Starting /dee2/code/volunteer_pipeline.sh SRR6958164 current disk space = 1550514348032 free memory = 1603047656 SRR6958164 SRAfilesize 03169aa33b50f28c6dd8a7af90a7cbca SRR6958164.sra SRR6958164.sra file validated SRR6958164 is paired end SRR6958164 is conventional basespace SRR6958164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.84625 32.0 25.0 33.0 18.0 33.0 2 27.79125 29.0 25.0 33.0 18.0 33.0 3 29.81075 31.0 28.0 33.0 25.0 33.0 4 31.2205 33.0 31.0 33.0 28.0 33.0 5 31.7465 33.0 32.0 33.0 30.0 34.0 6 36.7285 38.0 37.0 38.0 34.0 38.0 7 37.073 38.0 38.0 38.0 35.0 38.0 8 37.2395 38.0 38.0 38.0 36.0 38.0 9 37.14375 38.0 38.0 38.0 36.0 38.0 10-14 37.30955 38.0 38.0 38.0 36.8 38.0 15-19 37.429199999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.326800000000006 38.0 38.0 38.0 36.8 38.0 25-29 37.08284999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.97555 38.0 38.0 38.0 35.8 38.0 35-39 36.75 38.0 38.0 38.0 35.2 38.0 40-44 36.850649999999995 38.0 38.0 38.0 35.4 38.0 45-49 36.77955 38.0 38.0 38.0 35.0 38.0 50-54 36.48955 38.0 38.0 38.0 34.0 38.0 55-59 36.44415 38.0 38.0 38.0 33.8 38.0 60-64 36.6617 38.0 38.0 38.0 34.6 38.0 65-69 36.6831 38.0 38.0 38.0 34.4 38.0 70-74 36.46640000000001 38.0 38.0 38.0 34.0 38.0 75-79 35.90535 38.0 36.8 38.0 31.2 38.0 80-84 35.73479999999999 38.0 36.8 38.0 30.8 38.0 85-89 36.012150000000005 38.0 36.8 38.0 32.2 38.0 90-94 36.0379 38.0 37.0 38.0 33.0 38.0 95-99 35.725300000000004 38.0 36.4 38.0 31.0 38.0 100-104 34.914 38.0 35.4 38.0 27.0 38.0 105-109 34.57965 38.0 34.8 38.0 25.4 38.0 110-114 34.739850000000004 38.0 34.8 38.0 26.4 38.0 115-119 34.43729999999999 38.0 34.6 38.0 24.6 38.0 120-124 34.33365 38.0 34.2 38.0 24.6 38.0 125-129 33.93875 38.0 33.8 38.0 22.0 38.0 130-134 33.7595 38.0 34.0 38.0 22.2 38.0 135-139 32.978500000000004 37.8 33.2 38.0 18.4 38.0 140-144 31.93395 36.4 32.0 38.0 13.8 38.0 145-149 30.259050000000002 35.6 29.0 38.0 8.6 38.0 150-151 25.446875 33.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 2.0 17 5.0 18 7.0 19 10.0 20 5.0 21 14.0 22 12.0 23 10.0 24 8.0 25 22.0 26 33.0 27 36.0 28 52.0 29 66.0 30 81.0 31 101.0 32 158.0 33 192.0 34 302.0 35 505.0 36 1045.0 37 1327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.37281762019876 9.85764168681171 9.965081923180232 35.804458769809294 2 23.3 11.475 32.35 32.875 3 21.6 15.85 26.924999999999997 35.625 4 25.724999999999998 22.15 23.7 28.425 5 27.750000000000004 24.625 24.675 22.95 6 25.924999999999997 28.999999999999996 23.400000000000002 21.675 7 18.475 23.45 37.3 20.775 8 21.0 24.349999999999998 27.700000000000003 26.950000000000003 9 20.125 23.599999999999998 32.05 24.224999999999998 10-14 23.225 25.805 25.595000000000002 25.374999999999996 15-19 23.155 24.915000000000003 25.845000000000002 26.085 20-24 23.82 24.82 25.535000000000004 25.825 25-29 23.335 24.93 25.990000000000002 25.745 30-34 23.96 25.040000000000003 25.22 25.779999999999998 35-39 23.56 24.745 25.44 26.255 40-44 23.805 24.245 25.895000000000003 26.055 45-49 23.53 24.485 25.715 26.27 50-54 23.43 24.740000000000002 26.040000000000003 25.790000000000003 55-59 23.974999999999998 24.08 26.35 25.595000000000002 60-64 24.11 24.82 25.474999999999998 25.595000000000002 65-69 23.655 24.065 25.96 26.32 70-74 23.96 23.69 25.759999999999998 26.590000000000003 75-79 24.279999999999998 24.38 25.635 25.705 80-84 23.630000000000003 24.240000000000002 26.075 26.055 85-89 24.395 23.5 25.569999999999997 26.534999999999997 90-94 24.195 24.365000000000002 25.56 25.88 95-99 23.71 24.4 25.64 26.25 100-104 24.57 24.485 25.324999999999996 25.619999999999997 105-109 24.490000000000002 23.845 25.629999999999995 26.035000000000004 110-114 24.88124406220311 24.23121156057803 25.101255062753136 25.786289314465723 115-119 24.25 24.395 25.080000000000002 26.275 120-124 25.005 24.36 25.135 25.5 125-129 24.560000000000002 24.26 24.725 26.455000000000002 130-134 24.43 24.345 25.240000000000002 25.985000000000003 135-139 24.79 24.305 24.709999999999997 26.195 140-144 24.121206060303017 24.0062003100155 25.136256812840642 26.736336816840844 145-149 24.615000000000002 24.709999999999997 24.83 25.845000000000002 150-151 23.95 24.625 26.237500000000004 25.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 3.0 28 3.0 29 4.0 30 5.0 31 7.0 32 10.5 33 16.0 34 25.5 35 33.0 36 45.0 37 61.5 38 67.5 39 86.0 40 113.5 41 133.0 42 151.0 43 169.5 44 192.0 45 192.5 46 193.5 47 196.0 48 192.5 49 190.0 50 176.0 51 161.5 52 138.5 53 119.5 54 105.0 55 93.5 56 102.5 57 101.0 58 83.5 59 78.5 60 77.5 61 85.0 62 77.0 63 68.0 64 64.0 65 61.0 66 58.5 67 46.5 68 40.0 69 34.0 70 32.0 71 25.5 72 20.0 73 15.0 74 11.0 75 11.0 76 9.0 77 5.5 78 4.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.925000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTTT 10 0.0068396386 144.9375 3 >>END_MODULE SRR6958164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43775 33.0 33.0 34.0 32.0 34.0 2 32.43675 33.0 33.0 34.0 32.0 34.0 3 32.29275 33.0 33.0 34.0 31.0 34.0 4 32.26325 33.0 33.0 34.0 31.0 34.0 5 32.18725 33.0 33.0 34.0 31.0 34.0 6 36.0485 38.0 38.0 38.0 32.0 38.0 7 36.10425 38.0 38.0 38.0 33.0 38.0 8 36.11675 38.0 38.0 38.0 33.0 38.0 9 36.08775 38.0 38.0 38.0 31.0 38.0 10-14 36.13934999999999 38.0 38.0 38.0 33.2 38.0 15-19 36.349149999999995 38.0 38.0 38.0 34.2 38.0 20-24 36.49825 38.0 38.0 38.0 34.8 38.0 25-29 36.4778 38.0 38.0 38.0 34.8 38.0 30-34 36.4262 38.0 38.0 38.0 34.4 38.0 35-39 36.23935 38.0 38.0 38.0 33.6 38.0 40-44 36.1406 38.0 38.0 38.0 33.4 38.0 45-49 35.98905 38.0 38.0 38.0 32.8 38.0 50-54 36.2175 38.0 38.0 38.0 33.6 38.0 55-59 36.2102 38.0 38.0 38.0 34.0 38.0 60-64 36.043899999999994 38.0 38.0 38.0 33.2 38.0 65-69 35.990449999999996 38.0 38.0 38.0 33.0 38.0 70-74 35.87209999999999 38.0 38.0 38.0 32.0 38.0 75-79 35.657349999999994 38.0 37.4 38.0 31.0 38.0 80-84 35.68300000000001 38.0 37.4 38.0 31.4 38.0 85-89 35.60975 38.0 37.0 38.0 31.4 38.0 90-94 35.4507 38.0 37.0 38.0 30.2 38.0 95-99 35.21955 38.0 36.4 38.0 29.0 38.0 100-104 34.93745 38.0 36.0 38.0 27.0 38.0 105-109 34.646100000000004 38.0 35.2 38.0 25.4 38.0 110-114 34.57425 38.0 35.4 38.0 24.8 38.0 115-119 34.456050000000005 38.0 35.0 38.0 24.4 38.0 120-124 34.2025 38.0 35.0 38.0 23.4 38.0 125-129 33.7553 38.0 34.2 38.0 20.6 38.0 130-134 33.428 38.0 34.0 38.0 18.6 38.0 135-139 33.06495 38.0 34.0 38.0 14.4 38.0 140-144 32.347150000000006 38.0 31.8 38.0 13.2 38.0 145-149 31.00265 37.6 30.4 38.0 8.6 38.0 150-151 25.5885 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 13.0 4 2.0 5 5.0 6 2.0 7 0.0 8 2.0 9 3.0 10 3.0 11 1.0 12 2.0 13 4.0 14 1.0 15 1.0 16 6.0 17 12.0 18 16.0 19 6.0 20 9.0 21 7.0 22 20.0 23 18.0 24 26.0 25 30.0 26 51.0 27 33.0 28 49.0 29 72.0 30 83.0 31 76.0 32 110.0 33 141.0 34 216.0 35 326.0 36 746.0 37 1890.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 18.525 12.5 29.025000000000002 2 28.481963927855713 24.949899799599198 24.724448897795593 21.8436873747495 3 24.19839679358717 26.077154308617235 26.47795591182365 23.246492985971944 4 26.65330661322645 31.538076152304612 18.587174348697395 23.22144288577154 5 27.329659318637272 31.162324649298593 20.29058116232465 21.217434869739478 6 23.379224030037545 33.41677096370463 21.32665832290363 21.877346683354194 7 23.04804804804805 20.045045045045047 33.408408408408405 23.4984984984985 8 23.94894894894895 22.922922922922922 22.922922922922922 30.205205205205203 9 24.168126094570926 22.9672254190643 27.62071553665249 25.243932949712285 10-14 25.956147376852222 25.66079295154185 22.752302763315978 25.630756908289946 15-19 26.495469790258795 25.14391550282825 23.712269109475898 24.648345597437054 20-24 25.66322955250776 25.75332866152768 23.77615376914606 24.8072880168185 25-29 26.087391761349416 25.061314380099102 23.669853346013316 25.181440512538167 30-34 25.860860860860864 24.95995995995996 24.05905905905906 25.12012012012012 35-39 26.059756768930487 25.369100645613337 23.62244131925329 24.948701266202892 40-44 25.750600480384307 25.02502001601281 23.914131305044034 25.31024819855885 45-49 25.929447085313985 25.38403802852139 23.44758568926695 25.238929196897676 50-54 25.8845903608428 24.828587157799912 24.172964316100295 25.113858165256993 55-59 26.556556556556554 25.230230230230234 23.463463463463462 24.74974974974975 60-64 26.328961858043847 25.432976273901293 23.771148263089398 24.466913604965463 65-69 26.195124393052012 25.514341492716625 23.46698703509035 24.82354707914101 70-74 25.88847732505756 25.257783561918114 24.496946641305435 24.35679247171889 75-79 25.466740077080935 25.40167175534311 24.315531307873268 24.816056859702687 80-84 26.43850695486841 25.072550785549886 23.76163314320024 24.727309116381466 85-89 25.932228840282296 25.41668752189799 23.895089844336553 24.755993793483157 90-94 25.89848833717089 25.13264591050155 23.93132445690259 25.03754129542497 95-99 26.316579895875048 25.085102122547053 24.11894273127753 24.47937525030036 100-104 26.603943549194277 24.75227704934441 24.266840156140525 24.376939245320788 105-109 26.15854268841958 25.457912120908816 24.07666900210189 24.306876188569714 110-114 26.766766766766764 25.175175175175173 23.833833833833832 24.224224224224226 115-119 27.32822899464545 25.31651904118501 23.254766551568835 24.10048541260071 120-124 26.33580148088853 25.560336201721036 24.014408645187114 24.089453672203323 125-129 27.22361180590295 25.642821410705352 23.6368184092046 23.496748374187092 130-134 27.37916541579105 25.682978084659265 23.80166116281397 23.136195336735714 135-139 27.073012060251212 25.176399939948958 24.51583846269329 23.23474953710654 140-144 27.635199359647807 25.94426934814148 22.872579918955427 23.54795137325529 145-149 27.1244119707737 25.92333099789811 23.476128515664097 23.476128515664097 150-151 27.82434630301514 25.384711622669837 24.15863880895784 22.632303265357187 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 2.5 28 3.5 29 5.5 30 7.0 31 4.5 32 6.0 33 10.0 34 14.5 35 28.0 36 35.0 37 42.0 38 58.5 39 76.5 40 103.0 41 130.0 42 154.5 43 167.0 44 170.0 45 170.5 46 168.0 47 176.5 48 191.5 49 193.5 50 174.5 51 144.5 52 141.0 53 132.5 54 111.5 55 114.5 56 109.0 57 102.0 58 97.5 59 94.5 60 94.0 61 82.0 62 74.0 63 74.5 64 70.0 65 69.0 66 63.5 67 56.5 68 49.0 69 45.0 70 41.5 71 35.5 72 31.0 73 21.0 74 19.0 75 12.5 76 5.5 77 5.0 78 2.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.2 4 0.2 5 0.2 6 0.125 7 0.1 8 0.1 9 0.075 10-14 0.12 15-19 0.11499999999999999 20-24 0.11 25-29 0.105 30-34 0.1 35-39 0.095 40-44 0.08 45-49 0.075 50-54 0.095 55-59 0.1 60-64 0.11 65-69 0.11499999999999999 70-74 0.11 75-79 0.105 80-84 0.06999999999999999 85-89 0.105 90-94 0.11 95-99 0.12 100-104 0.09 105-109 0.09 110-114 0.1 115-119 0.08499999999999999 120-124 0.06 125-129 0.05 130-134 0.06999999999999999 135-139 0.08499999999999999 140-144 0.055 145-149 0.09 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21697398332913 98.2 2 0.5809547865622632 1.15 3 0.17681232634503663 0.525 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.7125000000000004 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.512499999999999 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGAAA 10 0.006830828 145.0 1 GAAATTG 10 0.006830828 145.0 4 GTGAAAT 10 0.006830828 145.0 2 TGAAATT 10 0.006830828 145.0 3 >>END_MODULE Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027658 spots for SRR6958164.sra Written 1027658 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra Read 1027640 spots for SRR6958164.sra Written 1027640 spots for SRR6958164.sra SRR ids: ['SRR6958164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0znr5d2l SRR6958164.sra spots: 20552818 blocks: [[1, 1027640], [1027641, 2055280], [2055281, 3082920], [3082921, 4110560], [4110561, 5138200], [5138201, 6165840], [6165841, 7193480], [7193481, 8221120], [8221121, 9248760], [9248761, 10276400], [10276401, 11304040], [11304041, 12331680], [12331681, 13359320], [13359321, 14386960], [14386961, 15414600], [15414601, 16442240], [16442241, 17469880], [17469881, 18497520], [18497521, 19525160], [19525161, 20552818]] SRR6958164 file size 6942975 SRR6958164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958164 SRR6958164_1.fastq SRR6958164_2.fastq Input file: SRR6958164_1.fastq Paired file: SRR6958164_2.fastq trimmed: SRR6958164-trimmed-pair1.fastq, SRR6958164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:50:33 2024 >> started Fri Dec 6 14:51:02 2024 >> done (29.302s) 20552818 read pairs processed; of these: 49980 ( 0.24%) short read pairs filtered out after trimming by size control 49901 ( 0.24%) empty read pairs filtered out after trimming by size control 20452937 (99.51%) read pairs available; of these: 9120785 (44.59%) trimmed read pairs available after processing 11332152 (55.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 6 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 7 0.00% 27 8 0.00% 28 8 0.00% 29 10 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 9 0.00% 34 8 0.00% 35 16 0.00% 36 6 0.00% 37 12 0.00% 38 7 0.00% 39 9 0.00% 40 17 0.00% 41 25 0.00% 42 21 0.00% 43 18 0.00% 44 25 0.00% 45 19 0.00% 46 24 0.00% 47 44 0.00% 48 28 0.00% 49 46 0.00% 50 52 0.00% 51 49 0.00% 52 58 0.00% 53 81 0.00% 54 70 0.00% 55 97 0.00% 56 81 0.00% 57 108 0.00% 58 139 0.00% 59 157 0.00% 60 153 0.00% 61 171 0.00% 62 214 0.00% 63 235 0.00% 64 246 0.00% 65 273 0.00% 66 330 0.00% 67 363 0.00% 68 380 0.00% 69 457 0.00% 70 540 0.00% 71 588 0.00% 72 653 0.00% 73 764 0.00% 74 858 0.00% 75 947 0.00% 76 1042 0.01% 77 1228 0.01% 78 1395 0.01% 79 1579 0.01% 80 1642 0.01% 81 2034 0.01% 82 2348 0.01% 83 2886 0.01% 84 4824 0.02% 85 6035 0.03% 86 6077 0.03% 87 6231 0.03% 88 6422 0.03% 89 6553 0.03% 90 6894 0.03% 91 7279 0.04% 92 7649 0.04% 93 8195 0.04% 94 8785 0.04% 95 9564 0.05% 96 9925 0.05% 97 10607 0.05% 98 11094 0.05% 99 11787 0.06% 100 12525 0.06% 101 13345 0.07% 102 14259 0.07% 103 15160 0.07% 104 16279 0.08% 105 17098 0.08% 106 18185 0.09% 107 19276 0.09% 108 19981 0.10% 109 21371 0.10% 110 22140 0.11% 111 23151 0.11% 112 24890 0.12% 113 26211 0.13% 114 28135 0.14% 115 29801 0.15% 116 30953 0.15% 117 32405 0.16% 118 33555 0.16% 119 34593 0.17% 120 36229 0.18% 121 37480 0.18% 122 39439 0.19% 123 42044 0.21% 124 44032 0.22% 125 46527 0.23% 126 48208 0.24% 127 50493 0.25% 128 52468 0.26% 129 54808 0.27% 130 57454 0.28% 131 59990 0.29% 132 63096 0.31% 133 66868 0.33% 134 69912 0.34% 135 73961 0.36% 136 77606 0.38% 137 81716 0.40% 138 85846 0.42% 139 92243 0.45% 140 98372 0.48% 141 106405 0.52% 142 117870 0.58% 143 133275 0.65% 144 152210 0.74% 145 179997 0.88% 146 221617 1.08% 147 297559 1.45% 148 445647 2.18% 149 911971 4.46% 150 4671562 22.84% 151 11332152 55.41% 20452937 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=26.91 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=19 prefix-density=0.53 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=19 fanout-score=50.92 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=10.8 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCACCC SRR6958164 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:51:47 Started mapping on | Dec 06 14:51:47 Finished on | Dec 06 14:53:51 Mapping speed, Million of reads per hour | 593.79 Number of input reads | 20452937 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19662440 Uniquely mapped reads % | 96.14% Average mapped length | 294.66 Number of splices: Total | 22208741 Number of splices: Annotated (sjdb) | 20862607 Number of splices: GT/AG | 21894372 Number of splices: GC/AG | 263832 Number of splices: AT/AC | 8059 Number of splices: Non-canonical | 42478 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237654 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 8739 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581065 581065 581065 N_multimapping 237654 237654 237654 N_noFeature 598526 19086212 739732 N_ambiguous 513379 2468 79230 UnstrandedReadsAssigned:18550535 PositiveStrandReadsAssigned:573760 NegativeStrandReadsAssigned:18843478 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958164-trimmed-pair1.fastq SRR6958164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,452,937 reads, 18,846,115 reads pseudoaligned [quant] estimated average fragment length: 252.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6958164.ke.tsv 35125 SRR6958164.se.tsv 88098 total ==> SRR6958164.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.376 18.306 1.9781 PNS24247 1044 792.921 51.5983 4.81937 PNS24249 1928 1676.92 43.9987 1.94318 PNS24246 1044 792.921 51.5983 4.81937 PNS24248 1044 792.921 51.5983 4.81937 PNS24244 1471 1219.92 47.9004 2.90798 PNS24243 293 89.3134 0 0 KQK14069 1603 1351.92 4156.68 227.709 KQK14071 474 234.775 100.749 31.7813 ==> SRR6958164.se.tsv <== BRADI_1g14170v3 4708 BRADI_1g53295v3 1399 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 393 BRADI_1g74790v3 139 BRADI_1g09890v3 1 BRADI_1g77505v3 332 BRADI_1g48960v3 0 SRR6958164 completed mapping pipeline successfully