Starting /dee2/code/volunteer_pipeline.sh SRR6958165 current disk space = 1550527344640 free memory = 1603030744 SRR6958165 SRAfilesize 4bc720bf0afd7a701fd5d1b1135dbc61 SRR6958165.sra SRR6958165.sra file validated SRR6958165 is paired end SRR6958165 is conventional basespace SRR6958165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.765 18.0 18.0 32.0 18.0 33.0 2 26.1625 27.0 18.0 31.0 18.0 33.0 3 30.38075 31.0 29.0 33.0 27.0 33.0 4 31.552 33.0 31.0 33.0 29.0 33.0 5 32.6825 33.0 33.0 33.0 31.0 34.0 6 36.99 38.0 37.0 38.0 36.0 38.0 7 37.338 38.0 38.0 38.0 36.0 38.0 8 37.517 38.0 38.0 38.0 37.0 38.0 9 37.58975 38.0 38.0 38.0 37.0 38.0 10-14 37.5929 38.0 38.0 38.0 37.6 38.0 15-19 37.54925 38.0 38.0 38.0 37.8 38.0 20-24 37.612300000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.6009 38.0 38.0 38.0 38.0 38.0 30-34 37.5995 38.0 38.0 38.0 37.8 38.0 35-39 37.36415 38.0 38.0 38.0 36.8 38.0 40-44 37.61565 38.0 38.0 38.0 38.0 38.0 45-49 37.47269999999999 38.0 38.0 38.0 37.6 38.0 50-54 37.4787 38.0 38.0 38.0 37.0 38.0 55-59 37.18945 38.0 38.0 38.0 36.2 38.0 60-64 37.448699999999995 38.0 38.0 38.0 37.0 38.0 65-69 36.996300000000005 38.0 37.8 38.0 35.4 38.0 70-74 37.214 38.0 38.0 38.0 36.0 38.0 75-79 36.9151 38.0 37.8 38.0 34.8 38.0 80-84 37.2051 38.0 38.0 38.0 36.0 38.0 85-89 37.19985 38.0 38.0 38.0 36.0 38.0 90-94 37.098949999999995 38.0 38.0 38.0 36.0 38.0 95-99 37.0079 38.0 38.0 38.0 35.4 38.0 100-104 36.9168 38.0 38.0 38.0 35.2 38.0 105-109 36.713350000000005 38.0 38.0 38.0 34.8 38.0 110-114 36.56995 38.0 38.0 38.0 34.0 38.0 115-119 36.44885 38.0 38.0 38.0 34.0 38.0 120-124 36.18105 38.0 37.4 38.0 33.6 38.0 125-129 36.1426 38.0 37.2 38.0 33.4 38.0 130-134 35.891299999999994 38.0 36.4 38.0 32.2 38.0 135-139 34.6772 38.0 34.4 38.0 25.8 38.0 140-144 31.35775 35.0 26.6 38.0 20.0 38.0 145-149 34.0967 38.0 33.0 38.0 26.2 38.0 150-151 29.444250000000004 35.0 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 3.0 21 4.0 22 4.0 23 1.0 24 1.0 25 3.0 26 10.0 27 8.0 28 17.0 29 17.0 30 30.0 31 53.0 32 64.0 33 116.0 34 194.0 35 361.0 36 1161.0 37 1949.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.89764612536366 27.37371065855594 7.511240412589262 38.21740280349114 2 24.125 13.750000000000002 32.175 29.95 3 20.775 18.85 23.45 36.925000000000004 4 26.025 24.95 22.2 26.825 5 25.275 30.575000000000003 23.799999999999997 20.349999999999998 6 21.45 34.150000000000006 24.099999999999998 20.3 7 16.75 24.175 40.949999999999996 18.125 8 19.6 25.55 29.475 25.374999999999996 9 19.575 21.875 34.1 24.45 10-14 22.215 27.66 26.575 23.549999999999997 15-19 22.53 26.275 26.875 24.32 20-24 22.4261213060653 26.796339816990848 26.531326566328318 24.24621231061553 25-29 22.33 26.575 26.919999999999998 24.175 30-34 21.95 27.01 26.724999999999998 24.315 35-39 22.845 26.169999999999998 26.865 24.12 40-44 22.264999999999997 26.1 26.765 24.87 45-49 22.14 26.334999999999997 26.784999999999997 24.740000000000002 50-54 22.165000000000003 27.12 26.235000000000003 24.48 55-59 22.16 27.07 26.19 24.58 60-64 23.06 27.04 25.5 24.4 65-69 22.675 26.419999999999998 26.169999999999998 24.735 70-74 22.245 26.650000000000002 26.58 24.525 75-79 22.685 26.200000000000003 26.99 24.125 80-84 21.404999999999998 27.01 26.490000000000002 25.095 85-89 21.325 26.685 26.695 25.295 90-94 23.185 26.72 25.755 24.34 95-99 22.275 26.25 26.83 24.645 100-104 23.001150057502876 26.58632931646582 25.911295564778236 24.501225061253063 105-109 22.365 26.450000000000003 26.490000000000002 24.695 110-114 22.686134306715335 26.696334816740837 26.241312065603278 24.376218810940546 115-119 23.584433773509403 26.225490196078432 25.880352140856345 24.309723889555823 120-124 22.900000000000002 26.345000000000002 26.275 24.48 125-129 22.882161621215914 26.965223917938452 25.589191893920436 24.563422566925194 130-134 22.770000000000003 25.89 26.295 25.045 135-139 22.06 26.784999999999997 25.374999999999996 25.779999999999998 140-144 22.61 26.86 25.509999999999998 25.019999999999996 145-149 22.645 25.81 26.05 25.495 150-151 23.425 25.7375 25.687500000000004 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 4.0 28 7.0 29 10.0 30 14.5 31 22.5 32 26.5 33 35.5 34 48.5 35 52.0 36 59.0 37 77.5 38 94.5 39 120.5 40 148.0 41 182.0 42 220.5 43 232.0 44 229.0 45 223.0 46 225.5 47 221.0 48 189.0 49 173.0 50 168.0 51 140.0 52 125.5 53 102.5 54 84.0 55 92.0 56 83.5 57 70.5 58 67.5 59 63.0 60 51.0 61 41.0 62 39.0 63 41.0 64 37.0 65 33.5 66 26.5 67 19.5 68 21.0 69 17.5 70 13.5 71 10.5 72 7.5 73 6.5 74 6.0 75 5.5 76 3.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.04 120-124 0.0 125-129 0.075 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.675000000000001 0.0 0.0 0.0 0.0 126-127 5.050000000000001 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATCA 10 0.0060887975 150.61038 1 ACTGATC 10 0.006836113 144.9625 2 >>END_MODULE SRR6958165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1835 33.0 33.0 34.0 33.0 34.0 2 33.2805 34.0 33.0 34.0 33.0 34.0 3 33.36375 34.0 33.0 34.0 33.0 34.0 4 33.324 34.0 33.0 34.0 33.0 34.0 5 33.3385 34.0 33.0 34.0 33.0 34.0 6 37.461 38.0 38.0 38.0 38.0 38.0 7 37.50375 38.0 38.0 38.0 38.0 38.0 8 37.492 38.0 38.0 38.0 38.0 38.0 9 37.4645 38.0 38.0 38.0 38.0 38.0 10-14 37.3789 38.0 38.0 38.0 37.8 38.0 15-19 36.9585 38.0 38.0 38.0 35.4 38.0 20-24 37.37195 38.0 38.0 38.0 37.8 38.0 25-29 37.454449999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.48555 38.0 38.0 38.0 38.0 38.0 35-39 36.6248 38.0 37.4 38.0 32.4 38.0 40-44 37.4988 38.0 38.0 38.0 38.0 38.0 45-49 37.4054 38.0 38.0 38.0 37.8 38.0 50-54 37.4551 38.0 38.0 38.0 38.0 38.0 55-59 37.433499999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.32315 38.0 38.0 38.0 37.2 38.0 65-69 37.3129 38.0 38.0 38.0 37.0 38.0 70-74 37.24745 38.0 38.0 38.0 37.0 38.0 75-79 37.25765 38.0 38.0 38.0 37.0 38.0 80-84 36.15465 38.0 36.0 38.0 32.4 38.0 85-89 36.563100000000006 38.0 37.4 38.0 33.8 38.0 90-94 35.6591 38.0 36.2 38.0 29.6 38.0 95-99 34.58385 38.0 33.8 38.0 26.6 38.0 100-104 34.942049999999995 38.0 34.4 38.0 28.2 38.0 105-109 36.4514 38.0 37.8 38.0 34.0 38.0 110-114 36.6189 38.0 38.0 38.0 34.0 38.0 115-119 36.370650000000005 38.0 38.0 38.0 33.0 38.0 120-124 36.20075 38.0 38.0 38.0 33.0 38.0 125-129 35.53655 38.0 37.0 38.0 30.6 38.0 130-134 35.675700000000006 38.0 37.6 38.0 31.6 38.0 135-139 35.005849999999995 38.0 36.2 38.0 28.2 38.0 140-144 32.1632 36.6 30.2 38.0 19.6 38.0 145-149 29.258500000000005 35.2 26.6 38.0 5.6 38.0 150-151 21.31175 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 0.0 15 2.0 16 3.0 17 1.0 18 0.0 19 4.0 20 4.0 21 10.0 22 2.0 23 8.0 24 7.0 25 10.0 26 18.0 27 16.0 28 26.0 29 32.0 30 43.0 31 61.0 32 94.0 33 108.0 34 233.0 35 414.0 36 1182.0 37 1712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6 20.825 10.25 31.324999999999996 2 29.975 22.625 30.15 17.25 3 21.45 26.375 29.599999999999998 22.575 4 24.45 32.0 21.425 22.125 5 26.700000000000003 34.35 20.0 18.95 6 21.85 36.4 21.349999999999998 20.4 7 21.05 20.424999999999997 36.725 21.8 8 22.6 23.575 27.175 26.650000000000002 9 23.674999999999997 23.474999999999998 27.725 25.124999999999996 10-14 25.330000000000002 27.250000000000004 23.630000000000003 23.79 15-19 25.674999999999997 25.8 25.330000000000002 23.195 20-24 24.565 26.51 25.740000000000002 23.185 25-29 25.345000000000002 26.31 25.6 22.745 30-34 24.785 26.815 25.540000000000003 22.86 35-39 24.985 26.384999999999998 25.814999999999998 22.814999999999998 40-44 24.765 26.195 25.5 23.54 45-49 25.0 26.215 25.674999999999997 23.11 50-54 24.75356517388041 26.875156367275455 25.769326995246434 22.601951463597697 55-59 24.795 26.445 25.585 23.175 60-64 24.65986394557823 26.95078031212485 25.52521008403361 22.864145658263304 65-69 24.775 26.415 25.865 22.945 70-74 25.25899604624393 26.044742505380107 25.664381162104 23.031880286271956 75-79 24.77486491895137 26.320792475485288 25.79047428457074 23.113868320992594 80-84 24.92239911885451 26.234104335636328 26.118954641033344 22.724541904475817 85-89 24.9812340489416 25.69684231596857 26.34239103237752 22.979532602712304 90-94 23.94838193367679 27.019456809883458 26.294202971039866 22.73795828539989 95-99 24.8 26.889999999999997 25.814999999999998 22.495 100-104 25.45 26.334999999999997 25.6 22.615 105-109 25.018760318174998 26.664665566061334 26.009305117814797 22.307268997948874 110-114 25.005 25.935000000000002 26.21 22.85 115-119 25.471462157971086 26.44189885448452 25.671552198489323 22.415086789055074 120-124 26.068910336550484 26.353953092963945 25.288793318997847 22.288343251487724 125-129 25.899064672635426 26.769369279247734 25.363877357074976 21.967688691041865 130-134 25.624999999999996 26.255 25.825 22.295 135-139 26.27182232004402 26.65199339702866 25.98169176129258 21.094492521634738 140-144 26.334999999999997 27.095000000000002 25.330000000000002 21.240000000000002 145-149 26.685 26.955000000000002 25.264999999999997 21.095 150-151 26.991869918699184 26.29143214509068 25.35334584115072 21.363352095059412 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 4.0 27 6.5 28 8.5 29 11.0 30 10.0 31 12.5 32 18.0 33 22.5 34 31.5 35 41.0 36 49.0 37 67.0 38 91.0 39 112.5 40 145.5 41 170.5 42 186.5 43 203.5 44 218.5 45 227.5 46 223.5 47 206.0 48 194.0 49 185.0 50 163.0 51 139.0 52 127.0 53 122.0 54 103.5 55 92.0 56 94.0 57 83.5 58 73.0 59 73.5 60 70.0 61 65.5 62 53.0 63 44.0 64 39.0 65 32.0 66 36.0 67 33.5 68 20.0 69 17.0 70 21.5 71 14.0 72 9.0 73 10.0 74 5.5 75 3.0 76 2.0 77 2.5 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.075 55-59 0.0 60-64 0.04 65-69 0.0 70-74 0.095 75-79 0.06 80-84 0.13 85-89 0.08499999999999999 90-94 0.034999999999999996 95-99 0.0 100-104 0.0 105-109 0.055 110-114 0.0 115-119 0.045 120-124 0.015 125-129 0.034999999999999996 130-134 0.0 135-139 0.045 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49672873678914 98.85000000000001 2 0.377453447408153 0.75 3 0.10065425264217413 0.3 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.425 0.0 0.0 0.0 0.0 134-135 6.6625 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTT 10 0.006830828 145.0 7 >>END_MODULE Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809888 spots for SRR6958165.sra Written 809888 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra Read 809874 spots for SRR6958165.sra Written 809874 spots for SRR6958165.sra SRR ids: ['SRR6958165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bjbng80 SRR6958165.sra spots: 16197494 blocks: [[1, 809874], [809875, 1619748], [1619749, 2429622], [2429623, 3239496], [3239497, 4049370], [4049371, 4859244], [4859245, 5669118], [5669119, 6478992], [6478993, 7288866], [7288867, 8098740], [8098741, 8908614], [8908615, 9718488], [9718489, 10528362], [10528363, 11338236], [11338237, 12148110], [12148111, 12957984], [12957985, 13767858], [13767859, 14577732], [14577733, 15387606], [15387607, 16197494]] SRR6958165 file size 5467098 SRR6958165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958165 SRR6958165_1.fastq SRR6958165_2.fastq Input file: SRR6958165_1.fastq Paired file: SRR6958165_2.fastq trimmed: SRR6958165-trimmed-pair1.fastq, SRR6958165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:51:19 2024 >> started Fri Dec 6 14:51:36 2024 >> done (16.862s) 16197494 read pairs processed; of these: 8764 ( 0.05%) short read pairs filtered out after trimming by size control 10296 ( 0.06%) empty read pairs filtered out after trimming by size control 16178434 (99.88%) read pairs available; of these: 6648117 (41.09%) trimmed read pairs available after processing 9530317 (58.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 8 0.00% 21 2 0.00% 22 9 0.00% 23 5 0.00% 24 9 0.00% 25 11 0.00% 26 6 0.00% 27 8 0.00% 28 5 0.00% 29 10 0.00% 30 9 0.00% 31 12 0.00% 32 12 0.00% 33 5 0.00% 34 16 0.00% 35 13 0.00% 36 11 0.00% 37 16 0.00% 38 27 0.00% 39 22 0.00% 40 23 0.00% 41 23 0.00% 42 26 0.00% 43 23 0.00% 44 27 0.00% 45 29 0.00% 46 33 0.00% 47 40 0.00% 48 62 0.00% 49 61 0.00% 50 58 0.00% 51 66 0.00% 52 68 0.00% 53 100 0.00% 54 109 0.00% 55 100 0.00% 56 107 0.00% 57 145 0.00% 58 144 0.00% 59 162 0.00% 60 177 0.00% 61 234 0.00% 62 236 0.00% 63 300 0.00% 64 296 0.00% 65 334 0.00% 66 354 0.00% 67 447 0.00% 68 485 0.00% 69 553 0.00% 70 614 0.00% 71 721 0.00% 72 797 0.00% 73 924 0.01% 74 1023 0.01% 75 1121 0.01% 76 1347 0.01% 77 1553 0.01% 78 1691 0.01% 79 1846 0.01% 80 2120 0.01% 81 2373 0.01% 82 2713 0.02% 83 2983 0.02% 84 3927 0.02% 85 4107 0.03% 86 4342 0.03% 87 4861 0.03% 88 5221 0.03% 89 5652 0.03% 90 6117 0.04% 91 6737 0.04% 92 7276 0.04% 93 8109 0.05% 94 9006 0.06% 95 9440 0.06% 96 10031 0.06% 97 10976 0.07% 98 11717 0.07% 99 13461 0.08% 100 16791 0.10% 101 19153 0.12% 102 14725 0.09% 103 15138 0.09% 104 16365 0.10% 105 17290 0.11% 106 18550 0.11% 107 19286 0.12% 108 19967 0.12% 109 20949 0.13% 110 22100 0.14% 111 23201 0.14% 112 24420 0.15% 113 25400 0.16% 114 27168 0.17% 115 28374 0.18% 116 29248 0.18% 117 30555 0.19% 118 31100 0.19% 119 32127 0.20% 120 33158 0.20% 121 34583 0.21% 122 36038 0.22% 123 37534 0.23% 124 38912 0.24% 125 40354 0.25% 126 41643 0.26% 127 42770 0.26% 128 44360 0.27% 129 45806 0.28% 130 47122 0.29% 131 48060 0.30% 132 50594 0.31% 133 52015 0.32% 134 53928 0.33% 135 55842 0.35% 136 58190 0.36% 137 59935 0.37% 138 61821 0.38% 139 65787 0.41% 140 69018 0.43% 141 73174 0.45% 142 79221 0.49% 143 86426 0.53% 144 96570 0.60% 145 111408 0.69% 146 134007 0.83% 147 175683 1.09% 148 261293 1.62% 149 529783 3.27% 150 3483321 21.53% 151 9530317 58.91% 16178434 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=32.85 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=20 prefix-density=0.40 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=173.59 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958165 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:52:20 Started mapping on | Dec 06 14:52:20 Finished on | Dec 06 14:54:13 Mapping speed, Million of reads per hour | 515.42 Number of input reads | 16178434 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15632778 Uniquely mapped reads % | 96.63% Average mapped length | 294.21 Number of splices: Total | 17579232 Number of splices: Annotated (sjdb) | 16483789 Number of splices: GT/AG | 17325582 Number of splices: GC/AG | 208665 Number of splices: AT/AC | 6694 Number of splices: Non-canonical | 38291 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196386 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 7738 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 354718 354718 354718 N_multimapping 196386 196386 196386 N_noFeature 659474 15155701 804146 N_ambiguous 389509 2036 57626 UnstrandedReadsAssigned:14583795 PositiveStrandReadsAssigned:475041 NegativeStrandReadsAssigned:14771006 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958165-trimmed-pair1.fastq SRR6958165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,178,434 reads, 14,776,780 reads pseudoaligned [quant] estimated average fragment length: 239.003 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR6958165.ke.tsv 35125 SRR6958165.se.tsv 88098 total ==> SRR6958165.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.442 0 0 PNS24247 1044 805.997 51.6832 6.49633 PNS24249 1928 1690 24.3985 1.46261 PNS24246 1044 805.997 51.6832 6.49633 PNS24248 1044 805.997 51.6832 6.49633 PNS24244 1471 1233 57.552 4.7288 PNS24243 293 94.6565 1 1.07029 KQK14069 1603 1365 3873.73 287.508 KQK14071 474 243.662 96.128 39.9683 ==> SRR6958165.se.tsv <== BRADI_1g14170v3 4632 BRADI_1g53295v3 1062 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 329 BRADI_1g74790v3 77 BRADI_1g09890v3 1 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR6958165 completed mapping pipeline successfully