Starting /dee2/code/volunteer_pipeline.sh SRR6958159 current disk space = 1550509281280 free memory = 1601812676 SRR6958159 SRAfilesize 0ea1d94cd5554bfce3bfa1f424965396 SRR6958159.sra SRR6958159.sra file validated SRR6958159 is paired end SRR6958159 is conventional basespace SRR6958159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0555 30.0 18.0 33.0 18.0 33.0 2 29.138 31.0 27.0 33.0 18.0 33.0 3 31.19325 33.0 30.0 33.0 27.0 33.0 4 32.739 33.0 33.0 33.0 32.0 34.0 5 32.82325 33.0 33.0 34.0 32.0 34.0 6 36.7515 38.0 37.0 38.0 34.0 38.0 7 37.1605 38.0 38.0 38.0 36.0 38.0 8 35.99425 38.0 38.0 38.0 31.0 38.0 9 37.2275 38.0 38.0 38.0 36.0 38.0 10-14 36.5053 38.0 36.8 38.0 31.4 38.0 15-19 37.46510000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.6434 38.0 38.0 38.0 38.0 38.0 25-29 37.59925 38.0 38.0 38.0 38.0 38.0 30-34 37.53185 38.0 38.0 38.0 38.0 38.0 35-39 37.323150000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.5176 38.0 38.0 38.0 37.8 38.0 45-49 37.545300000000005 38.0 38.0 38.0 38.0 38.0 50-54 36.71085 38.0 37.6 38.0 32.4 38.0 55-59 37.2961 38.0 38.0 38.0 36.8 38.0 60-64 37.3431 38.0 38.0 38.0 37.0 38.0 65-69 37.416700000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.429700000000004 38.0 38.0 38.0 37.2 38.0 75-79 37.0045 38.0 38.0 38.0 35.6 38.0 80-84 37.18125 38.0 38.0 38.0 36.0 38.0 85-89 37.3744 38.0 38.0 38.0 37.0 38.0 90-94 35.57445 38.0 35.2 38.0 29.8 38.0 95-99 36.94695 38.0 38.0 38.0 35.2 38.0 100-104 37.07340000000001 38.0 38.0 38.0 35.8 38.0 105-109 36.93405 38.0 38.0 38.0 35.0 38.0 110-114 36.831849999999996 38.0 38.0 38.0 34.8 38.0 115-119 36.49865 38.0 37.6 38.0 33.8 38.0 120-124 36.411350000000006 38.0 37.8 38.0 34.0 38.0 125-129 36.34265 38.0 38.0 38.0 34.0 38.0 130-134 36.29889999999999 38.0 38.0 38.0 34.0 38.0 135-139 36.1606 38.0 38.0 38.0 33.2 38.0 140-144 35.8279 38.0 36.8 38.0 31.6 38.0 145-149 35.1224 38.0 36.0 38.0 31.0 38.0 150-151 31.098875 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 1.0 22 1.0 23 3.0 24 4.0 25 8.0 26 8.0 27 12.0 28 19.0 29 16.0 30 21.0 31 53.0 32 56.0 33 89.0 34 139.0 35 261.0 36 742.0 37 2561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.23225806451613 13.10967741935484 7.070967741935484 39.58709677419355 2 24.625 12.975 33.625 28.775000000000002 3 21.575 17.25 23.549999999999997 37.625 4 26.55 24.6 21.15 27.700000000000003 5 25.724999999999998 30.7 22.775000000000002 20.8 6 21.65 32.300000000000004 23.25 22.8 7 16.975 22.625 41.099999999999994 19.3 8 21.05 22.525000000000002 29.775000000000002 26.650000000000002 9 20.4 21.925 32.125 25.55 10-14 22.99 26.135 26.240000000000002 24.635 15-19 23.205000000000002 25.505 25.869999999999997 25.419999999999998 20-24 23.0 25.19 26.295 25.515 25-29 22.96 25.955000000000002 25.564999999999998 25.52 30-34 22.795 25.319999999999997 26.255 25.629999999999995 35-39 22.985 25.619999999999997 25.785000000000004 25.61 40-44 23.125 25.740000000000002 25.919999999999998 25.215 45-49 22.58 26.25 25.775 25.395 50-54 22.835 25.97 25.605 25.590000000000003 55-59 23.345 25.465 25.455 25.735000000000003 60-64 22.985 25.085 25.814999999999998 26.115 65-69 23.515 25.324999999999996 25.755 25.405 70-74 23.525 25.15 26.064999999999998 25.259999999999998 75-79 23.445 25.495 25.4 25.66 80-84 23.51 25.055 25.705 25.729999999999997 85-89 23.849999999999998 25.240000000000002 25.419999999999998 25.490000000000002 90-94 23.22 25.069999999999997 25.66 26.05 95-99 23.52 24.795 25.855 25.83 100-104 23.84 25.135 25.474999999999998 25.55 105-109 23.305 25.740000000000002 25.61 25.345000000000002 110-114 23.285 24.945 25.64 26.13 115-119 23.674999999999997 25.21 25.729999999999997 25.385 120-124 23.165 25.445 25.785000000000004 25.605 125-129 23.39 25.650000000000002 25.455 25.505 130-134 24.195 25.264999999999997 24.88 25.66 135-139 24.005000000000003 25.165 25.369999999999997 25.46 140-144 23.200000000000003 24.965 26.06 25.775 145-149 23.57 25.314999999999998 25.224999999999998 25.89 150-151 23.2875 25.412499999999998 24.637500000000003 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 0.0 27 1.5 28 3.5 29 5.0 30 8.5 31 15.0 32 18.0 33 15.5 34 22.0 35 39.0 36 53.0 37 58.5 38 76.5 39 100.0 40 121.5 41 157.0 42 185.5 43 178.0 44 188.5 45 208.5 46 220.0 47 222.5 48 191.5 49 182.0 50 165.0 51 128.0 52 120.0 53 123.0 54 110.5 55 104.0 56 104.0 57 100.5 58 87.0 59 75.0 60 79.0 61 75.0 62 62.5 63 52.0 64 51.0 65 49.5 66 42.0 67 37.0 68 30.5 69 29.5 70 25.0 71 22.0 72 18.5 73 11.0 74 9.5 75 6.5 76 4.0 77 1.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGGT 10 0.0060887975 150.61038 1 >>END_MODULE SRR6958159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1035 33.0 33.0 34.0 32.0 34.0 2 33.20925 34.0 33.0 34.0 33.0 34.0 3 33.2635 34.0 33.0 34.0 33.0 34.0 4 33.212 34.0 33.0 34.0 33.0 34.0 5 33.0655 34.0 33.0 34.0 33.0 34.0 6 37.28825 38.0 38.0 38.0 37.0 38.0 7 37.26475 38.0 38.0 38.0 37.0 38.0 8 37.2705 38.0 38.0 38.0 37.0 38.0 9 37.29525 38.0 38.0 38.0 37.0 38.0 10-14 37.35035 38.0 38.0 38.0 37.2 38.0 15-19 37.44555 38.0 38.0 38.0 38.0 38.0 20-24 37.406150000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.25795 38.0 38.0 38.0 36.8 38.0 30-34 37.305600000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.939800000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.773700000000005 38.0 38.0 38.0 35.6 38.0 45-49 36.765699999999995 38.0 38.0 38.0 35.4 38.0 50-54 37.1176 38.0 38.0 38.0 36.6 38.0 55-59 35.893600000000006 38.0 37.0 38.0 29.4 38.0 60-64 37.0986 38.0 38.0 38.0 36.4 38.0 65-69 37.091750000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.1148 38.0 38.0 38.0 36.4 38.0 75-79 36.56345 38.0 37.8 38.0 33.8 38.0 80-84 36.857299999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.13065 38.0 37.2 38.0 30.4 38.0 90-94 36.423950000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.505900000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.53725000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.49265 38.0 38.0 38.0 34.2 38.0 110-114 36.381150000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.2649 38.0 38.0 38.0 33.8 38.0 120-124 35.879799999999996 38.0 37.6 38.0 32.2 38.0 125-129 35.6806 38.0 37.0 38.0 31.0 38.0 130-134 34.648900000000005 38.0 35.0 38.0 25.8 38.0 135-139 33.75805 38.0 32.8 38.0 22.0 38.0 140-144 34.47860000000001 38.0 35.4 38.0 26.6 38.0 145-149 33.949400000000004 38.0 34.4 38.0 24.8 38.0 150-151 28.56075 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 3.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 2.0 16 2.0 17 6.0 18 2.0 19 0.0 20 0.0 21 5.0 22 4.0 23 6.0 24 8.0 25 19.0 26 21.0 27 20.0 28 29.0 29 33.0 30 48.0 31 55.0 32 81.0 33 107.0 34 169.0 35 280.0 36 686.0 37 2402.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 19.825 9.875 31.225 2 30.025000000000002 22.900000000000002 27.950000000000003 19.125 3 22.15 24.8 29.175 23.875 4 25.5 31.924999999999997 20.349999999999998 22.225 5 27.55 33.525 19.975 18.95 6 22.8 36.325 19.75 21.125 7 22.95 19.85 33.825 23.375 8 23.225 25.4 23.575 27.800000000000004 9 24.175 22.25 27.750000000000004 25.825 10-14 25.695 26.515 23.49 24.3 15-19 25.759999999999998 25.324999999999996 24.965 23.95 20-24 25.278791818772817 26.148922338350754 24.80872130819623 23.7635645346802 25-29 25.53 26.290000000000003 23.955000000000002 24.224999999999998 30-34 25.55 26.08 23.96 24.41 35-39 26.02 25.424999999999997 24.279999999999998 24.275 40-44 25.77 25.955000000000002 24.41 23.865 45-49 25.28 25.69 24.775 24.255 50-54 25.865 25.285000000000004 25.095 23.755000000000003 55-59 26.090000000000003 25.395 24.48 24.035 60-64 25.480000000000004 24.985 24.955 24.58 65-69 25.518827824173623 25.713857078561787 24.4436665499825 24.323648547282094 70-74 25.855 25.4 25.009999999999998 23.735 75-79 26.215 25.535000000000004 24.779999999999998 23.47 80-84 26.025 25.585 24.745 23.645 85-89 25.625125025005 25.40508101620324 24.70994198839768 24.259851970394077 90-94 26.35 25.72 24.81 23.119999999999997 95-99 25.729999999999997 25.56 24.89 23.82 100-104 25.825 25.275 25.185000000000002 23.715 105-109 25.595000000000002 25.85 24.855 23.7 110-114 26.27262726272627 25.66756675667567 24.752475247524753 23.307330733073307 115-119 26.44528905781156 25.1000200040008 24.90998199639928 23.544708941788357 120-124 26.135 25.615 24.945 23.305 125-129 26.205000000000002 25.595000000000002 25.019999999999996 23.18 130-134 26.22893434015102 26.08391258688803 24.55368305245787 23.133470020503076 135-139 27.344101615242288 25.778866830024505 24.38865829874481 22.488373255988396 140-144 26.36 26.150000000000002 24.425 23.064999999999998 145-149 27.415 26.029999999999998 24.505 22.05 150-151 27.462500000000002 26.200000000000003 24.05 22.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 2.0 25 1.5 26 1.5 27 2.0 28 5.5 29 8.0 30 8.0 31 10.5 32 17.5 33 21.5 34 19.5 35 29.5 36 45.0 37 55.5 38 71.5 39 90.5 40 116.5 41 140.5 42 154.0 43 179.5 44 184.0 45 190.0 46 200.5 47 185.0 48 196.5 49 199.0 50 167.0 51 138.0 52 128.5 53 124.5 54 110.5 55 95.0 56 86.5 57 84.0 58 84.5 59 90.0 60 88.5 61 81.0 62 74.0 63 75.0 64 69.5 65 58.0 66 54.0 67 54.5 68 50.0 69 37.5 70 31.0 71 24.0 72 16.0 73 13.5 74 11.0 75 4.5 76 2.5 77 2.5 78 1.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98477157360406 97.5 2 0.7868020304568528 1.55 3 0.10152284263959391 0.3 4 0.050761421319796954 0.2 5 0.025380710659898477 0.125 6 0.025380710659898477 0.15 7 0.025380710659898477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.550000000000001 0.0 0.0 0.0 0.0 136-137 6.075 0.0 0.0 0.0 0.0 138-139 6.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTAGT 10 0.006905315 144.475 6 AGAATAC 10 0.006905315 144.475 8 CTTCGAC 10 0.006905315 144.475 1 >>END_MODULE Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181039 spots for SRR6958159.sra Written 1181039 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra Read 1181021 spots for SRR6958159.sra Written 1181021 spots for SRR6958159.sra SRR ids: ['SRR6958159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6jigrjmh SRR6958159.sra spots: 23620438 blocks: [[1, 1181021], [1181022, 2362042], [2362043, 3543063], [3543064, 4724084], [4724085, 5905105], [5905106, 7086126], [7086127, 8267147], [8267148, 9448168], [9448169, 10629189], [10629190, 11810210], [11810211, 12991231], [12991232, 14172252], [14172253, 15353273], [15353274, 16534294], [16534295, 17715315], [17715316, 18896336], [18896337, 20077357], [20077358, 21258378], [21258379, 22439399], [22439400, 23620438]] SRR6958159 file size 7982491 SRR6958159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958159 SRR6958159_1.fastq SRR6958159_2.fastq Input file: SRR6958159_1.fastq Paired file: SRR6958159_2.fastq trimmed: SRR6958159-trimmed-pair1.fastq, SRR6958159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:39:03 2024 >> started Fri Dec 6 14:39:30 2024 >> done (26.697s) 23620438 read pairs processed; of these: 15936 ( 0.07%) short read pairs filtered out after trimming by size control 14234 ( 0.06%) empty read pairs filtered out after trimming by size control 23590268 (99.87%) read pairs available; of these: 8915384 (37.79%) trimmed read pairs available after processing 14674884 (62.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 9 0.00% 21 12 0.00% 22 10 0.00% 23 11 0.00% 24 14 0.00% 25 15 0.00% 26 14 0.00% 27 12 0.00% 28 16 0.00% 29 16 0.00% 30 17 0.00% 31 13 0.00% 32 17 0.00% 33 14 0.00% 34 12 0.00% 35 22 0.00% 36 23 0.00% 37 16 0.00% 38 23 0.00% 39 31 0.00% 40 25 0.00% 41 24 0.00% 42 34 0.00% 43 36 0.00% 44 22 0.00% 45 41 0.00% 46 48 0.00% 47 71 0.00% 48 55 0.00% 49 76 0.00% 50 63 0.00% 51 87 0.00% 52 109 0.00% 53 100 0.00% 54 104 0.00% 55 124 0.00% 56 140 0.00% 57 127 0.00% 58 192 0.00% 59 209 0.00% 60 242 0.00% 61 280 0.00% 62 289 0.00% 63 343 0.00% 64 345 0.00% 65 378 0.00% 66 460 0.00% 67 515 0.00% 68 571 0.00% 69 609 0.00% 70 739 0.00% 71 832 0.00% 72 975 0.00% 73 1106 0.00% 74 1279 0.01% 75 1381 0.01% 76 1620 0.01% 77 1742 0.01% 78 1937 0.01% 79 2178 0.01% 80 2512 0.01% 81 2828 0.01% 82 3216 0.01% 83 3683 0.02% 84 4845 0.02% 85 5642 0.02% 86 6079 0.03% 87 6576 0.03% 88 7107 0.03% 89 7453 0.03% 90 8164 0.03% 91 8818 0.04% 92 9454 0.04% 93 10110 0.04% 94 11519 0.05% 95 11884 0.05% 96 12936 0.05% 97 13748 0.06% 98 14609 0.06% 99 15409 0.07% 100 16841 0.07% 101 17715 0.08% 102 19087 0.08% 103 20433 0.09% 104 21752 0.09% 105 22684 0.10% 106 24148 0.10% 107 25540 0.11% 108 26614 0.11% 109 27483 0.12% 110 29074 0.12% 111 30752 0.13% 112 32167 0.14% 113 33498 0.14% 114 35527 0.15% 115 37450 0.16% 116 39285 0.17% 117 40799 0.17% 118 41768 0.18% 119 42497 0.18% 120 44672 0.19% 121 46130 0.20% 122 47745 0.20% 123 50326 0.21% 124 53018 0.22% 125 53921 0.23% 126 56411 0.24% 127 57998 0.25% 128 59553 0.25% 129 61157 0.26% 130 63655 0.27% 131 65251 0.28% 132 68156 0.29% 133 71972 0.31% 134 74646 0.32% 135 76256 0.32% 136 79522 0.34% 137 82306 0.35% 138 85121 0.36% 139 90674 0.38% 140 94784 0.40% 141 100872 0.43% 142 109086 0.46% 143 118063 0.50% 144 132074 0.56% 145 151250 0.64% 146 182822 0.77% 147 236190 1.00% 148 343552 1.46% 149 673908 2.86% 150 4712752 19.98% 151 14674884 62.21% 23590268 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=51.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=133.98 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958159 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:40:22 Started mapping on | Dec 06 14:40:23 Finished on | Dec 06 14:42:27 Mapping speed, Million of reads per hour | 684.88 Number of input reads | 23590268 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23101988 Uniquely mapped reads % | 97.93% Average mapped length | 295.42 Number of splices: Total | 25770379 Number of splices: Annotated (sjdb) | 24203935 Number of splices: GT/AG | 25437172 Number of splices: GC/AG | 300944 Number of splices: AT/AC | 9888 Number of splices: Non-canonical | 22375 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177907 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 16394 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322219 322219 322219 N_multimapping 177907 177907 177907 N_noFeature 906358 22448841 1107166 N_ambiguous 539462 3026 88353 UnstrandedReadsAssigned:21656168 PositiveStrandReadsAssigned:650121 NegativeStrandReadsAssigned:21906469 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958159-trimmed-pair1.fastq SRR6958159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,590,268 reads, 21,954,124 reads pseudoaligned [quant] estimated average fragment length: 259.403 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR6958159.ke.tsv 35125 SRR6958159.se.tsv 88098 total ==> SRR6958159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.233 0.844336 0.0840775 PNS24247 1044 785.597 77.7171 6.68128 PNS24249 1928 1669.6 29.4378 1.19079 PNS24246 1044 785.597 77.7171 6.68128 PNS24248 1044 785.597 77.7171 6.68128 PNS24244 1471 1212.6 57.5668 3.20626 PNS24243 293 93.5334 0 0 KQK14069 1603 1344.6 3565.35 179.082 KQK14071 474 234.38 119.248 34.3615 ==> SRR6958159.se.tsv <== BRADI_1g14170v3 4489 BRADI_1g53295v3 278 BRADI_1g59795v3 475 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 381 BRADI_1g74790v3 121 BRADI_1g09890v3 0 BRADI_1g77505v3 306 BRADI_1g48960v3 0 SRR6958159 completed mapping pipeline successfully