Starting /dee2/code/volunteer_pipeline.sh SRR6958161 current disk space = 1550451933184 free memory = 1598447928 SRR6958161 SRAfilesize 73bf7e1e3d74a3eb36bcf4f31f464c62 SRR6958161.sra SRR6958161.sra file validated SRR6958161 is paired end SRR6958161 is conventional basespace SRR6958161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.7365 18.0 18.0 32.0 18.0 32.0 2 23.68175 25.0 18.0 28.0 18.0 31.0 3 26.4035 27.0 25.0 30.0 18.0 31.0 4 28.35925 29.0 27.0 31.0 15.0 33.0 5 29.6335 31.0 29.0 33.0 25.0 33.0 6 35.09575 37.0 34.0 38.0 29.0 38.0 7 36.9795 38.0 37.0 38.0 35.0 38.0 8 37.43325 38.0 38.0 38.0 37.0 38.0 9 37.51825 38.0 38.0 38.0 37.0 38.0 10-14 37.44395 38.0 38.0 38.0 37.2 38.0 15-19 37.55475 38.0 38.0 38.0 37.8 38.0 20-24 37.5983 38.0 38.0 38.0 38.0 38.0 25-29 37.623599999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.57185 38.0 38.0 38.0 38.0 38.0 35-39 37.3456 38.0 38.0 38.0 37.0 38.0 40-44 37.5976 38.0 38.0 38.0 38.0 38.0 45-49 37.46795000000001 38.0 38.0 38.0 37.6 38.0 50-54 37.48479999999999 38.0 38.0 38.0 37.2 38.0 55-59 37.239599999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.4549 38.0 38.0 38.0 37.4 38.0 65-69 36.9594 38.0 37.8 38.0 35.2 38.0 70-74 37.16185 38.0 38.0 38.0 36.2 38.0 75-79 36.88805 38.0 37.8 38.0 34.8 38.0 80-84 37.288700000000006 38.0 38.0 38.0 36.6 38.0 85-89 37.22315 38.0 38.0 38.0 36.6 38.0 90-94 37.1435 38.0 38.0 38.0 36.0 38.0 95-99 37.04955 38.0 38.0 38.0 35.8 38.0 100-104 36.9196 38.0 38.0 38.0 35.4 38.0 105-109 36.8304 38.0 38.0 38.0 35.0 38.0 110-114 36.7533 38.0 38.0 38.0 34.8 38.0 115-119 36.63315 38.0 38.0 38.0 34.6 38.0 120-124 36.3772 38.0 37.8 38.0 34.0 38.0 125-129 36.37075 38.0 38.0 38.0 34.0 38.0 130-134 36.02695 38.0 37.6 38.0 32.6 38.0 135-139 35.003049999999995 38.0 35.2 38.0 26.6 38.0 140-144 31.42885 35.0 26.8 38.0 20.4 38.0 145-149 34.5417 38.0 34.2 38.0 29.2 38.0 150-151 30.024375 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.0 21 3.0 22 2.0 23 12.0 24 6.0 25 5.0 26 5.0 27 11.0 28 9.0 29 24.0 30 23.0 31 38.0 32 65.0 33 107.0 34 170.0 35 348.0 36 1295.0 37 1870.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.8005249343832 27.76902887139108 6.981627296587926 39.44881889763779 2 16.525000000000002 19.275000000000002 32.074999999999996 32.125 3 19.475 19.425 24.7 36.4 4 24.05 29.349999999999998 20.8 25.8 5 23.200000000000003 32.85 23.599999999999998 20.349999999999998 6 22.25 33.2 23.150000000000002 21.4 7 15.45 24.224999999999998 40.875 19.45 8 18.775 24.425 30.049999999999997 26.75 9 18.775 22.925 34.55 23.75 10-14 21.43 27.985 26.08 24.505 15-19 21.740000000000002 26.229999999999997 26.97 25.06 20-24 21.90828624293644 26.23393509026354 27.269090363554533 24.588688303245487 25-29 22.375 26.575 26.865 24.185000000000002 30-34 22.245 26.325 27.224999999999998 24.205 35-39 21.965 26.645000000000003 27.139999999999997 24.25 40-44 22.29 27.150000000000002 26.25 24.310000000000002 45-49 22.03 26.27 26.919999999999998 24.779999999999998 50-54 21.735 26.71 26.650000000000002 24.905 55-59 21.985 26.919999999999998 26.810000000000002 24.285 60-64 22.445 25.955000000000002 26.75 24.85 65-69 22.825 26.135 26.6 24.44 70-74 22.33 26.484999999999996 26.284999999999997 24.9 75-79 22.065 26.295 26.415 25.224999999999998 80-84 22.355 26.145000000000003 26.71 24.79 85-89 22.535 26.11 26.515 24.84 90-94 22.31 26.21 25.95 25.53 95-99 22.595000000000002 26.47 26.565 24.37 100-104 22.648397259588936 26.4889733460019 26.53898084712707 24.323648547282094 105-109 22.93 26.69 26.064999999999998 24.315 110-114 22.78113905695285 26.816340817040853 26.001300065003253 24.401220061003052 115-119 22.396198099049524 26.923461730865434 26.45822911455728 24.222111055527765 120-124 22.74 27.105 25.56 24.595 125-129 23.006457426039944 26.755769134504682 25.79966962006307 24.4381038193923 130-134 23.055 26.540000000000003 25.525 24.88 135-139 22.415 27.355 24.985 25.245 140-144 23.04 26.305 25.195 25.46 145-149 22.485 26.395000000000003 25.52 25.6 150-151 22.475 26.0125 25.0625 26.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 2.0 28 5.5 29 7.5 30 13.0 31 16.0 32 19.0 33 22.5 34 30.0 35 49.0 36 70.0 37 89.5 38 102.0 39 129.0 40 160.0 41 172.5 42 207.5 43 234.5 44 233.0 45 228.5 46 236.5 47 235.0 48 212.5 49 192.0 50 169.0 51 137.0 52 121.5 53 116.5 54 98.5 55 89.0 56 76.0 57 71.5 58 64.5 59 49.0 60 45.0 61 36.5 62 32.0 63 34.0 64 29.0 65 21.5 66 19.5 67 22.0 68 18.0 69 15.5 70 14.0 71 12.0 72 12.0 73 9.5 74 5.0 75 5.5 76 5.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.005 115-119 0.05 120-124 0.0 125-129 0.11499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.3375000000000004 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0875000000000004 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.3 0.0 0.0 0.0 0.0 116-117 4.9125 0.0 0.0 0.0 0.0 118-119 5.55 0.0 0.0 0.0 0.0 120-121 6.375 0.0 0.0 0.0 0.0 122-123 7.0875 0.0 0.0 0.0 0.0 124-125 7.625 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.7 0.0 0.0 0.0 0.0 130-131 9.25 0.0 0.0 0.0 0.0 132-133 9.8875 0.0 0.0 0.0 0.0 134-135 10.5625 0.0 0.0 0.0 0.0 136-137 11.1875 0.0 0.0 0.0 0.0 138-139 11.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGAT 10 0.0060887975 150.61038 1 >>END_MODULE SRR6958161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.094 33.0 33.0 34.0 32.0 34.0 2 33.13225 34.0 33.0 34.0 33.0 34.0 3 33.2465 34.0 33.0 34.0 33.0 34.0 4 33.16975 34.0 33.0 34.0 33.0 34.0 5 33.28025 34.0 33.0 34.0 33.0 34.0 6 37.397 38.0 38.0 38.0 38.0 38.0 7 37.45975 38.0 38.0 38.0 38.0 38.0 8 37.43825 38.0 38.0 38.0 38.0 38.0 9 37.4455 38.0 38.0 38.0 38.0 38.0 10-14 37.3449 38.0 38.0 38.0 37.6 38.0 15-19 36.829150000000006 38.0 38.0 38.0 34.8 38.0 20-24 37.35525 38.0 38.0 38.0 37.6 38.0 25-29 37.43675 38.0 38.0 38.0 38.0 38.0 30-34 37.4576 38.0 38.0 38.0 38.0 38.0 35-39 36.4897 38.0 37.2 38.0 31.6 38.0 40-44 37.4202 38.0 38.0 38.0 38.0 38.0 45-49 37.3254 38.0 38.0 38.0 37.4 38.0 50-54 37.36280000000001 38.0 38.0 38.0 37.8 38.0 55-59 37.3037 38.0 38.0 38.0 37.8 38.0 60-64 37.254949999999994 38.0 38.0 38.0 37.2 38.0 65-69 37.18755 38.0 38.0 38.0 37.0 38.0 70-74 37.13805 38.0 38.0 38.0 37.0 38.0 75-79 37.134299999999996 38.0 38.0 38.0 37.0 38.0 80-84 36.046499999999995 38.0 36.0 38.0 32.4 38.0 85-89 36.4918 38.0 37.4 38.0 33.8 38.0 90-94 35.624750000000006 38.0 36.2 38.0 30.0 38.0 95-99 34.5578 38.0 34.0 38.0 26.2 38.0 100-104 34.99545 38.0 34.6 38.0 28.0 38.0 105-109 36.415549999999996 38.0 37.8 38.0 34.0 38.0 110-114 36.4461 38.0 38.0 38.0 33.6 38.0 115-119 36.2607 38.0 38.0 38.0 33.0 38.0 120-124 36.11725 38.0 38.0 38.0 33.0 38.0 125-129 35.3805 38.0 37.0 38.0 29.6 38.0 130-134 35.519349999999996 38.0 37.6 38.0 30.8 38.0 135-139 34.92915 38.0 36.0 38.0 28.0 38.0 140-144 32.1631 37.0 30.2 38.0 19.6 38.0 145-149 29.1219 35.4 25.2 38.0 3.8 38.0 150-151 20.823875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 3.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 4.0 20 6.0 21 6.0 22 4.0 23 15.0 24 13.0 25 17.0 26 14.0 27 26.0 28 23.0 29 23.0 30 37.0 31 50.0 32 105.0 33 131.0 34 207.0 35 412.0 36 1180.0 37 1705.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.65 20.625 10.174999999999999 27.55 2 29.425 25.624999999999996 27.150000000000002 17.8 3 21.9 26.75 29.65 21.7 4 25.25 31.75 22.025 20.974999999999998 5 27.200000000000003 33.800000000000004 19.975 19.025 6 22.0 37.824999999999996 21.125 19.05 7 20.8 20.974999999999998 35.825 22.400000000000002 8 23.674999999999997 23.75 25.4 27.175 9 22.925 24.25 28.249999999999996 24.575 10-14 24.755 27.650000000000002 24.41 23.185 15-19 24.72 26.775 25.595000000000002 22.91 20-24 24.834999999999997 26.6 25.55 23.015 25-29 25.014999999999997 26.790000000000003 24.955 23.24 30-34 24.34 27.229999999999997 25.775 22.655 35-39 24.04 26.575 26.13 23.255 40-44 24.795 26.395000000000003 25.779999999999998 23.03 45-49 24.83 26.479999999999997 25.96 22.73 50-54 25.30632658164541 26.641660415103775 25.751437859464865 22.30057514378595 55-59 25.38380757113567 26.809021353202983 25.188778316747513 22.61839275891384 60-64 25.03751125337601 26.117835350605183 25.66770031009303 23.176953085925778 65-69 25.112533760128038 26.833049914974495 25.27258177453236 22.78183455036511 70-74 24.98624380971437 26.411885348406784 26.041718773448054 22.560152068430796 75-79 24.559823929571827 26.76570628251301 26.030412164865947 22.644057623049218 80-84 24.81364750612837 26.88978938416129 25.69413177247486 22.60243133723548 85-89 25.075030012004802 25.885354141656663 26.31552621048419 22.72408963585434 90-94 24.752475247524753 26.912691269126913 25.72757275727573 22.607260726072607 95-99 24.66 26.86 26.85 21.63 100-104 25.522552255225524 26.332633263326333 25.937593759375936 22.207220722072208 105-109 25.292587776332898 26.652995898769632 26.187856356907073 21.866559967990398 110-114 25.47 26.924999999999997 26.0 21.605 115-119 25.395079015803162 27.330466093218643 25.460092018403678 21.814362872574513 120-124 25.84758475847585 27.137713771377136 25.347534753475347 21.66716671667167 125-129 26.107610761076106 26.832683268326836 25.442544254425442 21.61716171617162 130-134 26.265 26.685 25.619999999999997 21.43 135-139 26.625325065013 26.785357071414285 25.600120024004802 20.989197839567915 140-144 27.2004400880176 27.445489097819564 25.11502300460092 20.239047809561914 145-149 27.615523104620927 26.810362072414485 24.524904980996197 21.049209841968395 150-151 26.79419854963741 26.756689172293076 26.19404851212803 20.255063765941486 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 1.0 25 2.0 26 2.5 27 4.0 28 5.5 29 7.0 30 8.5 31 12.5 32 14.5 33 21.0 34 30.0 35 41.0 36 52.0 37 65.0 38 91.0 39 121.5 40 149.0 41 190.0 42 211.5 43 198.5 44 230.0 45 253.5 46 227.5 47 202.0 48 195.5 49 172.5 50 155.0 51 158.0 52 137.0 53 122.0 54 104.0 55 90.5 56 85.0 57 78.0 58 72.5 59 63.5 60 54.0 61 39.0 62 33.5 63 39.5 64 44.5 65 39.0 66 28.0 67 22.5 68 21.5 69 22.5 70 18.5 71 14.0 72 12.0 73 11.5 74 9.0 75 5.0 76 3.5 77 2.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.025 55-59 0.015 60-64 0.03 65-69 0.03 70-74 0.045 75-79 0.04 80-84 0.055 85-89 0.04 90-94 0.01 95-99 0.0 100-104 0.01 105-109 0.03 110-114 0.0 115-119 0.02 120-124 0.01 125-129 0.01 130-134 0.0 135-139 0.02 140-144 0.02 145-149 0.02 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.0 0.0 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 2.3375000000000004 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0875000000000004 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.2875 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 7.012499999999999 0.0 0.0 0.0 0.0 124-125 7.637499999999999 0.0 0.0 0.0 0.0 126-127 8.212499999999999 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.462499999999999 0.0 0.0 0.0 0.0 132-133 10.175 0.0 0.0 0.0 0.0 134-135 10.9375 0.0 0.0 0.0 0.0 136-137 11.6375 0.0 0.0 0.0 0.0 138-139 12.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912832 spots for SRR6958161.sra Written 912832 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra Read 912815 spots for SRR6958161.sra Written 912815 spots for SRR6958161.sra SRR ids: ['SRR6958161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8heuxx1m SRR6958161.sra spots: 18256317 blocks: [[1, 912815], [912816, 1825630], [1825631, 2738445], [2738446, 3651260], [3651261, 4564075], [4564076, 5476890], [5476891, 6389705], [6389706, 7302520], [7302521, 8215335], [8215336, 9128150], [9128151, 10040965], [10040966, 10953780], [10953781, 11866595], [11866596, 12779410], [12779411, 13692225], [13692226, 14605040], [14605041, 15517855], [15517856, 16430670], [16430671, 17343485], [17343486, 18256317]] SRR6958161 file size 6164766 SRR6958161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958161 SRR6958161_1.fastq SRR6958161_2.fastq Input file: SRR6958161_1.fastq Paired file: SRR6958161_2.fastq trimmed: SRR6958161-trimmed-pair1.fastq, SRR6958161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:40:16 2024 >> started Fri Dec 6 14:40:36 2024 >> done (19.509s) 18256317 read pairs processed; of these: 11806 ( 0.06%) short read pairs filtered out after trimming by size control 19926 ( 0.11%) empty read pairs filtered out after trimming by size control 18224585 (99.83%) read pairs available; of these: 8302734 (45.56%) trimmed read pairs available after processing 9921851 (54.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 10 0.00% 21 4 0.00% 22 9 0.00% 23 16 0.00% 24 8 0.00% 25 9 0.00% 26 9 0.00% 27 11 0.00% 28 17 0.00% 29 8 0.00% 30 17 0.00% 31 21 0.00% 32 21 0.00% 33 26 0.00% 34 24 0.00% 35 26 0.00% 36 25 0.00% 37 39 0.00% 38 35 0.00% 39 44 0.00% 40 49 0.00% 41 43 0.00% 42 66 0.00% 43 45 0.00% 44 54 0.00% 45 68 0.00% 46 65 0.00% 47 74 0.00% 48 115 0.00% 49 104 0.00% 50 136 0.00% 51 165 0.00% 52 185 0.00% 53 189 0.00% 54 188 0.00% 55 203 0.00% 56 261 0.00% 57 282 0.00% 58 321 0.00% 59 367 0.00% 60 420 0.00% 61 521 0.00% 62 594 0.00% 63 634 0.00% 64 638 0.00% 65 715 0.00% 66 855 0.00% 67 918 0.01% 68 1136 0.01% 69 1253 0.01% 70 1390 0.01% 71 1628 0.01% 72 1842 0.01% 73 2062 0.01% 74 2307 0.01% 75 2632 0.01% 76 3116 0.02% 77 3590 0.02% 78 3608 0.02% 79 3990 0.02% 80 4496 0.02% 81 4923 0.03% 82 5723 0.03% 83 6419 0.04% 84 7685 0.04% 85 8414 0.05% 86 8914 0.05% 87 9746 0.05% 88 10717 0.06% 89 11310 0.06% 90 12290 0.07% 91 13794 0.08% 92 15127 0.08% 93 16640 0.09% 94 18369 0.10% 95 19530 0.11% 96 20530 0.11% 97 22023 0.12% 98 23146 0.13% 99 25287 0.14% 100 28986 0.16% 101 32164 0.18% 102 30315 0.17% 103 32093 0.18% 104 34068 0.19% 105 35679 0.20% 106 37665 0.21% 107 38701 0.21% 108 40489 0.22% 109 42230 0.23% 110 43678 0.24% 111 45580 0.25% 112 48243 0.26% 113 49863 0.27% 114 52803 0.29% 115 55043 0.30% 116 56422 0.31% 117 57479 0.32% 118 58294 0.32% 119 59053 0.32% 120 61335 0.34% 121 63143 0.35% 122 65010 0.36% 123 68218 0.37% 124 70612 0.39% 125 72327 0.40% 126 74117 0.41% 127 75129 0.41% 128 75914 0.42% 129 77953 0.43% 130 78669 0.43% 131 80042 0.44% 132 83293 0.46% 133 86278 0.47% 134 88459 0.49% 135 91416 0.50% 136 93166 0.51% 137 94615 0.52% 138 96521 0.53% 139 99954 0.55% 140 102394 0.56% 141 107047 0.59% 142 113509 0.62% 143 120531 0.66% 144 130554 0.72% 145 146185 0.80% 146 167192 0.92% 147 208197 1.14% 148 291254 1.60% 149 555256 3.05% 150 3583290 19.66% 151 9921851 54.44% 18224585 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=35.89 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=19 prefix-density=0.45 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=68.51 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR6958161 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:41:46 Started mapping on | Dec 06 14:41:47 Finished on | Dec 06 14:43:18 Mapping speed, Million of reads per hour | 720.97 Number of input reads | 18224585 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 15558606 Uniquely mapped reads % | 85.37% Average mapped length | 288.34 Number of splices: Total | 17932653 Number of splices: Annotated (sjdb) | 16828869 Number of splices: GT/AG | 17677795 Number of splices: GC/AG | 207494 Number of splices: AT/AC | 6462 Number of splices: Non-canonical | 40902 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182522 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 9899 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.38% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2489630 2489630 2489630 N_multimapping 182522 182522 182522 N_noFeature 611453 15073559 756310 N_ambiguous 417706 2405 78658 UnstrandedReadsAssigned:14529447 PositiveStrandReadsAssigned:482642 NegativeStrandReadsAssigned:14723638 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=142 echo kmer=137 SRR6958161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958161-trimmed-pair1.fastq SRR6958161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,224,585 reads, 16,808,463 reads pseudoaligned [quant] estimated average fragment length: 211.076 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR6958161.ke.tsv 35125 SRR6958161.se.tsv 88098 total ==> SRR6958161.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.311 0 0 PNS24247 1044 833.924 47.5258 5.21973 PNS24249 1928 1717.92 43.6637 2.32789 PNS24246 1044 833.924 47.5258 5.21973 PNS24248 1044 833.924 47.5258 5.21973 PNS24244 1471 1260.92 29.759 2.1616 PNS24243 293 110.001 0 0 KQK14069 1603 1392.92 6153.97 404.644 KQK14071 474 268.871 173.439 59.0811 ==> SRR6958161.se.tsv <== BRADI_1g14170v3 6343 BRADI_1g53295v3 990 BRADI_1g59795v3 96 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 257 BRADI_1g74790v3 81 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958161 completed mapping pipeline successfully