Starting /dee2/code/volunteer_pipeline.sh SRR6958157 current disk space = 1550524596224 free memory = 1600464460 SRR6958157 SRAfilesize b838af1e1476c246a80e3b621f1222e8 SRR6958157.sra SRR6958157.sra file validated SRR6958157 is paired end SRR6958157 is conventional basespace SRR6958157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.58025 32.0 25.0 33.0 18.0 33.0 2 28.822 31.0 27.0 33.0 18.0 33.0 3 31.61675 33.0 31.0 33.0 28.0 34.0 4 32.665 33.0 33.0 33.0 32.0 34.0 5 33.10475 33.0 33.0 34.0 33.0 34.0 6 36.87075 38.0 37.0 38.0 36.0 38.0 7 37.45175 38.0 38.0 38.0 37.0 38.0 8 37.465 38.0 38.0 38.0 37.0 38.0 9 36.5205 38.0 38.0 38.0 34.0 38.0 10-14 37.34065 38.0 38.0 38.0 36.8 38.0 15-19 37.4338 38.0 38.0 38.0 37.0 38.0 20-24 37.495799999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.33755 38.0 38.0 38.0 37.0 38.0 30-34 37.64450000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.545 38.0 38.0 38.0 37.6 38.0 40-44 37.6275 38.0 38.0 38.0 38.0 38.0 45-49 37.556349999999995 38.0 38.0 38.0 37.8 38.0 50-54 37.404250000000005 38.0 38.0 38.0 37.2 38.0 55-59 37.10765 38.0 38.0 38.0 36.0 38.0 60-64 36.857 38.0 38.0 38.0 35.2 38.0 65-69 37.23915 38.0 38.0 38.0 36.2 38.0 70-74 37.15465 38.0 38.0 38.0 36.0 38.0 75-79 37.2931 38.0 38.0 38.0 36.4 38.0 80-84 37.1628 38.0 38.0 38.0 36.0 38.0 85-89 37.0516 38.0 38.0 38.0 35.8 38.0 90-94 37.05 38.0 38.0 38.0 36.0 38.0 95-99 36.96445 38.0 38.0 38.0 35.4 38.0 100-104 36.7362 38.0 38.0 38.0 34.6 38.0 105-109 36.723400000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.4532 38.0 37.8 38.0 34.0 38.0 115-119 36.430099999999996 38.0 37.8 38.0 34.0 38.0 120-124 36.3421 38.0 37.6 38.0 34.0 38.0 125-129 36.008649999999996 38.0 37.0 38.0 33.0 38.0 130-134 35.81845 38.0 36.0 38.0 32.4 38.0 135-139 35.75845 38.0 36.2 38.0 32.2 38.0 140-144 35.27885 38.0 35.6 38.0 31.0 38.0 145-149 34.6048 38.0 35.2 38.0 27.8 38.0 150-151 31.035249999999998 35.5 29.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 2.0 20 2.0 21 1.0 22 5.0 23 3.0 24 6.0 25 8.0 26 6.0 27 10.0 28 15.0 29 21.0 30 30.0 31 31.0 32 54.0 33 79.0 34 169.0 35 321.0 36 750.0 37 2484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.50799381124291 10.237235688499226 8.303249097472925 45.95152140278494 2 19.05 15.475 37.65 27.825 3 19.75 17.150000000000002 24.925 38.175 4 24.75 25.374999999999996 21.85 28.025 5 26.0 29.4 24.0 20.599999999999998 6 21.525 33.825 24.75 19.900000000000002 7 16.725 25.95 40.225 17.1 8 20.175 24.3 30.875000000000004 24.65 9 19.2 23.849999999999998 32.475 24.474999999999998 10-14 21.46 28.560000000000002 26.484999999999996 23.494999999999997 15-19 21.62 27.29 26.935 24.154999999999998 20-24 22.255 27.82 26.515 23.41 25-29 21.75 28.22 26.16 23.87 30-34 21.7 27.245 27.18 23.875 35-39 22.255 27.265 26.815 23.665 40-44 21.990000000000002 26.96 27.145000000000003 23.905 45-49 22.005 26.715 26.779999999999998 24.5 50-54 21.586872780029015 27.645204862674472 26.219420681374757 24.54850167592176 55-59 21.22606130306515 27.481374068703435 26.756337816890845 24.536226811340565 60-64 21.86218621862186 26.392639263926394 27.127712771277128 24.61746174617462 65-69 22.155 26.735 26.52 24.59 70-74 22.155 26.35 26.87 24.625 75-79 21.884999999999998 26.924999999999997 26.82 24.37 80-84 22.28 26.58 27.12 24.02 85-89 21.995 27.1 26.86 24.044999999999998 90-94 22.07 26.755000000000003 26.625 24.55 95-99 22.24 26.82 26.840000000000003 24.099999999999998 100-104 21.877187718771875 27.15271527152715 26.172617261726174 24.797479747974798 105-109 22.428364254638193 26.618992848927338 26.90903635545332 24.04360654098115 110-114 22.768214571657325 26.956565252201763 26.551240992794234 23.723979183346678 115-119 22.60695521641231 26.975231423567674 26.705028771578682 23.71278458844133 120-124 22.46 27.500000000000004 25.569999999999997 24.47 125-129 22.866740198536046 26.862528827835153 26.71713626792339 23.553594705705404 130-134 22.39403492969024 26.982935495170896 26.457488865535705 24.16554070960316 135-139 22.36 26.369999999999997 26.495 24.775 140-144 22.52 26.755000000000003 26.575 24.15 145-149 22.415 26.640000000000004 26.76 24.185000000000002 150-151 22.225 26.4625 26.737499999999997 24.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.0 27 1.0 28 6.0 29 10.0 30 12.5 31 19.5 32 28.5 33 37.5 34 43.5 35 47.5 36 57.0 37 82.0 38 102.5 39 126.5 40 158.0 41 195.5 42 228.5 43 244.5 44 242.0 45 235.5 46 241.5 47 224.0 48 212.0 49 206.0 50 178.0 51 144.5 52 111.0 53 96.5 54 88.0 55 78.0 56 74.5 57 61.0 58 53.0 59 48.0 60 37.0 61 36.5 62 38.0 63 31.5 64 23.5 65 19.5 66 18.0 67 16.5 68 17.0 69 16.0 70 14.0 71 12.0 72 7.5 73 5.0 74 3.5 75 2.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.055 55-59 0.005 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.015 110-114 0.08 115-119 0.075 120-124 0.0 125-129 0.27 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.1 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCCC 10 0.006916044 144.40001 9 >>END_MODULE SRR6958157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2545 34.0 33.0 34.0 33.0 34.0 2 33.33525 34.0 33.0 34.0 33.0 34.0 3 33.37075 34.0 33.0 34.0 33.0 34.0 4 33.33575 34.0 33.0 34.0 33.0 34.0 5 33.38475 34.0 33.0 34.0 33.0 34.0 6 37.50275 38.0 38.0 38.0 38.0 38.0 7 37.57025 38.0 38.0 38.0 38.0 38.0 8 37.5495 38.0 38.0 38.0 38.0 38.0 9 33.943 38.0 34.0 38.0 16.0 38.0 10-14 37.2218 38.0 37.8 38.0 36.0 38.0 15-19 36.058800000000005 38.0 37.0 38.0 31.4 38.0 20-24 37.4554 38.0 38.0 38.0 37.8 38.0 25-29 37.513799999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.55065 38.0 38.0 38.0 38.0 38.0 35-39 37.5689 38.0 38.0 38.0 38.0 38.0 40-44 37.53715 38.0 38.0 38.0 38.0 38.0 45-49 37.507799999999996 38.0 38.0 38.0 38.0 38.0 50-54 36.6157 38.0 37.8 38.0 33.6 38.0 55-59 37.42195 38.0 38.0 38.0 37.8 38.0 60-64 37.479 38.0 38.0 38.0 38.0 38.0 65-69 37.4414 38.0 38.0 38.0 38.0 38.0 70-74 37.3957 38.0 38.0 38.0 37.8 38.0 75-79 37.35995 38.0 38.0 38.0 37.2 38.0 80-84 37.36865 38.0 38.0 38.0 37.4 38.0 85-89 37.33415 38.0 38.0 38.0 37.2 38.0 90-94 37.25825 38.0 38.0 38.0 37.0 38.0 95-99 37.1794 38.0 38.0 38.0 37.0 38.0 100-104 35.913 38.0 36.4 38.0 30.2 38.0 105-109 36.8505 38.0 38.0 38.0 35.4 38.0 110-114 34.36465 37.6 33.2 38.0 25.2 38.0 115-119 36.702099999999994 38.0 38.0 38.0 34.8 38.0 120-124 35.2068 38.0 35.4 38.0 28.4 38.0 125-129 36.6776 38.0 38.0 38.0 35.0 38.0 130-134 33.415749999999996 37.6 32.0 38.0 21.8 38.0 135-139 34.8521 38.0 35.2 38.0 26.6 38.0 140-144 35.29664999999999 38.0 35.8 38.0 30.6 38.0 145-149 35.40505 38.0 37.0 38.0 31.0 38.0 150-151 31.973 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 1.0 17 3.0 18 0.0 19 1.0 20 2.0 21 3.0 22 5.0 23 4.0 24 4.0 25 7.0 26 8.0 27 12.0 28 14.0 29 28.0 30 20.0 31 22.0 32 54.0 33 72.0 34 142.0 35 273.0 36 880.0 37 2432.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.550000000000004 17.825 12.65 36.975 2 29.2 23.025000000000002 29.375 18.4 3 21.475 26.125 29.125 23.275000000000002 4 25.2 31.65 22.25 20.9 5 26.700000000000003 32.675 21.925 18.7 6 21.95 38.175 21.425 18.45 7 21.349999999999998 19.225 38.25 21.175 8 23.5 24.224999999999998 26.674999999999997 25.6 9 23.200000000000003 23.775 28.000000000000004 25.025 10-14 24.740000000000002 27.689999999999998 24.605 22.965 15-19 24.65 26.71 25.8 22.84 20-24 24.87 26.845000000000002 25.555 22.73 25-29 24.72 26.965 25.705 22.61 30-34 24.535 26.58 26.08 22.805 35-39 24.22 27.134999999999998 26.119999999999997 22.525000000000002 40-44 24.365000000000002 26.955000000000002 25.85 22.830000000000002 45-49 24.89 26.465 26.13 22.515 50-54 24.75 26.735 26.395000000000003 22.12 55-59 24.52 26.655 26.540000000000003 22.285 60-64 24.255 26.845000000000002 26.265 22.634999999999998 65-69 24.385 26.479999999999997 26.779999999999998 22.355 70-74 24.43 26.76 26.68 22.13 75-79 24.224999999999998 26.685 26.790000000000003 22.3 80-84 25.03 26.83 25.845000000000002 22.295 85-89 24.605 26.915 26.36 22.12 90-94 24.585 27.145000000000003 26.07 22.2 95-99 24.474999999999998 26.705000000000002 26.14 22.68 100-104 24.645 26.505000000000003 26.83 22.02 105-109 24.085 27.42 26.3 22.195 110-114 24.455 27.37 25.965 22.21 115-119 24.7 26.669999999999998 26.484999999999996 22.145 120-124 24.995 26.56 26.405 22.040000000000003 125-129 25.145 26.484999999999996 26.97 21.4 130-134 24.995 27.52 25.979999999999997 21.505 135-139 24.709999999999997 27.29 26.669999999999998 21.33 140-144 25.21 27.105 26.200000000000003 21.485000000000003 145-149 25.435000000000002 27.045 25.865 21.654999999999998 150-151 25.4875 26.687499999999996 25.937500000000004 21.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 2.5 26 2.5 27 3.5 28 7.5 29 9.5 30 12.0 31 19.5 32 22.0 33 25.5 34 35.5 35 52.5 36 60.0 37 65.5 38 96.0 39 116.5 40 136.0 41 161.0 42 188.5 43 211.0 44 222.0 45 241.0 46 243.5 47 235.5 48 211.5 49 187.0 50 179.0 51 160.0 52 135.5 53 115.5 54 98.0 55 84.5 56 74.0 57 73.5 58 73.0 59 67.0 60 64.0 61 55.0 62 42.0 63 33.5 64 29.5 65 25.5 66 18.5 67 16.0 68 19.0 69 14.5 70 12.0 71 10.0 72 9.0 73 10.0 74 5.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACTGG 10 0.006830828 145.0 8 >>END_MODULE Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704620 spots for SRR6958157.sra Written 704620 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra Read 704612 spots for SRR6958157.sra Written 704612 spots for SRR6958157.sra SRR ids: ['SRR6958157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0pddczet SRR6958157.sra spots: 14092248 blocks: [[1, 704612], [704613, 1409224], [1409225, 2113836], [2113837, 2818448], [2818449, 3523060], [3523061, 4227672], [4227673, 4932284], [4932285, 5636896], [5636897, 6341508], [6341509, 7046120], [7046121, 7750732], [7750733, 8455344], [8455345, 9159956], [9159957, 9864568], [9864569, 10569180], [10569181, 11273792], [11273793, 11978404], [11978405, 12683016], [12683017, 13387628], [13387629, 14092248]] SRR6958157 file size 4753700 SRR6958157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958157 SRR6958157_1.fastq SRR6958157_2.fastq Input file: SRR6958157_1.fastq Paired file: SRR6958157_2.fastq trimmed: SRR6958157-trimmed-pair1.fastq, SRR6958157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:35:45 2024 >> started Fri Dec 6 14:36:00 2024 >> done (15.180s) 14092248 read pairs processed; of these: 6902 ( 0.05%) short read pairs filtered out after trimming by size control 8338 ( 0.06%) empty read pairs filtered out after trimming by size control 14077008 (99.89%) read pairs available; of these: 5824096 (41.37%) trimmed read pairs available after processing 8252912 (58.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 5 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 1 0.00% 30 5 0.00% 31 1 0.00% 32 6 0.00% 33 6 0.00% 34 8 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 4 0.00% 39 3 0.00% 40 10 0.00% 41 13 0.00% 42 7 0.00% 43 5 0.00% 44 14 0.00% 45 9 0.00% 46 7 0.00% 47 20 0.00% 48 5 0.00% 49 16 0.00% 50 17 0.00% 51 18 0.00% 52 28 0.00% 53 29 0.00% 54 25 0.00% 55 41 0.00% 56 30 0.00% 57 38 0.00% 58 54 0.00% 59 53 0.00% 60 53 0.00% 61 54 0.00% 62 72 0.00% 63 94 0.00% 64 98 0.00% 65 100 0.00% 66 95 0.00% 67 122 0.00% 68 142 0.00% 69 173 0.00% 70 182 0.00% 71 222 0.00% 72 244 0.00% 73 254 0.00% 74 320 0.00% 75 322 0.00% 76 408 0.00% 77 437 0.00% 78 504 0.00% 79 537 0.00% 80 639 0.00% 81 667 0.00% 82 823 0.01% 83 973 0.01% 84 1231 0.01% 85 1493 0.01% 86 1658 0.01% 87 1777 0.01% 88 1948 0.01% 89 2002 0.01% 90 2180 0.02% 91 2411 0.02% 92 2555 0.02% 93 2851 0.02% 94 3153 0.02% 95 3449 0.02% 96 3743 0.03% 97 3933 0.03% 98 4305 0.03% 99 5194 0.04% 100 5307 0.04% 101 6084 0.04% 102 5494 0.04% 103 5777 0.04% 104 6273 0.04% 105 6675 0.05% 106 7212 0.05% 107 7619 0.05% 108 8167 0.06% 109 8615 0.06% 110 9093 0.06% 111 9370 0.07% 112 10080 0.07% 113 10409 0.07% 114 11482 0.08% 115 12071 0.09% 116 12659 0.09% 117 13207 0.09% 118 14033 0.10% 119 14568 0.10% 120 15103 0.11% 121 15733 0.11% 122 16668 0.12% 123 17815 0.13% 124 18545 0.13% 125 19423 0.14% 126 20717 0.15% 127 21691 0.15% 128 22608 0.16% 129 23905 0.17% 130 25583 0.18% 131 26592 0.19% 132 28390 0.20% 133 30452 0.22% 134 32577 0.23% 135 35247 0.25% 136 37651 0.27% 137 40238 0.29% 138 42570 0.30% 139 46504 0.33% 140 51023 0.36% 141 55910 0.40% 142 63061 0.45% 143 70787 0.50% 144 83194 0.59% 145 102573 0.73% 146 130840 0.93% 147 182357 1.30% 148 290097 2.06% 149 600950 4.27% 150 3419162 24.29% 151 8252912 58.63% 14077008 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=34.74 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=17 prefix-density=0.47 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=122.35 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958157 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:37:05 Started mapping on | Dec 06 14:37:05 Finished on | Dec 06 14:38:24 Mapping speed, Million of reads per hour | 641.48 Number of input reads | 14077008 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13202853 Uniquely mapped reads % | 93.79% Average mapped length | 293.04 Number of splices: Total | 15679702 Number of splices: Annotated (sjdb) | 14778593 Number of splices: GT/AG | 15464603 Number of splices: GC/AG | 178578 Number of splices: AT/AC | 5999 Number of splices: Non-canonical | 30522 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153818 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 4967 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725669 725669 725669 N_multimapping 153818 153818 153818 N_noFeature 552310 12778007 672696 N_ambiguous 359085 1862 55618 UnstrandedReadsAssigned:12291458 PositiveStrandReadsAssigned:422984 NegativeStrandReadsAssigned:12474539 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958157-trimmed-pair1.fastq SRR6958157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,077,008 reads, 12,974,066 reads pseudoaligned [quant] estimated average fragment length: 238.757 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR6958157.ke.tsv 35125 SRR6958157.se.tsv 88098 total ==> SRR6958157.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.6 0 0 PNS24247 1044 806.243 35.6866 5.37259 PNS24249 1928 1690.24 20.9143 1.50189 PNS24246 1044 806.243 35.6866 5.37259 PNS24248 1044 806.243 35.6866 5.37259 PNS24244 1471 1233.24 26.0258 2.56153 PNS24243 293 85.7407 0 0 KQK14069 1603 1365.24 4541.42 403.761 KQK14071 474 240.802 74.8992 37.7537 ==> SRR6958157.se.tsv <== BRADI_1g14170v3 4803 BRADI_1g53295v3 885 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 250 BRADI_1g74790v3 65 BRADI_1g09890v3 0 BRADI_1g77505v3 166 BRADI_1g48960v3 0 SRR6958157 completed mapping pipeline successfully