Starting /dee2/code/volunteer_pipeline.sh SRR6958160 current disk space = 1550464114688 free memory = 1599955544 SRR6958160 SRAfilesize 0b771eb000f78b1620034cce903f1b4f SRR6958160.sra SRR6958160.sra file validated SRR6958160 is paired end SRR6958160 is conventional basespace SRR6958160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.75 18.0 18.0 18.0 18.0 18.0 2 26.26875 27.0 25.0 27.0 18.0 30.0 3 28.21025 29.0 27.0 31.0 25.0 31.0 4 29.4825 31.0 29.0 33.0 25.0 33.0 5 32.2095 33.0 32.0 33.0 32.0 33.0 6 35.64875 37.0 35.0 38.0 31.0 38.0 7 37.138 38.0 37.0 38.0 36.0 38.0 8 36.61 38.0 37.0 38.0 34.0 38.0 9 37.43325 38.0 38.0 38.0 37.0 38.0 10-14 37.535000000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.539100000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.448449999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.5601 38.0 38.0 38.0 37.6 38.0 30-34 37.66420000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.609849999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.5706 38.0 38.0 38.0 37.8 38.0 45-49 37.510200000000005 38.0 38.0 38.0 37.8 38.0 50-54 37.235749999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.071600000000004 38.0 38.0 38.0 35.6 38.0 60-64 37.05585 38.0 38.0 38.0 35.8 38.0 65-69 36.9763 38.0 38.0 38.0 35.4 38.0 70-74 37.1639 38.0 38.0 38.0 36.0 38.0 75-79 37.11344999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.004000000000005 38.0 38.0 38.0 35.6 38.0 85-89 37.0544 38.0 38.0 38.0 35.8 38.0 90-94 37.00789999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.7302 38.0 38.0 38.0 34.4 38.0 100-104 36.618900000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.55884999999999 38.0 37.8 38.0 34.0 38.0 110-114 36.33045 38.0 37.4 38.0 33.6 38.0 115-119 36.12695 38.0 37.0 38.0 33.2 38.0 120-124 35.97055 38.0 36.8 38.0 32.6 38.0 125-129 35.7997 38.0 36.0 38.0 31.2 38.0 130-134 35.67435 38.0 36.0 38.0 31.4 38.0 135-139 35.20035 38.0 34.8 38.0 30.2 38.0 140-144 34.5648 38.0 34.6 38.0 27.0 38.0 145-149 33.8412 38.0 33.2 38.0 24.2 38.0 150-151 29.713625 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 1.0 25 4.0 26 11.0 27 9.0 28 9.0 29 27.0 30 31.0 31 59.0 32 77.0 33 106.0 34 208.0 35 409.0 36 1157.0 37 1885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 8.22233606557377 5.122950819672131 49.84631147540984 36.80840163934426 2 24.375 13.350000000000001 36.025 26.25 3 21.85 14.924999999999999 24.9 38.324999999999996 4 25.775 24.075 22.8 27.35 5 24.85 29.9 23.95 21.3 6 20.599999999999998 35.125 24.25 20.025000000000002 7 16.1 24.15 40.275 19.475 8 19.525000000000002 25.074999999999996 30.675 24.725 9 18.55 23.225 34.5 23.724999999999998 10-14 21.625 27.79 26.735 23.849999999999998 15-19 21.845 26.740000000000002 27.22 24.195 20-24 21.605 27.05 26.865 24.48 25-29 21.245 27.045 27.284999999999997 24.425 30-34 21.98 26.290000000000003 27.48 24.25 35-39 22.035 26.46 26.924999999999997 24.58 40-44 22.045 26.735 26.775 24.445 45-49 21.69 26.57 27.18 24.560000000000002 50-54 21.59 26.724999999999998 26.905 24.779999999999998 55-59 22.3 26.11 26.87 24.72 60-64 21.986595978793638 26.22786836050815 26.97809342802841 24.807442232669803 65-69 21.772177217721772 26.167616761676165 27.242724272427242 24.817481748174817 70-74 21.75 26.495 27.1 24.654999999999998 75-79 21.69 26.505000000000003 27.08 24.725 80-84 21.54 26.565 27.150000000000002 24.745 85-89 22.16 26.85 26.424999999999997 24.565 90-94 22.36 26.215 27.33 24.095 95-99 22.41 26.235000000000003 27.310000000000002 24.044999999999998 100-104 22.505 26.545 26.55 24.4 105-109 21.785 27.029999999999998 26.41 24.775 110-114 22.335 26.55 26.63 24.485 115-119 22.39 27.11 26.295 24.205 120-124 22.220000000000002 26.55 26.545 24.685000000000002 125-129 22.17 26.87 26.26 24.7 130-134 22.38 27.584999999999997 25.915 24.12 135-139 22.38 27.0 26.19 24.43 140-144 22.935 26.96 25.715 24.39 145-149 22.314999999999998 27.595 25.509999999999998 24.58 150-151 22.175 26.7125 25.525 25.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 4.0 27 4.5 28 4.0 29 5.5 30 11.0 31 17.5 32 21.0 33 31.5 34 40.5 35 48.0 36 72.0 37 91.5 38 111.5 39 144.0 40 170.5 41 192.5 42 211.5 43 236.0 44 247.5 45 230.5 46 224.5 47 224.0 48 206.0 49 193.5 50 171.5 51 137.0 52 123.5 53 116.5 54 99.0 55 78.0 56 69.5 57 66.0 58 48.0 59 39.5 60 44.0 61 41.0 62 32.5 63 31.0 64 29.5 65 23.5 66 24.0 67 17.0 68 11.0 69 13.5 70 10.0 71 6.0 72 5.5 73 4.5 74 3.5 75 2.0 76 2.0 77 1.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.9 0.0 0.0 0.0 0.0 116-117 4.2375 0.0 0.0 0.0 0.0 118-119 4.7 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.7 0.0 0.0 0.0 0.0 124-125 6.3 0.0 0.0 0.0 0.0 126-127 7.1125 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.3375 0.0 0.0 0.0 0.0 134-135 10.2 0.0 0.0 0.0 0.0 136-137 11.225000000000001 0.0 0.0 0.0 0.0 138-139 12.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCACC 10 0.0068378756 144.95 9 ATTTGAT 10 0.0068378756 144.95 6 >>END_MODULE SRR6958160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2065 33.0 33.0 34.0 33.0 34.0 2 33.328 34.0 33.0 34.0 33.0 34.0 3 33.39225 34.0 33.0 34.0 33.0 34.0 4 33.39225 34.0 33.0 34.0 33.0 34.0 5 33.42325 34.0 33.0 34.0 33.0 34.0 6 37.63025 38.0 38.0 38.0 38.0 38.0 7 37.64925 38.0 38.0 38.0 38.0 38.0 8 37.6915 38.0 38.0 38.0 38.0 38.0 9 37.61575 38.0 38.0 38.0 38.0 38.0 10-14 37.5873 38.0 38.0 38.0 38.0 38.0 15-19 37.603699999999996 38.0 38.0 38.0 38.0 38.0 20-24 36.799549999999996 38.0 37.8 38.0 34.2 38.0 25-29 37.59075 38.0 38.0 38.0 38.0 38.0 30-34 37.63045 38.0 38.0 38.0 38.0 38.0 35-39 37.0293 38.0 38.0 38.0 35.4 38.0 40-44 37.59205 38.0 38.0 38.0 38.0 38.0 45-49 37.56955000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.560199999999995 38.0 38.0 38.0 38.0 38.0 55-59 36.835499999999996 38.0 37.8 38.0 34.4 38.0 60-64 37.50205 38.0 38.0 38.0 37.8 38.0 65-69 37.4943 38.0 38.0 38.0 38.0 38.0 70-74 37.43775 38.0 38.0 38.0 38.0 38.0 75-79 37.405899999999995 38.0 38.0 38.0 37.6 38.0 80-84 37.397450000000006 38.0 38.0 38.0 37.6 38.0 85-89 37.32755 38.0 38.0 38.0 37.4 38.0 90-94 37.24409999999999 38.0 38.0 38.0 37.0 38.0 95-99 37.188900000000004 38.0 38.0 38.0 37.0 38.0 100-104 36.53715 38.0 38.0 38.0 33.6 38.0 105-109 36.17445 38.0 37.0 38.0 31.2 38.0 110-114 36.25505 38.0 37.4 38.0 32.6 38.0 115-119 36.8418 38.0 38.0 38.0 35.2 38.0 120-124 34.84785000000001 38.0 35.6 38.0 25.0 38.0 125-129 35.986599999999996 38.0 36.8 38.0 32.2 38.0 130-134 34.728100000000005 38.0 34.6 38.0 25.8 38.0 135-139 33.1359 37.0 31.6 38.0 21.4 38.0 140-144 34.9144 38.0 34.8 38.0 29.4 38.0 145-149 34.70455 38.0 36.0 38.0 28.6 38.0 150-151 28.89425 34.5 19.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 6.0 20 1.0 21 1.0 22 4.0 23 8.0 24 1.0 25 4.0 26 8.0 27 9.0 28 16.0 29 10.0 30 11.0 31 27.0 32 62.0 33 93.0 34 146.0 35 263.0 36 970.0 37 2347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.675000000000004 18.224999999999998 12.375 32.725 2 28.799999999999997 24.8 29.2 17.2 3 21.75 27.725 26.85 23.674999999999997 4 25.4 32.074999999999996 20.95 21.575 5 27.075 33.375 21.95 17.599999999999998 6 21.975 38.0 21.55 18.475 7 22.05 20.474999999999998 37.15 20.325 8 22.85 25.324999999999996 26.150000000000002 25.674999999999997 9 22.75 23.525 29.599999999999998 24.125 10-14 25.2 27.384999999999998 24.645 22.770000000000003 15-19 24.7 27.02 25.595000000000002 22.685 20-24 24.89 27.700000000000003 25.230000000000004 22.18 25-29 24.51 26.855 26.064999999999998 22.57 30-34 23.695 26.900000000000002 26.86 22.545 35-39 24.88 27.055 25.825 22.24 40-44 24.97 26.735 26.02 22.275 45-49 24.48 26.96 26.07 22.49 50-54 24.27 27.6 25.785000000000004 22.345000000000002 55-59 24.555 27.065 25.779999999999998 22.6 60-64 24.695 27.445000000000004 26.275 21.584999999999997 65-69 24.005000000000003 27.125 26.16 22.71 70-74 24.625 26.96 26.075 22.34 75-79 24.95 26.185000000000002 26.565 22.3 80-84 24.545 26.705000000000002 26.640000000000004 22.11 85-89 24.2 26.674999999999997 27.01 22.115000000000002 90-94 24.709999999999997 27.12 26.1 22.07 95-99 24.82 27.47 25.61 22.1 100-104 25.069999999999997 27.26 25.765 21.905 105-109 25.230000000000004 27.115000000000002 25.965 21.69 110-114 25.230000000000004 27.715 25.795 21.26 115-119 25.16 27.36 26.005 21.475 120-124 25.264999999999997 28.165000000000003 26.224999999999998 20.345 125-129 25.419999999999998 27.165 26.125 21.29 130-134 26.625 26.955000000000002 25.825 20.595 135-139 26.14 28.04 24.834999999999997 20.985 140-144 26.590000000000003 27.97 25.3 20.14 145-149 27.02 27.32 25.169999999999998 20.49 150-151 27.675 28.225 24.3625 19.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 3.0 27 4.5 28 6.0 29 5.5 30 8.0 31 12.5 32 20.0 33 29.5 34 36.0 35 49.0 36 56.0 37 64.5 38 95.5 39 133.0 40 166.0 41 197.0 42 216.5 43 218.5 44 215.5 45 228.5 46 232.0 47 210.0 48 204.5 49 200.0 50 177.0 51 149.5 52 130.0 53 117.5 54 108.0 55 86.0 56 62.0 57 62.0 58 67.5 59 64.0 60 57.5 61 49.0 62 37.0 63 31.5 64 33.0 65 26.5 66 22.5 67 26.5 68 22.0 69 17.0 70 13.0 71 7.5 72 3.5 73 3.5 74 2.5 75 2.0 76 2.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.65 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 3.95 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.25 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.525 0.0 0.0 0.0 0.0 128-129 7.0875 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.375 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 10.0375 0.0 0.0 0.0 0.0 138-139 11.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGCG 10 0.006830828 145.0 6 >>END_MODULE Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra Read 464878 spots for SRR6958160.sra Written 464878 spots for SRR6958160.sra Read 464859 spots for SRR6958160.sra Written 464859 spots for SRR6958160.sra SRR ids: ['SRR6958160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_klx09nz_ SRR6958160.sra spots: 9297199 blocks: [[1, 464859], [464860, 929718], [929719, 1394577], [1394578, 1859436], [1859437, 2324295], [2324296, 2789154], [2789155, 3254013], [3254014, 3718872], [3718873, 4183731], [4183732, 4648590], [4648591, 5113449], [5113450, 5578308], [5578309, 6043167], [6043168, 6508026], [6508027, 6972885], [6972886, 7437744], [7437745, 7902603], [7902604, 8367462], [8367463, 8832321], [8832322, 9297199]] SRR6958160 file size 3130187 SRR6958160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958160 SRR6958160_1.fastq SRR6958160_2.fastq Input file: SRR6958160_1.fastq Paired file: SRR6958160_2.fastq trimmed: SRR6958160-trimmed-pair1.fastq, SRR6958160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:38:55 2024 >> started Fri Dec 6 14:39:06 2024 >> done (11.236s) 9297199 read pairs processed; of these: 2999 ( 0.03%) short read pairs filtered out after trimming by size control 3859 ( 0.04%) empty read pairs filtered out after trimming by size control 9290341 (99.93%) read pairs available; of these: 5523209 (59.45%) trimmed read pairs available after processing 3767132 (40.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 1 0.00% 27 4 0.00% 28 6 0.00% 29 7 0.00% 30 6 0.00% 31 9 0.00% 32 6 0.00% 33 9 0.00% 34 9 0.00% 35 11 0.00% 36 8 0.00% 37 13 0.00% 38 16 0.00% 39 12 0.00% 40 14 0.00% 41 14 0.00% 42 20 0.00% 43 26 0.00% 44 21 0.00% 45 22 0.00% 46 21 0.00% 47 30 0.00% 48 30 0.00% 49 42 0.00% 50 49 0.00% 51 53 0.00% 52 65 0.00% 53 61 0.00% 54 76 0.00% 55 85 0.00% 56 96 0.00% 57 78 0.00% 58 112 0.00% 59 147 0.00% 60 164 0.00% 61 164 0.00% 62 199 0.00% 63 216 0.00% 64 247 0.00% 65 261 0.00% 66 309 0.00% 67 336 0.00% 68 422 0.00% 69 400 0.00% 70 490 0.01% 71 557 0.01% 72 655 0.01% 73 739 0.01% 74 827 0.01% 75 915 0.01% 76 1103 0.01% 77 1206 0.01% 78 1250 0.01% 79 1463 0.02% 80 1690 0.02% 81 1863 0.02% 82 2072 0.02% 83 2310 0.02% 84 2728 0.03% 85 3134 0.03% 86 3444 0.04% 87 3717 0.04% 88 4069 0.04% 89 4313 0.05% 90 4848 0.05% 91 5302 0.06% 92 5683 0.06% 93 6329 0.07% 94 6950 0.07% 95 7397 0.08% 96 8045 0.09% 97 8449 0.09% 98 9049 0.10% 99 9794 0.11% 100 10757 0.12% 101 11487 0.12% 102 12039 0.13% 103 12809 0.14% 104 13766 0.15% 105 14665 0.16% 106 15524 0.17% 107 16212 0.17% 108 16769 0.18% 109 17680 0.19% 110 18580 0.20% 111 19193 0.21% 112 20552 0.22% 113 21167 0.23% 114 22362 0.24% 115 23607 0.25% 116 24831 0.27% 117 25623 0.28% 118 26706 0.29% 119 27371 0.29% 120 28601 0.31% 121 29604 0.32% 122 30396 0.33% 123 31676 0.34% 124 33442 0.36% 125 34953 0.38% 126 36495 0.39% 127 37911 0.41% 128 39328 0.42% 129 40465 0.44% 130 42536 0.46% 131 43950 0.47% 132 46099 0.50% 133 48661 0.52% 134 50470 0.54% 135 52805 0.57% 136 56573 0.61% 137 59662 0.64% 138 62821 0.68% 139 67261 0.72% 140 71238 0.77% 141 77386 0.83% 142 85692 0.92% 143 95514 1.03% 144 106468 1.15% 145 129601 1.40% 146 157801 1.70% 147 206762 2.23% 148 304197 3.27% 149 577753 6.22% 150 2351061 25.31% 151 3767132 40.55% 9290341 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=58.63 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.1 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=216.12 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958160 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:39:51 Started mapping on | Dec 06 14:39:52 Finished on | Dec 06 14:40:36 Mapping speed, Million of reads per hour | 760.12 Number of input reads | 9290341 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9177820 Uniquely mapped reads % | 98.79% Average mapped length | 291.09 Number of splices: Total | 10104596 Number of splices: Annotated (sjdb) | 9474790 Number of splices: GT/AG | 9970880 Number of splices: GC/AG | 120516 Number of splices: AT/AC | 4690 Number of splices: Non-canonical | 8510 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77013 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 3168 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.18% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 37291 37291 37291 N_multimapping 77013 77013 77013 N_noFeature 444044 8918250 531325 N_ambiguous 202437 1193 30332 UnstrandedReadsAssigned:8531339 PositiveStrandReadsAssigned:258377 NegativeStrandReadsAssigned:8616163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR6958160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958160-trimmed-pair1.fastq SRR6958160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,290,341 reads, 8,647,242 reads pseudoaligned [quant] estimated average fragment length: 208.191 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR6958160.ke.tsv 35125 SRR6958160.se.tsv 88098 total ==> SRR6958160.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.113 0 0 PNS24247 1044 836.809 29.9979 6.73355 PNS24249 1928 1720.81 19.2969 2.10637 PNS24246 1044 836.809 29.9979 6.73355 PNS24248 1044 836.809 29.9979 6.73355 PNS24244 1471 1263.81 21.7095 3.22662 PNS24243 293 105.389 1 1.78231 KQK14069 1603 1395.81 522.714 70.3425 KQK14071 474 269.68 9.07145 6.31841 ==> SRR6958160.se.tsv <== BRADI_1g14170v3 641 BRADI_1g53295v3 151 BRADI_1g59795v3 253 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 154 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR6958160 completed mapping pipeline successfully