Starting /dee2/code/volunteer_pipeline.sh SRR6958163 current disk space = 1550401785856 free memory = 1598954320 SRR6958163 SRAfilesize a21f216570a0979da7a1e0d09ca5e81e SRR6958163.sra SRR6958163.sra file validated SRR6958163 is paired end SRR6958163 is conventional basespace SRR6958163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.4965 32.0 30.0 33.0 18.0 33.0 2 30.29975 31.0 29.0 33.0 25.0 33.0 3 30.60225 33.0 29.0 33.0 27.0 33.0 4 29.4675 31.0 29.0 33.0 15.0 33.0 5 31.32675 33.0 32.0 33.0 27.0 33.0 6 36.12275 38.0 36.0 38.0 33.0 38.0 7 36.7315 38.0 37.0 38.0 34.0 38.0 8 37.0855 38.0 38.0 38.0 36.0 38.0 9 37.33125 38.0 38.0 38.0 37.0 38.0 10-14 37.35355 38.0 38.0 38.0 37.0 38.0 15-19 37.3998 38.0 38.0 38.0 37.0 38.0 20-24 37.45505 38.0 38.0 38.0 37.0 38.0 25-29 37.360749999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.274649999999994 38.0 38.0 38.0 36.8 38.0 35-39 37.138 38.0 38.0 38.0 36.4 38.0 40-44 37.01495 38.0 38.0 38.0 35.8 38.0 45-49 37.16915 38.0 38.0 38.0 36.0 38.0 50-54 37.083749999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.87105 38.0 38.0 38.0 35.0 38.0 60-64 36.899100000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.8178 38.0 38.0 38.0 34.8 38.0 70-74 36.880399999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.644099999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.42139999999999 38.0 37.6 38.0 33.6 38.0 85-89 36.187149999999995 38.0 37.0 38.0 33.0 38.0 90-94 36.28185 38.0 37.2 38.0 33.4 38.0 95-99 36.2001 38.0 37.0 38.0 33.0 38.0 100-104 36.24665 38.0 37.0 38.0 33.4 38.0 105-109 35.84155 38.0 36.4 38.0 31.6 38.0 110-114 35.4898 38.0 35.8 38.0 29.6 38.0 115-119 35.295249999999996 38.0 35.2 38.0 29.0 38.0 120-124 35.15255 38.0 35.0 38.0 28.2 38.0 125-129 34.85335 38.0 34.8 38.0 27.4 38.0 130-134 34.574850000000005 38.0 34.8 38.0 25.8 38.0 135-139 34.44135 38.0 34.8 38.0 25.4 38.0 140-144 33.95335000000001 38.0 34.2 38.0 23.6 38.0 145-149 32.49425 36.8 33.2 38.0 15.2 38.0 150-151 28.21575 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 4.0 24 12.0 25 13.0 26 15.0 27 23.0 28 29.0 29 37.0 30 62.0 31 81.0 32 127.0 33 172.0 34 258.0 35 466.0 36 964.0 37 1727.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.03604531410917 9.268795056642636 8.72811534500515 41.96704428424305 2 23.925 10.65 36.65 28.775000000000002 3 20.674999999999997 14.725 24.525 40.075 4 26.575 22.1 22.425 28.9 5 25.068801601200903 28.87165374030523 23.967975981986488 22.091568676507382 6 23.025000000000002 33.074999999999996 23.825 20.075000000000003 7 18.975 25.15 36.725 19.15 8 21.375 23.599999999999998 29.425 25.6 9 19.85 22.0 33.025 25.124999999999996 10-14 22.43 26.575 26.205000000000002 24.79 15-19 23.565 24.27 26.235000000000003 25.929999999999996 20-24 22.8 25.7 26.200000000000003 25.3 25-29 23.125 25.46 26.314999999999998 25.1 30-34 22.68 25.81 25.665 25.845000000000002 35-39 23.135 25.314999999999998 25.840000000000003 25.71 40-44 22.775000000000002 26.1 25.465 25.66 45-49 23.06 25.4 25.61 25.929999999999996 50-54 22.965 24.79 26.245 26.0 55-59 23.025000000000002 25.169999999999998 26.145000000000003 25.66 60-64 23.655 25.365 25.455 25.525 65-69 23.375 25.295 25.335 25.995 70-74 24.135 24.825 25.335 25.705 75-79 22.785 25.72 25.595000000000002 25.900000000000002 80-84 23.48 25.124999999999996 25.569999999999997 25.825 85-89 23.445 25.224999999999998 25.825 25.505 90-94 23.22 25.64 25.135 26.005 95-99 23.1 24.945 26.179999999999996 25.775 100-104 23.119999999999997 25.41 26.150000000000002 25.319999999999997 105-109 23.599999999999998 24.795 26.040000000000003 25.564999999999998 110-114 23.625 25.324999999999996 25.39 25.66 115-119 23.425 25.324999999999996 25.595000000000002 25.655 120-124 23.21 25.19 25.509999999999998 26.090000000000003 125-129 23.03 25.290000000000003 25.72 25.96 130-134 23.695 25.085 25.380000000000003 25.840000000000003 135-139 23.855 25.085 25.655 25.405 140-144 23.93 25.040000000000003 25.290000000000003 25.740000000000002 145-149 23.45 25.22 25.490000000000002 25.840000000000003 150-151 24.637137137137138 24.86236236236236 24.774774774774773 25.725725725725724 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 3.0 29 6.0 30 11.0 31 13.5 32 11.5 33 14.0 34 19.0 35 29.5 36 47.5 37 64.0 38 75.5 39 92.5 40 123.0 41 162.5 42 193.5 43 201.5 44 211.0 45 217.0 46 207.0 47 195.0 48 187.5 49 182.0 50 176.5 51 151.0 52 120.0 53 107.5 54 99.0 55 89.5 56 90.5 57 89.5 58 78.5 59 75.0 60 76.0 61 77.5 62 70.0 63 66.0 64 61.5 65 54.0 66 44.5 67 36.0 68 32.5 69 23.0 70 24.5 71 25.0 72 15.5 73 11.0 74 9.5 75 8.5 76 8.0 77 5.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACGGT 10 0.0060887975 150.61038 1 TACGGTA 10 0.006836113 144.9625 2 >>END_MODULE SRR6958163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90175 33.0 33.0 34.0 32.0 34.0 2 32.88675 33.0 33.0 34.0 32.0 34.0 3 32.75 33.0 33.0 34.0 32.0 34.0 4 32.8 33.0 33.0 34.0 32.0 34.0 5 32.885 34.0 33.0 34.0 32.0 34.0 6 37.05125 38.0 38.0 38.0 36.0 38.0 7 36.89325 38.0 38.0 38.0 36.0 38.0 8 36.91725 38.0 38.0 38.0 36.0 38.0 9 36.7995 38.0 38.0 38.0 35.0 38.0 10-14 36.8129 38.0 38.0 38.0 35.4 38.0 15-19 36.80645 38.0 38.0 38.0 35.0 38.0 20-24 36.8258 38.0 38.0 38.0 35.4 38.0 25-29 36.86745 38.0 38.0 38.0 35.4 38.0 30-34 36.968849999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.757000000000005 38.0 38.0 38.0 35.2 38.0 40-44 36.719049999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.69885 38.0 38.0 38.0 34.6 38.0 50-54 36.6967 38.0 38.0 38.0 35.0 38.0 55-59 36.587599999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.71285 38.0 38.0 38.0 34.8 38.0 65-69 36.4531 38.0 38.0 38.0 33.8 38.0 70-74 36.375 38.0 38.0 38.0 34.0 38.0 75-79 36.212599999999995 38.0 37.6 38.0 33.0 38.0 80-84 36.07045 38.0 37.2 38.0 32.4 38.0 85-89 35.90065 38.0 37.0 38.0 31.8 38.0 90-94 35.76205 38.0 37.0 38.0 31.4 38.0 95-99 35.74725 38.0 37.0 38.0 31.0 38.0 100-104 35.610049999999994 38.0 36.8 38.0 31.0 38.0 105-109 35.2577 38.0 35.8 38.0 29.2 38.0 110-114 35.01435 38.0 35.6 38.0 27.6 38.0 115-119 34.7626 38.0 35.0 38.0 26.6 38.0 120-124 34.5757 38.0 35.0 38.0 25.8 38.0 125-129 34.36575 38.0 34.8 38.0 24.2 38.0 130-134 34.0118 38.0 34.4 38.0 23.4 38.0 135-139 33.3283 38.0 33.8 38.0 19.0 38.0 140-144 32.78625000000001 38.0 33.0 38.0 14.2 38.0 145-149 31.814550000000004 37.8 31.4 38.0 11.0 38.0 150-151 27.3365 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 0.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 3.0 14 3.0 15 1.0 16 1.0 17 4.0 18 3.0 19 4.0 20 5.0 21 9.0 22 12.0 23 14.0 24 20.0 25 19.0 26 37.0 27 41.0 28 49.0 29 52.0 30 57.0 31 99.0 32 110.0 33 140.0 34 258.0 35 406.0 36 800.0 37 1840.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.80185138854141 16.537403052289218 12.984738553915436 34.676007005253936 2 29.525000000000002 22.3 29.299999999999997 18.875 3 21.085542771385693 26.23811905952976 27.938969484742373 24.73736868434217 4 27.400000000000002 30.875000000000004 20.45 21.275 5 29.139569784892444 31.6408204102051 19.809904952476238 19.409704852426213 6 22.275 35.949999999999996 20.95 20.825 7 23.0 20.25 34.775 21.975 8 23.375 24.275 25.0 27.35 9 23.599999999999998 21.825 28.7 25.874999999999996 10-14 25.619999999999997 27.060000000000002 22.965 24.355 15-19 25.509999999999998 25.39 25.2 23.9 20-24 25.545 26.534999999999997 24.485 23.435 25-29 25.624999999999996 25.835 24.185000000000002 24.355 30-34 25.745 25.990000000000002 24.51 23.755000000000003 35-39 26.009999999999998 26.075 24.349999999999998 23.565 40-44 25.845000000000002 25.580000000000002 24.75 23.825 45-49 26.02 25.505 25.080000000000002 23.395 50-54 26.255 25.86 24.6 23.285 55-59 26.465 25.055 24.775 23.705000000000002 60-64 25.674999999999997 24.965 25.16 24.2 65-69 25.845000000000002 25.635 24.69 23.830000000000002 70-74 26.19 25.619999999999997 24.725 23.465 75-79 25.380000000000003 25.679999999999996 25.115 23.825 80-84 25.77 25.240000000000002 24.7 24.29 85-89 25.6 24.605 25.535000000000004 24.26 90-94 25.895000000000003 25.014999999999997 25.185000000000002 23.905 95-99 25.495 25.555 25.025 23.925 100-104 25.965 24.86 25.0 24.175 105-109 25.39 25.39 25.174999999999997 24.044999999999998 110-114 25.66 26.63 24.515 23.195 115-119 26.355 25.885 24.265 23.494999999999997 120-124 25.995 25.77 24.665 23.57 125-129 26.395000000000003 26.119999999999997 24.455 23.03 130-134 26.784999999999997 26.040000000000003 23.79 23.385 135-139 26.415 25.55 24.75 23.285 140-144 26.945000000000004 26.165 24.725 22.165000000000003 145-149 26.605 25.535000000000004 24.725 23.135 150-151 26.392191215117005 26.2670504317357 24.802903266174447 22.537855086972844 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 1.5 28 2.0 29 3.5 30 5.5 31 7.0 32 10.5 33 12.5 34 25.5 35 38.0 36 42.0 37 55.0 38 78.0 39 107.5 40 124.0 41 149.5 42 162.0 43 168.5 44 192.5 45 194.0 46 199.0 47 202.5 48 194.0 49 176.0 50 160.5 51 164.5 52 152.0 53 120.0 54 104.0 55 104.0 56 87.0 57 79.5 58 85.5 59 79.5 60 80.0 61 76.0 62 63.0 63 63.0 64 58.5 65 48.0 66 47.5 67 48.5 68 49.0 69 46.0 70 39.5 71 25.5 72 16.5 73 15.5 74 11.5 75 7.0 76 4.5 77 3.5 78 2.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.05 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47172694854814 96.65 2 1.3245033112582782 2.6 3 0.10188487009679062 0.3 4 0.07641365257259297 0.3 5 0.0 0.0 6 0.025471217524197655 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.2125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAACA 10 0.006830828 145.0 2 TTGATTC 10 0.006830828 145.0 9 >>END_MODULE Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra Read 896690 spots for SRR6958163.sra Written 896690 spots for SRR6958163.sra Read 896675 spots for SRR6958163.sra Written 896675 spots for SRR6958163.sra SRR ids: ['SRR6958163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0fib152o SRR6958163.sra spots: 17933515 blocks: [[1, 896675], [896676, 1793350], [1793351, 2690025], [2690026, 3586700], [3586701, 4483375], [4483376, 5380050], [5380051, 6276725], [6276726, 7173400], [7173401, 8070075], [8070076, 8966750], [8966751, 9863425], [9863426, 10760100], [10760101, 11656775], [11656776, 12553450], [12553451, 13450125], [13450126, 14346800], [14346801, 15243475], [15243476, 16140150], [16140151, 17036825], [17036826, 17933515]] SRR6958163 file size 6055379 SRR6958163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958163 SRR6958163_1.fastq SRR6958163_2.fastq Input file: SRR6958163_1.fastq Paired file: SRR6958163_2.fastq trimmed: SRR6958163-trimmed-pair1.fastq, SRR6958163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:43:21 2024 >> started Fri Dec 6 14:43:42 2024 >> done (20.908s) 17933515 read pairs processed; of these: 13160 ( 0.07%) short read pairs filtered out after trimming by size control 11912 ( 0.07%) empty read pairs filtered out after trimming by size control 17908443 (99.86%) read pairs available; of these: 6544897 (36.55%) trimmed read pairs available after processing 11363546 (63.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 8 0.00% 26 5 0.00% 27 5 0.00% 28 2 0.00% 29 2 0.00% 30 8 0.00% 31 4 0.00% 32 15 0.00% 33 12 0.00% 34 5 0.00% 35 7 0.00% 36 7 0.00% 37 13 0.00% 38 10 0.00% 39 11 0.00% 40 9 0.00% 41 11 0.00% 42 12 0.00% 43 19 0.00% 44 23 0.00% 45 14 0.00% 46 17 0.00% 47 17 0.00% 48 33 0.00% 49 34 0.00% 50 29 0.00% 51 32 0.00% 52 35 0.00% 53 40 0.00% 54 46 0.00% 55 50 0.00% 56 61 0.00% 57 78 0.00% 58 70 0.00% 59 70 0.00% 60 83 0.00% 61 127 0.00% 62 126 0.00% 63 161 0.00% 64 194 0.00% 65 164 0.00% 66 166 0.00% 67 214 0.00% 68 215 0.00% 69 235 0.00% 70 337 0.00% 71 371 0.00% 72 372 0.00% 73 418 0.00% 74 428 0.00% 75 427 0.00% 76 578 0.00% 77 611 0.00% 78 682 0.00% 79 778 0.00% 80 877 0.00% 81 981 0.01% 82 1096 0.01% 83 1282 0.01% 84 1958 0.01% 85 2344 0.01% 86 2340 0.01% 87 2622 0.01% 88 2790 0.02% 89 2984 0.02% 90 3179 0.02% 91 3533 0.02% 92 3641 0.02% 93 3755 0.02% 94 4318 0.02% 95 4428 0.02% 96 4427 0.02% 97 4936 0.03% 98 5350 0.03% 99 5607 0.03% 100 5966 0.03% 101 6381 0.04% 102 6784 0.04% 103 7194 0.04% 104 7553 0.04% 105 8091 0.05% 106 8714 0.05% 107 9160 0.05% 108 9553 0.05% 109 10240 0.06% 110 10876 0.06% 111 11342 0.06% 112 12203 0.07% 113 13290 0.07% 114 13558 0.08% 115 15225 0.09% 116 15184 0.08% 117 16025 0.09% 118 16750 0.09% 119 17931 0.10% 120 18588 0.10% 121 19211 0.11% 122 20360 0.11% 123 21662 0.12% 124 22348 0.12% 125 23593 0.13% 126 24998 0.14% 127 26568 0.15% 128 27590 0.15% 129 28817 0.16% 130 30538 0.17% 131 32319 0.18% 132 34018 0.19% 133 36473 0.20% 134 39165 0.22% 135 41075 0.23% 136 44088 0.25% 137 46863 0.26% 138 50235 0.28% 139 54524 0.30% 140 59247 0.33% 141 65107 0.36% 142 72599 0.41% 143 82462 0.46% 144 96540 0.54% 145 118776 0.66% 146 154697 0.86% 147 204529 1.14% 148 321990 1.80% 149 686219 3.83% 150 3747714 20.93% 151 11363546 63.45% 17908443 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=27 prefix-density=0.81 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=53.47 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=16 prefix-density=0.53 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=33.56 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958163 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:44:22 Started mapping on | Dec 06 14:44:23 Finished on | Dec 06 14:45:51 Mapping speed, Million of reads per hour | 732.62 Number of input reads | 17908443 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17350204 Uniquely mapped reads % | 96.88% Average mapped length | 297.69 Number of splices: Total | 20377659 Number of splices: Annotated (sjdb) | 19227190 Number of splices: GT/AG | 20116809 Number of splices: GC/AG | 237200 Number of splices: AT/AC | 7601 Number of splices: Non-canonical | 16049 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206438 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 40717 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 359371 359371 359371 N_multimapping 206438 206438 206438 N_noFeature 708284 16859919 855098 N_ambiguous 410728 2365 68031 UnstrandedReadsAssigned:16231192 PositiveStrandReadsAssigned:487920 NegativeStrandReadsAssigned:16427075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958163-trimmed-pair1.fastq SRR6958163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,908,443 reads, 16,483,873 reads pseudoaligned [quant] estimated average fragment length: 272.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6958163.ke.tsv 35125 SRR6958163.se.tsv 88098 total ==> SRR6958163.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.815 0 0 PNS24247 1044 772.351 52.1481 6.14177 PNS24249 1928 1656.35 41.0489 2.25434 PNS24246 1044 772.351 52.1481 6.14177 PNS24248 1044 772.351 52.1481 6.14177 PNS24244 1471 1199.35 21.5067 1.63116 PNS24243 293 78.7546 0 0 KQK14069 1603 1331.35 6287.85 429.615 KQK14071 474 217.289 83.0511 34.7678 ==> SRR6958163.se.tsv <== BRADI_1g14170v3 6800 BRADI_1g53295v3 227 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 159 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 212 BRADI_1g48960v3 0 SRR6958163 completed mapping pipeline successfully