Starting /dee2/code/volunteer_pipeline.sh SRR6958158 current disk space = 1550512205824 free memory = 1358428072 SRR6958158 SRAfilesize 02bc887c9f880476caa780de871bc11b SRR6958158.sra SRR6958158.sra file validated SRR6958158 is paired end SRR6958158 is conventional basespace SRR6958158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09825 33.0 32.0 33.0 27.0 34.0 2 31.9375 33.0 31.0 34.0 28.0 34.0 3 31.92325 33.0 31.0 34.0 28.0 34.0 4 31.87375 33.0 31.0 33.0 29.0 34.0 5 32.3705 33.0 33.0 34.0 31.0 34.0 6 36.25825 38.0 37.0 38.0 33.0 38.0 7 36.4005 38.0 37.0 38.0 33.0 38.0 8 36.92875 38.0 38.0 38.0 35.0 38.0 9 36.937 38.0 38.0 38.0 35.0 38.0 10-14 37.16325 38.0 38.0 38.0 36.0 38.0 15-19 37.16335 38.0 38.0 38.0 36.0 38.0 20-24 37.24675 38.0 38.0 38.0 36.8 38.0 25-29 37.1048 38.0 38.0 38.0 36.2 38.0 30-34 36.89155000000001 38.0 38.0 38.0 35.4 38.0 35-39 36.933800000000005 38.0 38.0 38.0 35.6 38.0 40-44 36.7638 38.0 38.0 38.0 34.6 38.0 45-49 36.9252 38.0 38.0 38.0 35.2 38.0 50-54 36.9239 38.0 38.0 38.0 35.4 38.0 55-59 36.63945 38.0 38.0 38.0 34.4 38.0 60-64 36.686499999999995 38.0 38.0 38.0 34.2 38.0 65-69 36.7126 38.0 38.0 38.0 34.6 38.0 70-74 36.76875 38.0 38.0 38.0 34.6 38.0 75-79 36.66515 38.0 38.0 38.0 34.4 38.0 80-84 36.28995 38.0 37.8 38.0 33.4 38.0 85-89 36.2659 38.0 37.4 38.0 33.0 38.0 90-94 36.3636 38.0 37.6 38.0 33.6 38.0 95-99 36.304649999999995 38.0 37.4 38.0 33.2 38.0 100-104 36.06515 38.0 37.0 38.0 32.6 38.0 105-109 35.674249999999994 38.0 36.2 38.0 30.8 38.0 110-114 35.619 38.0 36.0 38.0 30.6 38.0 115-119 35.49465 38.0 36.0 38.0 30.4 38.0 120-124 35.3955 38.0 36.0 38.0 30.6 38.0 125-129 35.0182 38.0 35.4 38.0 28.2 38.0 130-134 34.731500000000004 38.0 35.0 38.0 27.0 38.0 135-139 34.377199999999995 38.0 34.8 38.0 25.4 38.0 140-144 34.08345 38.0 34.2 38.0 24.0 38.0 145-149 32.8807 38.0 33.6 38.0 17.2 38.0 150-151 28.144 36.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 6.0 20 0.0 21 5.0 22 10.0 23 8.0 24 12.0 25 10.0 26 16.0 27 37.0 28 39.0 29 54.0 30 73.0 31 93.0 32 101.0 33 143.0 34 218.0 35 364.0 36 827.0 37 1979.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.260462698206396 9.331946971666232 9.461918377956849 46.94567195217052 2 22.62828535669587 11.589486858573217 36.195244055068834 29.586983729662077 3 19.6 14.649999999999999 24.425 41.325 4 25.224999999999998 22.05 22.8 29.925 5 26.688344172086044 27.5887943971986 24.73736868434217 20.985492746373186 6 22.275 31.05 24.375 22.3 7 18.075 25.525 36.6 19.8 8 20.599999999999998 23.7 30.125 25.575 9 19.05 22.45 33.95 24.55 10-14 21.905 26.889999999999997 26.36 24.845 15-19 21.945 25.674999999999997 26.645000000000003 25.735000000000003 20-24 22.415 25.715 26.450000000000003 25.419999999999998 25-29 22.915 25.6 26.369999999999997 25.115 30-34 22.13 25.580000000000002 26.490000000000002 25.8 35-39 22.185 25.28 26.834999999999997 25.7 40-44 22.425 25.845000000000002 26.035000000000004 25.695 45-49 22.805 25.905 25.805 25.485000000000003 50-54 22.884999999999998 25.495 25.874999999999996 25.745 55-59 22.865 25.61 25.840000000000003 25.685000000000002 60-64 22.865 24.9 26.505000000000003 25.729999999999997 65-69 22.564999999999998 25.82 26.195 25.419999999999998 70-74 22.884999999999998 25.155 26.384999999999998 25.575 75-79 22.56 25.39 26.405 25.645 80-84 22.97 25.624999999999996 25.705 25.7 85-89 22.955000000000002 25.22 25.929999999999996 25.895000000000003 90-94 22.745 25.650000000000002 25.929999999999996 25.674999999999997 95-99 22.93 25.555 25.665 25.85 100-104 22.785 25.345000000000002 26.200000000000003 25.669999999999998 105-109 23.599999999999998 24.535 26.505000000000003 25.36 110-114 22.585 25.865 25.955000000000002 25.595000000000002 115-119 22.535 25.480000000000004 25.96 26.025 120-124 22.945 24.87 26.555 25.629999999999995 125-129 23.085 24.965 26.545 25.405 130-134 23.29 24.935 26.634999999999998 25.14 135-139 23.225 25.424999999999997 25.474999999999998 25.874999999999996 140-144 23.415 25.419999999999998 25.645 25.52 145-149 23.544999999999998 24.925 26.085 25.445 150-151 23.486743371685844 24.224612306153077 26.025512756378188 26.263131565782892 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 3.0 30 5.5 31 8.5 32 15.5 33 23.0 34 26.5 35 34.5 36 54.0 37 68.0 38 80.5 39 98.0 40 127.0 41 174.5 42 201.0 43 204.0 44 211.0 45 208.0 46 214.5 47 202.0 48 191.0 49 188.5 50 178.5 51 166.0 52 126.0 53 108.5 54 109.0 55 99.0 56 88.0 57 83.5 58 73.5 59 76.0 60 72.5 61 61.0 62 62.0 63 56.0 64 51.0 65 48.5 66 37.0 67 29.5 68 26.5 69 21.5 70 18.0 71 17.5 72 16.0 73 11.0 74 6.5 75 5.0 76 2.5 77 1.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.125 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80725 33.0 33.0 34.0 32.0 34.0 2 32.78075 33.0 33.0 34.0 32.0 34.0 3 32.76775 33.0 33.0 34.0 32.0 34.0 4 32.7675 33.0 33.0 34.0 32.0 34.0 5 32.78275 34.0 33.0 34.0 32.0 34.0 6 36.8455 38.0 38.0 38.0 35.0 38.0 7 36.90575 38.0 38.0 38.0 36.0 38.0 8 36.92025 38.0 38.0 38.0 36.0 38.0 9 36.87525 38.0 38.0 38.0 36.0 38.0 10-14 36.6758 38.0 38.0 38.0 34.8 38.0 15-19 36.60055 38.0 38.0 38.0 34.0 38.0 20-24 36.69315 38.0 38.0 38.0 34.8 38.0 25-29 36.81165 38.0 38.0 38.0 35.0 38.0 30-34 36.833800000000004 38.0 38.0 38.0 35.4 38.0 35-39 36.7444 38.0 38.0 38.0 34.6 38.0 40-44 36.614799999999995 38.0 38.0 38.0 34.2 38.0 45-49 36.52114999999999 38.0 38.0 38.0 34.0 38.0 50-54 36.60445 38.0 38.0 38.0 34.0 38.0 55-59 36.657650000000004 38.0 38.0 38.0 34.4 38.0 60-64 36.51835 38.0 38.0 38.0 34.0 38.0 65-69 36.36325000000001 38.0 38.0 38.0 33.8 38.0 70-74 36.3107 38.0 38.0 38.0 33.6 38.0 75-79 36.1973 38.0 38.0 38.0 33.0 38.0 80-84 36.07835 38.0 37.6 38.0 32.8 38.0 85-89 35.84255 38.0 37.0 38.0 31.6 38.0 90-94 35.86685 38.0 37.0 38.0 32.0 38.0 95-99 35.663 38.0 37.0 38.0 30.6 38.0 100-104 35.5674 38.0 36.6 38.0 30.6 38.0 105-109 35.280150000000006 38.0 36.0 38.0 28.8 38.0 110-114 35.01535 38.0 35.8 38.0 27.4 38.0 115-119 34.9243 38.0 35.2 38.0 27.6 38.0 120-124 34.779700000000005 38.0 35.0 38.0 27.0 38.0 125-129 34.56795 38.0 35.0 38.0 25.6 38.0 130-134 34.15115 38.0 34.6 38.0 23.2 38.0 135-139 33.69949999999999 38.0 34.0 38.0 21.8 38.0 140-144 33.443799999999996 38.0 34.0 38.0 20.2 38.0 145-149 32.67399999999999 38.0 33.4 38.0 15.0 38.0 150-151 28.129624999999997 35.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 2.0 13 2.0 14 0.0 15 7.0 16 5.0 17 4.0 18 7.0 19 7.0 20 7.0 21 6.0 22 9.0 23 19.0 24 16.0 25 25.0 26 27.0 27 38.0 28 50.0 29 66.0 30 79.0 31 83.0 32 107.0 33 153.0 34 227.0 35 330.0 36 668.0 37 2047.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.85 18.099999999999998 12.875 38.175 2 27.825 24.25 29.375 18.55 3 21.55 26.674999999999997 28.050000000000004 23.724999999999998 4 24.85 30.525000000000002 22.15 22.475 5 27.250000000000004 32.975 21.325 18.45 6 22.45 36.175000000000004 21.875 19.5 7 22.2 20.925 34.475 22.400000000000002 8 23.5 23.1 25.8 27.6 9 22.900000000000002 23.325000000000003 28.475 25.3 10-14 25.840000000000003 26.705000000000002 23.544999999999998 23.91 15-19 25.41 25.855 24.555 24.18 20-24 25.755 26.340000000000003 24.605 23.3 25-29 25.785000000000004 25.905 24.84 23.47 30-34 25.224999999999998 26.31 24.55 23.915 35-39 25.814999999999998 25.665 24.355 24.165 40-44 25.665 25.655 24.805 23.875 45-49 26.06 26.21 24.035 23.695 50-54 25.71 26.090000000000003 24.959999999999997 23.24 55-59 26.025 25.740000000000002 24.425 23.810000000000002 60-64 25.445 25.86 24.654999999999998 24.04 65-69 25.885 25.44 25.215 23.46 70-74 25.1 25.119999999999997 25.235000000000003 24.545 75-79 25.419999999999998 25.97 25.095 23.515 80-84 26.064999999999998 26.040000000000003 24.645 23.25 85-89 25.91 25.8 24.740000000000002 23.549999999999997 90-94 25.75 25.75 25.080000000000002 23.419999999999998 95-99 25.430000000000003 26.33 24.845 23.395 100-104 26.05 25.85 24.66 23.44 105-109 26.075 25.8 24.565 23.56 110-114 25.665 26.22 24.425 23.69 115-119 26.665 25.81 24.310000000000002 23.215 120-124 25.985000000000003 25.605 25.380000000000003 23.03 125-129 25.35 26.36 25.119999999999997 23.169999999999998 130-134 26.05 25.61 24.779999999999998 23.56 135-139 26.200000000000003 26.545 24.44 22.814999999999998 140-144 25.874999999999996 26.405 24.89 22.830000000000002 145-149 26.540000000000003 25.77 24.585 23.105 150-151 26.388194097048522 27.063531765882942 23.6368184092046 22.911455727863935 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 5.0 29 6.5 30 7.5 31 7.0 32 11.0 33 16.5 34 18.0 35 27.0 36 42.0 37 61.0 38 77.5 39 107.0 40 133.0 41 146.5 42 162.0 43 175.0 44 188.5 45 220.0 46 225.5 47 216.0 48 200.0 49 170.5 50 164.0 51 141.0 52 119.5 53 117.0 54 119.0 55 107.0 56 96.5 57 95.5 58 85.5 59 72.0 60 74.5 61 87.0 62 82.0 63 66.0 64 56.5 65 48.0 66 44.0 67 39.0 68 31.0 69 26.0 70 24.5 71 24.0 72 16.0 73 10.5 74 8.0 75 6.0 76 4.0 77 2.0 78 2.0 79 1.5 80 1.5 81 1.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.6819904016165698 1.35 3 0.17681232634503663 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTCT 10 0.006830828 145.0 6 >>END_MODULE Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323318 spots for SRR6958158.sra Written 1323318 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra Read 1323300 spots for SRR6958158.sra Written 1323300 spots for SRR6958158.sra SRR ids: ['SRR6958158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o8rnp6ft SRR6958158.sra spots: 26466018 blocks: [[1, 1323300], [1323301, 2646600], [2646601, 3969900], [3969901, 5293200], [5293201, 6616500], [6616501, 7939800], [7939801, 9263100], [9263101, 10586400], [10586401, 11909700], [11909701, 13233000], [13233001, 14556300], [14556301, 15879600], [15879601, 17202900], [17202901, 18526200], [18526201, 19849500], [19849501, 21172800], [21172801, 22496100], [22496101, 23819400], [23819401, 25142700], [25142701, 26466018]] SRR6958158 file size 8946764 SRR6958158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958158 SRR6958158_1.fastq SRR6958158_2.fastq Input file: SRR6958158_1.fastq Paired file: SRR6958158_2.fastq trimmed: SRR6958158-trimmed-pair1.fastq, SRR6958158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:39:45 2024 >> started Fri Dec 6 14:40:18 2024 >> done (32.969s) 26466018 read pairs processed; of these: 11584 ( 0.04%) short read pairs filtered out after trimming by size control 6802 ( 0.03%) empty read pairs filtered out after trimming by size control 26447632 (99.93%) read pairs available; of these: 9678754 (36.60%) trimmed read pairs available after processing 16768878 (63.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 8 0.00% 22 6 0.00% 23 8 0.00% 24 15 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 11 0.00% 29 3 0.00% 30 7 0.00% 31 14 0.00% 32 10 0.00% 33 14 0.00% 34 14 0.00% 35 22 0.00% 36 11 0.00% 37 23 0.00% 38 20 0.00% 39 19 0.00% 40 16 0.00% 41 23 0.00% 42 14 0.00% 43 12 0.00% 44 22 0.00% 45 17 0.00% 46 21 0.00% 47 32 0.00% 48 33 0.00% 49 38 0.00% 50 36 0.00% 51 52 0.00% 52 44 0.00% 53 40 0.00% 54 60 0.00% 55 59 0.00% 56 72 0.00% 57 76 0.00% 58 90 0.00% 59 89 0.00% 60 121 0.00% 61 117 0.00% 62 136 0.00% 63 147 0.00% 64 180 0.00% 65 217 0.00% 66 196 0.00% 67 226 0.00% 68 292 0.00% 69 285 0.00% 70 328 0.00% 71 374 0.00% 72 388 0.00% 73 449 0.00% 74 481 0.00% 75 507 0.00% 76 598 0.00% 77 726 0.00% 78 764 0.00% 79 785 0.00% 80 979 0.00% 81 1055 0.00% 82 1094 0.00% 83 1390 0.01% 84 1973 0.01% 85 2428 0.01% 86 2488 0.01% 87 2626 0.01% 88 2810 0.01% 89 2999 0.01% 90 3276 0.01% 91 3408 0.01% 92 3626 0.01% 93 3988 0.02% 94 4253 0.02% 95 4604 0.02% 96 4866 0.02% 97 5282 0.02% 98 5693 0.02% 99 6149 0.02% 100 6678 0.03% 101 7116 0.03% 102 7510 0.03% 103 8279 0.03% 104 8620 0.03% 105 9101 0.03% 106 9861 0.04% 107 10645 0.04% 108 11461 0.04% 109 12246 0.05% 110 12921 0.05% 111 13825 0.05% 112 14756 0.06% 113 15620 0.06% 114 16489 0.06% 115 17755 0.07% 116 18981 0.07% 117 20426 0.08% 118 21656 0.08% 119 22650 0.09% 120 24065 0.09% 121 25757 0.10% 122 26534 0.10% 123 28185 0.11% 124 29827 0.11% 125 31784 0.12% 126 33633 0.13% 127 35898 0.14% 128 38198 0.14% 129 40268 0.15% 130 42867 0.16% 131 45673 0.17% 132 48755 0.18% 133 51899 0.20% 134 55368 0.21% 135 59344 0.22% 136 64181 0.24% 137 69633 0.26% 138 74645 0.28% 139 81930 0.31% 140 89671 0.34% 141 99122 0.37% 142 112491 0.43% 143 128881 0.49% 144 150703 0.57% 145 185730 0.70% 146 232709 0.88% 147 321448 1.22% 148 503778 1.90% 149 1029461 3.89% 150 5576335 21.08% 151 16768878 63.40% 26447632 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=21 prefix-density=0.73 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=36.65 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=13 prefix-density=0.51 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=27.88 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958158 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:41:22 Started mapping on | Dec 06 14:41:22 Finished on | Dec 06 14:44:05 Mapping speed, Million of reads per hour | 584.12 Number of input reads | 26447632 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25715883 Uniquely mapped reads % | 97.23% Average mapped length | 297.56 Number of splices: Total | 30419159 Number of splices: Annotated (sjdb) | 28660122 Number of splices: GT/AG | 30000326 Number of splices: GC/AG | 352908 Number of splices: AT/AC | 11801 Number of splices: Non-canonical | 54124 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323035 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 16883 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416432 416432 416432 N_multimapping 323035 323035 323035 N_noFeature 963790 24902883 1169761 N_ambiguous 707292 3112 101549 UnstrandedReadsAssigned:24044801 PositiveStrandReadsAssigned:809888 NegativeStrandReadsAssigned:24444573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958158-trimmed-pair1.fastq SRR6958158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,447,632 reads, 24,407,419 reads pseudoaligned [quant] estimated average fragment length: 279.528 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR6958158.ke.tsv 35125 SRR6958158.se.tsv 88098 total ==> SRR6958158.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.006 0 0 PNS24247 1044 765.472 78.5517 6.15553 PNS24249 1928 1649.47 35.4296 1.28843 PNS24246 1044 765.472 78.5517 6.15553 PNS24248 1044 765.472 78.5517 6.15553 PNS24244 1471 1192.47 49.9153 2.51087 PNS24243 293 75.7524 0 0 KQK14069 1603 1324.47 6783.49 307.22 KQK14071 474 212.564 127.36 35.9405 ==> SRR6958158.se.tsv <== BRADI_1g14170v3 8081 BRADI_1g53295v3 2522 BRADI_1g59795v3 153 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 552 BRADI_1g74790v3 125 BRADI_1g09890v3 0 BRADI_1g77505v3 373 BRADI_1g48960v3 0 SRR6958158 completed mapping pipeline successfully