Starting /dee2/code/volunteer_pipeline.sh SRR6958162 current disk space = 1550452383744 free memory = 1602728916 SRR6958162 SRAfilesize 1ac513bc81656b5762a33ec867e80948 SRR6958162.sra SRR6958162.sra file validated SRR6958162 is paired end SRR6958162 is conventional basespace SRR6958162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.32325 33.0 32.0 33.0 18.0 34.0 2 31.86875 33.0 31.0 34.0 28.0 34.0 3 30.86175 33.0 31.0 33.0 27.0 33.0 4 32.16975 33.0 32.0 33.0 31.0 34.0 5 32.3345 33.0 33.0 33.0 31.0 34.0 6 36.58975 38.0 37.0 38.0 34.0 38.0 7 37.1465 38.0 38.0 38.0 36.0 38.0 8 37.26 38.0 38.0 38.0 36.0 38.0 9 37.33925 38.0 38.0 38.0 37.0 38.0 10-14 37.4325 38.0 38.0 38.0 37.0 38.0 15-19 37.331399999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.42255 38.0 38.0 38.0 37.0 38.0 25-29 37.346050000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.27655 38.0 38.0 38.0 36.6 38.0 35-39 37.097699999999996 38.0 38.0 38.0 36.2 38.0 40-44 37.076499999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.1734 38.0 38.0 38.0 36.2 38.0 50-54 37.0002 38.0 38.0 38.0 35.8 38.0 55-59 36.78615 38.0 38.0 38.0 35.0 38.0 60-64 36.83 38.0 38.0 38.0 35.0 38.0 65-69 37.013999999999996 38.0 38.0 38.0 35.6 38.0 70-74 36.99739999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.87975 38.0 38.0 38.0 35.2 38.0 80-84 36.51955 38.0 38.0 38.0 34.2 38.0 85-89 36.334950000000006 38.0 37.8 38.0 33.4 38.0 90-94 36.51375 38.0 38.0 38.0 34.0 38.0 95-99 36.4711 38.0 37.8 38.0 34.0 38.0 100-104 36.31955 38.0 37.0 38.0 33.8 38.0 105-109 36.08369999999999 38.0 37.0 38.0 32.4 38.0 110-114 35.90905 38.0 36.8 38.0 31.8 38.0 115-119 35.779399999999995 38.0 36.4 38.0 31.4 38.0 120-124 35.52645 38.0 36.0 38.0 30.6 38.0 125-129 35.304050000000004 38.0 35.6 38.0 29.2 38.0 130-134 35.168699999999994 38.0 35.2 38.0 28.4 38.0 135-139 34.7304 38.0 35.0 38.0 27.6 38.0 140-144 34.43075 38.0 35.0 38.0 26.0 38.0 145-149 33.6132 38.0 34.2 38.0 20.6 38.0 150-151 29.222125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 1.0 21 1.0 22 8.0 23 2.0 24 8.0 25 12.0 26 15.0 27 16.0 28 27.0 29 41.0 30 56.0 31 70.0 32 101.0 33 150.0 34 192.0 35 387.0 36 813.0 37 2096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.62070732957458 9.764223475140954 6.688877498718606 43.926191696565866 2 20.424999999999997 10.9 40.275 28.4 3 19.725 13.425 25.525 41.325 4 24.05 23.674999999999997 23.1 29.175 5 27.150000000000002 27.0 24.15 21.7 6 23.25 31.825 23.825 21.099999999999998 7 18.825 25.05 37.8 18.325 8 19.175 24.825 31.324999999999996 24.675 9 19.375 22.3 33.15 25.174999999999997 10-14 22.145 26.93 26.090000000000003 24.834999999999997 15-19 22.439999999999998 25.564999999999998 26.314999999999998 25.679999999999996 20-24 22.655 25.735000000000003 26.150000000000002 25.46 25-29 22.81 25.064999999999998 26.395000000000003 25.729999999999997 30-34 21.654999999999998 25.495 27.189999999999998 25.66 35-39 22.605 25.635 26.935 24.825 40-44 22.939999999999998 25.395 26.674999999999997 24.990000000000002 45-49 22.7 25.72 25.955000000000002 25.624999999999996 50-54 22.56 25.590000000000003 26.255 25.595000000000002 55-59 22.55 25.905 26.1 25.445 60-64 22.84 25.224999999999998 26.895000000000003 25.040000000000003 65-69 23.305 24.975 26.005 25.715 70-74 22.23 26.200000000000003 26.1 25.47 75-79 22.634999999999998 25.445 26.150000000000002 25.77 80-84 23.18 25.495 26.179999999999996 25.145 85-89 22.435 25.72 26.1 25.745 90-94 22.75 25.005 26.009999999999998 26.235000000000003 95-99 23.265 25.465 26.145000000000003 25.124999999999996 100-104 22.905 25.46 26.255 25.380000000000003 105-109 23.635 24.959999999999997 25.790000000000003 25.615 110-114 22.75 25.569999999999997 26.165 25.515 115-119 23.62 25.685000000000002 25.915 24.779999999999998 120-124 22.62 25.665 26.16 25.555 125-129 22.105 25.590000000000003 26.355 25.95 130-134 22.945 25.374999999999996 25.85 25.83 135-139 23.055 25.430000000000003 26.105 25.41 140-144 23.474999999999998 25.374999999999996 25.83 25.319999999999997 145-149 23.405 25.650000000000002 25.465 25.480000000000004 150-151 22.527815976997125 25.278159769971246 26.8533566695837 25.340667583447928 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 1.5 29 4.0 30 7.5 31 12.5 32 17.0 33 19.5 34 27.5 35 41.0 36 53.0 37 73.5 38 89.0 39 101.5 40 127.0 41 152.0 42 171.0 43 187.5 44 209.5 45 216.0 46 205.0 47 209.0 48 220.0 49 198.5 50 180.5 51 176.0 52 153.5 53 119.5 54 105.5 55 103.0 56 90.5 57 87.5 58 72.5 59 64.5 60 64.0 61 56.5 62 50.5 63 46.5 64 45.5 65 39.0 66 37.5 67 39.5 68 30.5 69 23.0 70 18.5 71 12.5 72 9.5 73 8.5 74 6.0 75 2.5 76 3.0 77 3.0 78 2.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.55 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93075 33.0 33.0 34.0 32.0 34.0 2 32.91975 33.0 33.0 34.0 32.0 34.0 3 32.88275 34.0 33.0 34.0 32.0 34.0 4 32.90075 34.0 33.0 34.0 32.0 34.0 5 32.861 34.0 33.0 34.0 32.0 34.0 6 37.08775 38.0 38.0 38.0 36.0 38.0 7 37.048 38.0 38.0 38.0 36.0 38.0 8 37.04325 38.0 38.0 38.0 36.0 38.0 9 36.93025 38.0 38.0 38.0 36.0 38.0 10-14 36.916700000000006 38.0 38.0 38.0 35.6 38.0 15-19 36.873850000000004 38.0 38.0 38.0 35.6 38.0 20-24 36.940599999999996 38.0 38.0 38.0 36.0 38.0 25-29 37.011250000000004 38.0 38.0 38.0 36.0 38.0 30-34 37.08025 38.0 38.0 38.0 36.4 38.0 35-39 37.065999999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.930099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.86985 38.0 38.0 38.0 35.6 38.0 50-54 36.7324 38.0 38.0 38.0 35.0 38.0 55-59 36.852549999999994 38.0 38.0 38.0 35.4 38.0 60-64 36.780100000000004 38.0 38.0 38.0 35.2 38.0 65-69 36.68845 38.0 38.0 38.0 34.6 38.0 70-74 36.50365 38.0 38.0 38.0 34.0 38.0 75-79 36.35665 38.0 38.0 38.0 33.6 38.0 80-84 36.23255 38.0 37.8 38.0 33.4 38.0 85-89 36.1569 38.0 37.8 38.0 33.2 38.0 90-94 36.161 38.0 37.8 38.0 33.0 38.0 95-99 35.947649999999996 38.0 37.0 38.0 32.0 38.0 100-104 35.877599999999994 38.0 37.0 38.0 32.4 38.0 105-109 35.69369999999999 38.0 36.8 38.0 31.2 38.0 110-114 35.33825 38.0 36.0 38.0 29.6 38.0 115-119 35.113350000000004 38.0 35.6 38.0 28.4 38.0 120-124 35.15725 38.0 35.6 38.0 28.4 38.0 125-129 34.976350000000004 38.0 35.6 38.0 28.0 38.0 130-134 34.572799999999994 38.0 35.0 38.0 26.0 38.0 135-139 34.0264 38.0 34.2 38.0 23.4 38.0 140-144 33.8091 38.0 34.2 38.0 22.6 38.0 145-149 32.88765000000001 38.0 33.6 38.0 16.8 38.0 150-151 28.04225 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 2.0 14 0.0 15 2.0 16 6.0 17 2.0 18 2.0 19 4.0 20 4.0 21 3.0 22 8.0 23 13.0 24 18.0 25 20.0 26 21.0 27 24.0 28 40.0 29 30.0 30 64.0 31 92.0 32 111.0 33 150.0 34 212.0 35 313.0 36 714.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.275 17.299999999999997 11.700000000000001 36.725 2 27.725 24.175 29.599999999999998 18.5 3 21.880470117529384 24.731182795698924 29.182295573893473 24.20605151287822 4 27.306826706676667 29.932483120780194 21.230307576894223 21.530382595648913 5 28.107026756689173 33.18329582395599 20.655163790947736 18.0545136284071 6 21.65 36.525 21.175 20.65 7 24.125 19.85 34.449999999999996 21.575 8 24.4 24.75 25.275 25.575 9 24.5 22.85 28.925 23.724999999999998 10-14 25.624999999999996 26.68 24.185000000000002 23.51 15-19 25.235000000000003 25.775 25.085 23.905 20-24 25.290000000000003 26.229999999999997 24.82 23.66 25-29 25.505 25.935000000000002 24.8 23.76 30-34 25.15 25.650000000000002 25.21 23.990000000000002 35-39 24.825 25.915 24.745 24.515 40-44 25.230000000000004 25.485000000000003 25.235000000000003 24.05 45-49 25.35 26.605 24.88 23.165 50-54 25.915 25.580000000000002 25.45 23.055 55-59 25.96 25.28 25.085 23.674999999999997 60-64 25.47 25.75 25.41 23.369999999999997 65-69 24.965 26.224999999999998 25.405 23.405 70-74 26.145000000000003 25.455 25.115 23.285 75-79 25.205 25.835 25.355 23.605 80-84 25.874999999999996 26.215 25.035 22.875 85-89 25.575 26.290000000000003 25.064999999999998 23.07 90-94 25.740000000000002 26.729999999999997 24.64 22.89 95-99 25.52 26.424999999999997 25.05 23.005 100-104 25.569999999999997 25.8 25.174999999999997 23.455000000000002 105-109 25.15 26.055 25.6 23.195 110-114 25.655 26.165 24.9 23.28 115-119 26.3 25.56 24.87 23.27 120-124 25.990000000000002 25.915 25.44 22.655 125-129 25.569999999999997 26.095000000000002 25.290000000000003 23.044999999999998 130-134 26.205000000000002 26.155 24.795 22.845 135-139 26.275 26.145000000000003 25.180000000000003 22.400000000000002 140-144 26.255 26.35 24.765 22.63 145-149 26.424999999999997 26.090000000000003 24.765 22.720000000000002 150-151 26.156539134783696 26.619154788697173 25.218804701175294 22.005501375343837 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 0.5 25 1.5 26 2.5 27 3.5 28 4.0 29 4.0 30 5.0 31 7.0 32 14.0 33 23.0 34 34.0 35 45.0 36 43.5 37 50.5 38 77.0 39 102.0 40 121.0 41 141.5 42 169.0 43 191.5 44 183.0 45 193.5 46 217.0 47 205.0 48 193.0 49 188.5 50 173.0 51 148.0 52 142.5 53 134.5 54 110.0 55 108.5 56 111.0 57 101.5 58 93.5 59 90.5 60 81.0 61 64.0 62 61.5 63 57.0 64 46.0 65 41.5 66 36.0 67 35.0 68 31.0 69 20.0 70 19.5 71 18.5 72 16.5 73 14.0 74 9.0 75 6.5 76 3.0 77 2.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98811029597773 97.82499999999999 2 0.8854034910194789 1.7500000000000002 3 0.07589172780166961 0.22499999999999998 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.1375 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCAG 10 0.006830828 145.0 5 >>END_MODULE Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037555 spots for SRR6958162.sra Written 1037555 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra Read 1037543 spots for SRR6958162.sra Written 1037543 spots for SRR6958162.sra SRR ids: ['SRR6958162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3oot_j72 SRR6958162.sra spots: 20750872 blocks: [[1, 1037543], [1037544, 2075086], [2075087, 3112629], [3112630, 4150172], [4150173, 5187715], [5187716, 6225258], [6225259, 7262801], [7262802, 8300344], [8300345, 9337887], [9337888, 10375430], [10375431, 11412973], [11412974, 12450516], [12450517, 13488059], [13488060, 14525602], [14525603, 15563145], [15563146, 16600688], [16600689, 17638231], [17638232, 18675774], [18675775, 19713317], [19713318, 20750872]] SRR6958162 file size 7010089 SRR6958162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958162 SRR6958162_1.fastq SRR6958162_2.fastq Input file: SRR6958162_1.fastq Paired file: SRR6958162_2.fastq trimmed: SRR6958162-trimmed-pair1.fastq, SRR6958162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:43:02 2024 >> started Fri Dec 6 14:43:27 2024 >> done (25.751s) 20750872 read pairs processed; of these: 9004 ( 0.04%) short read pairs filtered out after trimming by size control 6341 ( 0.03%) empty read pairs filtered out after trimming by size control 20735527 (99.93%) read pairs available; of these: 7495136 (36.15%) trimmed read pairs available after processing 13240391 (63.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 0 0.00% 24 8 0.00% 25 3 0.00% 26 7 0.00% 27 3 0.00% 28 5 0.00% 29 10 0.00% 30 6 0.00% 31 9 0.00% 32 13 0.00% 33 4 0.00% 34 10 0.00% 35 8 0.00% 36 6 0.00% 37 4 0.00% 38 10 0.00% 39 13 0.00% 40 11 0.00% 41 11 0.00% 42 20 0.00% 43 12 0.00% 44 18 0.00% 45 14 0.00% 46 21 0.00% 47 19 0.00% 48 14 0.00% 49 32 0.00% 50 26 0.00% 51 22 0.00% 52 32 0.00% 53 32 0.00% 54 39 0.00% 55 39 0.00% 56 51 0.00% 57 58 0.00% 58 60 0.00% 59 58 0.00% 60 97 0.00% 61 101 0.00% 62 104 0.00% 63 119 0.00% 64 143 0.00% 65 143 0.00% 66 161 0.00% 67 182 0.00% 68 213 0.00% 69 217 0.00% 70 256 0.00% 71 305 0.00% 72 318 0.00% 73 370 0.00% 74 427 0.00% 75 453 0.00% 76 539 0.00% 77 628 0.00% 78 655 0.00% 79 703 0.00% 80 813 0.00% 81 894 0.00% 82 1045 0.01% 83 1128 0.01% 84 1678 0.01% 85 2122 0.01% 86 2179 0.01% 87 2353 0.01% 88 2522 0.01% 89 2685 0.01% 90 2874 0.01% 91 2985 0.01% 92 3260 0.02% 93 3515 0.02% 94 3825 0.02% 95 4067 0.02% 96 4262 0.02% 97 4728 0.02% 98 5094 0.02% 99 5320 0.03% 100 5831 0.03% 101 6189 0.03% 102 6458 0.03% 103 6923 0.03% 104 7305 0.04% 105 7795 0.04% 106 8324 0.04% 107 8876 0.04% 108 9338 0.05% 109 9784 0.05% 110 10544 0.05% 111 11195 0.05% 112 11961 0.06% 113 12400 0.06% 114 13141 0.06% 115 14267 0.07% 116 14814 0.07% 117 15733 0.08% 118 16796 0.08% 119 17469 0.08% 120 18266 0.09% 121 19296 0.09% 122 20143 0.10% 123 21604 0.10% 124 22570 0.11% 125 23844 0.11% 126 25183 0.12% 127 26449 0.13% 128 28189 0.14% 129 29606 0.14% 130 31411 0.15% 131 33150 0.16% 132 35061 0.17% 133 37842 0.18% 134 39522 0.19% 135 42926 0.21% 136 45911 0.22% 137 48833 0.24% 138 52720 0.25% 139 57964 0.28% 140 63419 0.31% 141 69270 0.33% 142 77946 0.38% 143 88765 0.43% 144 104802 0.51% 145 129091 0.62% 146 162545 0.78% 147 226441 1.09% 148 358069 1.73% 149 753964 3.64% 150 4520979 21.80% 151 13240391 63.85% 20735527 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=21 prefix-density=0.78 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=88.06 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.3 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=24.40 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958162 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:44:10 Started mapping on | Dec 06 14:44:10 Finished on | Dec 06 14:46:14 Mapping speed, Million of reads per hour | 602.00 Number of input reads | 20735527 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20068085 Uniquely mapped reads % | 96.78% Average mapped length | 297.66 Number of splices: Total | 23907079 Number of splices: Annotated (sjdb) | 22514194 Number of splices: GT/AG | 23575047 Number of splices: GC/AG | 278595 Number of splices: AT/AC | 8875 Number of splices: Non-canonical | 44562 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252855 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 23318 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420566 420566 420566 N_multimapping 252855 252855 252855 N_noFeature 804958 19416004 980923 N_ambiguous 553921 2872 79049 UnstrandedReadsAssigned:18709206 PositiveStrandReadsAssigned:649209 NegativeStrandReadsAssigned:19008113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958162-trimmed-pair1.fastq SRR6958162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,735,527 reads, 18,982,499 reads pseudoaligned [quant] estimated average fragment length: 278.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52973 SRR6958162.ke.tsv 35125 SRR6958162.se.tsv 88098 total ==> SRR6958162.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.727 0 0 PNS24247 1044 766.258 64.1302 6.64958 PNS24249 1928 1650.26 16.7505 0.806458 PNS24246 1044 766.258 64.1302 6.64958 PNS24248 1044 766.258 64.1302 6.64958 PNS24244 1471 1193.26 64.8588 4.31858 PNS24243 293 76.2233 0 0 KQK14069 1603 1325.26 7068.74 423.787 KQK14071 474 213.598 70.405 26.1886 ==> SRR6958162.se.tsv <== BRADI_1g14170v3 7911 BRADI_1g53295v3 1236 BRADI_1g59795v3 116 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 343 BRADI_1g74790v3 137 BRADI_1g09890v3 0 BRADI_1g77505v3 232 BRADI_1g48960v3 0 SRR6958162 completed mapping pipeline successfully