR6958156 file size 7674748 SRR6958156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958156 SRR6958156_1.fastq SRR6958156_2.fastq Input file: SRR6958156_1.fastq Paired file: SRR6958156_2.fastq trimmed: SRR6958156-trimmed-pair1.fastq, SRR6958156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:41:34 2024 >> started Fri Dec 6 14:41:58 2024 >> done (23.710s) 22712286 read pairs processed; of these: 11043 ( 0.05%) short read pairs filtered out after trimming by size control 9691 ( 0.04%) empty read pairs filtered out after trimming by size control 22691552 (99.91%) read pairs available; of these: 8462997 (37.30%) trimmed read pairs available after processing 14228555 (62.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 6 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 8 0.00% 31 6 0.00% 32 10 0.00% 33 23 0.00% 34 16 0.00% 35 12 0.00% 36 18 0.00% 37 11 0.00% 38 16 0.00% 39 14 0.00% 40 14 0.00% 41 10 0.00% 42 12 0.00% 43 16 0.00% 44 26 0.00% 45 19 0.00% 46 22 0.00% 47 24 0.00% 48 37 0.00% 49 48 0.00% 50 48 0.00% 51 43 0.00% 52 49 0.00% 53 48 0.00% 54 71 0.00% 55 77 0.00% 56 72 0.00% 57 95 0.00% 58 84 0.00% 59 114 0.00% 60 130 0.00% 61 141 0.00% 62 130 0.00% 63 140 0.00% 64 196 0.00% 65 215 0.00% 66 214 0.00% 67 269 0.00% 68 294 0.00% 69 365 0.00% 70 362 0.00% 71 386 0.00% 72 450 0.00% 73 523 0.00% 74 587 0.00% 75 621 0.00% 76 758 0.00% 77 796 0.00% 78 903 0.00% 79 1085 0.00% 80 1190 0.01% 81 1272 0.01% 82 1455 0.01% 83 1664 0.01% 84 2357 0.01% 85 2834 0.01% 86 3050 0.01% 87 3254 0.01% 88 3506 0.02% 89 3897 0.02% 90 3683 0.02% 91 4175 0.02% 92 4552 0.02% 93 4779 0.02% 94 5255 0.02% 95 6065 0.03% 96 5921 0.03% 97 6417 0.03% 98 6528 0.03% 99 7051 0.03% 100 7542 0.03% 101 8030 0.04% 102 8649 0.04% 103 9214 0.04% 104 9681 0.04% 105 10384 0.05% 106 10914 0.05% 107 11595 0.05% 108 12246 0.05% 109 13052 0.06% 110 13736 0.06% 111 14592 0.06% 112 15345 0.07% 113 16484 0.07% 114 16915 0.07% 115 18409 0.08% 116 19367 0.09% 117 20103 0.09% 118 21423 0.09% 119 22495 0.10% 120 23616 0.10% 121 24335 0.11% 122 25656 0.11% 123 26985 0.12% 124 28453 0.13% 125 30348 0.13% 126 31683 0.14% 127 33457 0.15% 128 35298 0.16% 129 37247 0.16% 130 39190 0.17% 131 41717 0.18% 132 44372 0.20% 133 47054 0.21% 134 50632 0.22% 135 53844 0.24% 136 57169 0.25% 137 61233 0.27% 138 66182 0.29% 139 72165 0.32% 140 79018 0.35% 141 86556 0.38% 142 97255 0.43% 143 111634 0.49% 144 130253 0.57% 145 159323 0.70% 146 201812 0.89% 147 278413 1.23% 148 431919 1.90% 149 879396 3.88% 150 4808008 21.19% 151 14228555 62.70% 22691552 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=25 prefix-density=0.42 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=91.10 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.0 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCGCCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=74.97 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.3 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958156 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:42:46 Started mapping on | Dec 06 14:42:46 Finished on | Dec 06 14:44:36 Mapping speed, Million of reads per hour | 742.63 Number of input reads | 22691552 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22312597 Uniquely mapped reads % | 98.33% Average mapped length | 297.63 Number of splices: Total | 26766264 Number of splices: Annotated (sjdb) | 25266742 Number of splices: GT/AG | 26428442 Number of splices: GC/AG | 307928 Number of splices: AT/AC | 10705 Number of splices: Non-canonical | 19189 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163362 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 8887 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 222558 222558 222558 N_multimapping 163362 163362 163362 N_noFeature 834391 21695667 1023520 N_ambiguous 509035 2880 82485 UnstrandedReadsAssigned:20969171 PositiveStrandReadsAssigned:614050 NegativeStrandReadsAssigned:21206592 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958156-trimmed-pair1.fastq SRR6958156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,691,552 reads, 21,249,286 reads pseudoaligned [quant] estimated average fragment length: 271.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6958156.ke.tsv 35125 SRR6958156.se.tsv 88098 total ==> SRR6958156.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.588 0 0 PNS24247 1044 773.169 68.059 6.27636 PNS24249 1928 1657.17 49.1572 2.11503 PNS24246 1044 773.169 68.059 6.27636 PNS24248 1044 773.169 68.059 6.27636 PNS24244 1471 1200.17 18.6656 1.10891 PNS24243 293 78.5721 0 0 KQK14069 1603 1332.17 4051.95 216.871 KQK14071 474 217.86 102.082 33.4093 ==> SRR6958156.se.tsv <== BRADI_1g14170v3 4716 BRADI_1g53295v3 450 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 313 BRADI_1g74790v3 153 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR6958156 completed mapping pipeline successfully