Starting /dee2/code/volunteer_pipeline.sh SRR6958166 current disk space = 1550524641280 free memory = 1507012112 SRR6958166 SRAfilesize aea521d63be86c4ffd1ab1d2b0a58535 SRR6958166.sra SRR6958166.sra file validated SRR6958166 is paired end SRR6958166 is conventional basespace SRR6958166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.12475 25.0 18.0 32.0 18.0 33.0 2 29.97225 31.0 28.0 33.0 27.0 33.0 3 30.655 33.0 29.0 33.0 27.0 33.0 4 31.35875 33.0 31.0 33.0 29.0 34.0 5 31.065 33.0 32.0 33.0 28.0 33.0 6 36.3885 38.0 37.0 38.0 34.0 38.0 7 36.60175 38.0 37.0 38.0 34.0 38.0 8 37.10175 38.0 38.0 38.0 36.0 38.0 9 37.203 38.0 38.0 38.0 36.0 38.0 10-14 37.26255 38.0 38.0 38.0 36.8 38.0 15-19 37.3097 38.0 38.0 38.0 36.6 38.0 20-24 37.2124 38.0 38.0 38.0 36.6 38.0 25-29 37.093650000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.98525 38.0 38.0 38.0 36.0 38.0 35-39 36.683800000000005 38.0 38.0 38.0 34.8 38.0 40-44 36.81775 38.0 38.0 38.0 35.0 38.0 45-49 36.653949999999995 38.0 38.0 38.0 34.2 38.0 50-54 36.37435 38.0 37.8 38.0 33.2 38.0 55-59 36.40415 38.0 38.0 38.0 33.6 38.0 60-64 36.838 38.0 38.0 38.0 35.0 38.0 65-69 36.6605 38.0 38.0 38.0 34.0 38.0 70-74 36.150400000000005 38.0 37.4 38.0 32.2 38.0 75-79 35.759100000000004 38.0 37.0 38.0 29.8 38.0 80-84 36.00605 38.0 37.0 38.0 32.0 38.0 85-89 36.1931 38.0 37.2 38.0 33.0 38.0 90-94 36.009550000000004 38.0 37.0 38.0 32.2 38.0 95-99 35.0878 38.0 35.6 38.0 28.0 38.0 100-104 34.838049999999996 38.0 35.0 38.0 26.4 38.0 105-109 34.33284999999999 38.0 34.4 38.0 23.8 38.0 110-114 34.60785 38.0 34.8 38.0 25.8 38.0 115-119 33.8316 38.0 34.0 38.0 20.6 38.0 120-124 34.077999999999996 38.0 34.2 38.0 23.4 38.0 125-129 33.79055 37.8 33.8 38.0 21.4 38.0 130-134 33.029 37.4 32.8 38.0 17.6 38.0 135-139 32.36725 36.2 32.0 38.0 14.6 38.0 140-144 30.77585 35.6 29.2 38.0 13.4 38.0 145-149 28.448500000000003 34.2 22.4 38.0 4.2 38.0 150-151 24.391624999999998 32.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 6.0 18 2.0 19 4.0 20 10.0 21 10.0 22 13.0 23 14.0 24 23.0 25 34.0 26 29.0 27 43.0 28 49.0 29 82.0 30 114.0 31 125.0 32 165.0 33 236.0 34 355.0 35 531.0 36 966.0 37 1183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.152505446623096 14.324618736383442 5.28322440087146 35.239651416122 2 21.9 12.174999999999999 31.525 34.4 3 18.95 16.425 25.1 39.525 4 25.1 23.325000000000003 23.375 28.199999999999996 5 28.449999999999996 26.3 23.799999999999997 21.45 6 24.575 29.549999999999997 23.025000000000002 22.85 7 17.825 25.7 36.975 19.5 8 22.475 23.575 27.900000000000002 26.05 9 19.85 21.325 33.675 25.15 10-14 23.085 26.145000000000003 25.540000000000003 25.230000000000004 15-19 22.564999999999998 25.34 26.290000000000003 25.805 20-24 22.845 24.585 26.619999999999997 25.95 25-29 22.715 25.285000000000004 26.355 25.645 30-34 22.884999999999998 24.915000000000003 26.064999999999998 26.135 35-39 23.294999999999998 24.665 26.125 25.915 40-44 22.915 25.480000000000004 26.075 25.53 45-49 23.080000000000002 25.36 25.900000000000002 25.66 50-54 23.59 24.834999999999997 25.735000000000003 25.840000000000003 55-59 23.45 25.165 25.990000000000002 25.395 60-64 23.345 24.64 25.545 26.47 65-69 23.27 24.68 25.61 26.44 70-74 23.365 25.275 25.52 25.840000000000003 75-79 23.585 25.080000000000002 25.155 26.179999999999996 80-84 23.185 24.755 25.874999999999996 26.185000000000002 85-89 23.48 24.73 25.569999999999997 26.22 90-94 23.294999999999998 24.575 25.835 26.295 95-99 23.735 24.355 25.895000000000003 26.015 100-104 23.415 24.755 25.455 26.375 105-109 24.18 24.605 25.405 25.81 110-114 23.65 24.73 25.395 26.224999999999998 115-119 23.255 24.985 25.724999999999998 26.035000000000004 120-124 23.799999999999997 24.625 25.840000000000003 25.735000000000003 125-129 24.22 25.064999999999998 25.19 25.525 130-134 24.385 24.83 25.540000000000003 25.245 135-139 24.235 24.915000000000003 24.935 25.915 140-144 24.115000000000002 24.77 25.945 25.169999999999998 145-149 24.08 24.68 25.580000000000002 25.66 150-151 24.0125 24.15 25.324999999999996 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 0.5 26 1.0 27 2.0 28 3.0 29 4.0 30 5.5 31 8.5 32 13.5 33 17.0 34 25.0 35 40.0 36 53.5 37 61.5 38 74.5 39 97.0 40 112.0 41 135.0 42 170.0 43 196.0 44 207.0 45 201.5 46 199.0 47 186.0 48 175.0 49 177.5 50 171.5 51 149.5 52 134.0 53 136.0 54 119.0 55 104.0 56 100.0 57 93.5 58 91.0 59 85.0 60 80.5 61 74.0 62 63.0 63 57.5 64 46.0 65 39.5 66 44.5 67 46.5 68 38.5 69 30.5 70 27.0 71 25.5 72 26.5 73 17.5 74 11.0 75 8.0 76 3.0 77 3.0 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.200000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.5793450881612091 1.15 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.6625 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.439 33.0 33.0 34.0 32.0 34.0 2 32.44525 33.0 33.0 34.0 31.0 34.0 3 32.5705 33.0 33.0 34.0 31.0 34.0 4 32.3865 33.0 33.0 34.0 31.0 34.0 5 32.3925 33.0 33.0 34.0 31.0 34.0 6 35.95725 38.0 38.0 38.0 31.0 38.0 7 36.182 38.0 38.0 38.0 33.0 38.0 8 36.215 38.0 38.0 38.0 33.0 38.0 9 36.3225 38.0 38.0 38.0 34.0 38.0 10-14 36.265049999999995 38.0 38.0 38.0 33.4 38.0 15-19 36.47355 38.0 38.0 38.0 34.2 38.0 20-24 36.657650000000004 38.0 38.0 38.0 35.0 38.0 25-29 36.6197 38.0 38.0 38.0 34.6 38.0 30-34 36.463750000000005 38.0 38.0 38.0 34.2 38.0 35-39 36.3942 38.0 38.0 38.0 34.2 38.0 40-44 36.269800000000004 38.0 38.0 38.0 33.8 38.0 45-49 36.17285 38.0 38.0 38.0 33.4 38.0 50-54 36.1593 38.0 38.0 38.0 33.4 38.0 55-59 36.14175 38.0 38.0 38.0 33.4 38.0 60-64 35.89185 38.0 37.0 38.0 32.6 38.0 65-69 35.898399999999995 38.0 37.6 38.0 32.2 38.0 70-74 35.774049999999995 38.0 37.2 38.0 31.8 38.0 75-79 35.654 38.0 37.0 38.0 30.4 38.0 80-84 35.46975 38.0 37.0 38.0 29.6 38.0 85-89 35.3342 38.0 36.4 38.0 29.4 38.0 90-94 35.21695000000001 38.0 36.4 38.0 28.8 38.0 95-99 34.87455 38.0 36.0 38.0 27.2 38.0 100-104 34.21645 38.0 34.8 38.0 23.4 38.0 105-109 34.1827 38.0 34.8 38.0 22.8 38.0 110-114 33.99835 38.0 34.4 38.0 23.0 38.0 115-119 33.45055 38.0 33.8 38.0 19.8 38.0 120-124 33.11729999999999 38.0 33.8 38.0 16.2 38.0 125-129 32.8516 37.8 33.2 38.0 16.0 38.0 130-134 32.28365 37.6 32.2 38.0 14.2 38.0 135-139 31.342149999999997 36.0 30.4 38.0 13.2 38.0 140-144 30.663549999999997 36.0 29.4 38.0 13.0 38.0 145-149 28.78125 35.0 24.8 38.0 2.0 38.0 150-151 23.11575 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 12.0 4 6.0 5 0.0 6 2.0 7 0.0 8 1.0 9 4.0 10 2.0 11 4.0 12 7.0 13 3.0 14 2.0 15 5.0 16 5.0 17 9.0 18 11.0 19 11.0 20 12.0 21 17.0 22 22.0 23 26.0 24 25.0 25 34.0 26 33.0 27 47.0 28 57.0 29 68.0 30 90.0 31 132.0 32 136.0 33 199.0 34 297.0 35 464.0 36 893.0 37 1354.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.28557139284821 20.205051262815704 11.177794448612154 26.331582895723933 2 29.049999999999997 24.175 25.7 21.075 3 23.425 26.125 27.150000000000002 23.3 4 26.400000000000002 30.975 20.375 22.25 5 26.450000000000003 33.1 19.85 20.599999999999998 6 25.0 34.625 19.8 20.575 7 23.45 20.875 33.275 22.400000000000002 8 24.099999999999998 24.349999999999998 23.575 27.975 9 24.125 23.575 26.974999999999998 25.324999999999996 10-14 26.05 26.015 23.535 24.4 15-19 25.785000000000004 25.590000000000003 24.27 24.355 20-24 26.150000000000002 25.755 23.87 24.224999999999998 25-29 26.005 25.619999999999997 23.59 24.785 30-34 26.365 25.66 23.35 24.625 35-39 25.69 25.825 23.990000000000002 24.495 40-44 25.665 25.14 24.3 24.895 45-49 26.314999999999998 25.855 23.580000000000002 24.25 50-54 26.155 25.580000000000002 24.125 24.14 55-59 26.895000000000003 24.915000000000003 24.12 24.07 60-64 26.55 25.28 24.51 23.66 65-69 25.865 25.2 24.79 24.145 70-74 26.035000000000004 25.085 24.57 24.310000000000002 75-79 26.009999999999998 25.455 24.215 24.32 80-84 26.265 25.505 24.29 23.94 85-89 25.885 25.685000000000002 24.09 24.34 90-94 26.305 24.985 24.605 24.104999999999997 95-99 25.96 24.75 25.115 24.175 100-104 26.200000000000003 25.169999999999998 24.715 23.915 105-109 25.915 25.724999999999998 24.64 23.72 110-114 26.51 25.655 24.529999999999998 23.305 115-119 26.355 25.945 24.01 23.69 120-124 26.810000000000002 25.365 24.205 23.62 125-129 26.200000000000003 25.805 24.529999999999998 23.465 130-134 26.245 25.575 24.5 23.68 135-139 26.375 25.585 24.759999999999998 23.28 140-144 26.784999999999997 26.32 24.18 22.715 145-149 26.8 26.38 23.97 22.85 150-151 26.4625 26.3 23.8875 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 4.0 30 4.5 31 7.0 32 11.0 33 15.0 34 20.0 35 27.0 36 35.5 37 44.5 38 62.0 39 90.5 40 114.5 41 126.5 42 146.0 43 172.0 44 186.5 45 195.0 46 189.5 47 192.5 48 203.5 49 185.0 50 162.5 51 144.0 52 124.5 53 123.5 54 125.5 55 112.0 56 92.5 57 87.5 58 97.5 59 98.0 60 87.0 61 79.0 62 76.5 63 83.0 64 73.5 65 62.0 66 58.5 67 50.0 68 42.0 69 37.5 70 34.0 71 27.0 72 25.5 73 20.0 74 14.0 75 8.0 76 2.5 77 3.5 78 4.5 79 2.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.6059075990911386 1.2 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.2875 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGAG 10 0.006830828 145.0 6 >>END_MODULE Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155878 spots for SRR6958166.sra Written 1155878 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra Read 1155873 spots for SRR6958166.sra Written 1155873 spots for SRR6958166.sra SRR ids: ['SRR6958166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5w2wzye SRR6958166.sra spots: 23117465 blocks: [[1, 1155873], [1155874, 2311746], [2311747, 3467619], [3467620, 4623492], [4623493, 5779365], [5779366, 6935238], [6935239, 8091111], [8091112, 9246984], [9246985, 10402857], [10402858, 11558730], [11558731, 12714603], [12714604, 13870476], [13870477, 15026349], [15026350, 16182222], [16182223, 17338095], [17338096, 18493968], [18493969, 19649841], [19649842, 20805714], [20805715, 21961587], [21961588, 23117465]] SRR6958166 file size 7812049 SRR6958166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958166 SRR6958166_1.fastq SRR6958166_2.fastq Input file: SRR6958166_1.fastq Paired file: SRR6958166_2.fastq trimmed: SRR6958166-trimmed-pair1.fastq, SRR6958166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:56:29 2024 >> started Fri Dec 6 15:01:04 2024 >> done (275.563s) 23117465 read pairs processed; of these: 49791 ( 0.22%) short read pairs filtered out after trimming by size control 59759 ( 0.26%) empty read pairs filtered out after trimming by size control 23007915 (99.53%) read pairs available; of these: 10595162 (46.05%) trimmed read pairs available after processing 12412753 (53.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 6 0.00% 26 8 0.00% 27 10 0.00% 28 12 0.00% 29 10 0.00% 30 10 0.00% 31 7 0.00% 32 10 0.00% 33 9 0.00% 34 15 0.00% 35 13 0.00% 36 16 0.00% 37 22 0.00% 38 18 0.00% 39 9 0.00% 40 26 0.00% 41 20 0.00% 42 25 0.00% 43 30 0.00% 44 27 0.00% 45 31 0.00% 46 41 0.00% 47 28 0.00% 48 50 0.00% 49 48 0.00% 50 63 0.00% 51 75 0.00% 52 91 0.00% 53 87 0.00% 54 77 0.00% 55 95 0.00% 56 102 0.00% 57 123 0.00% 58 132 0.00% 59 159 0.00% 60 162 0.00% 61 154 0.00% 62 179 0.00% 63 204 0.00% 64 227 0.00% 65 263 0.00% 66 285 0.00% 67 323 0.00% 68 332 0.00% 69 401 0.00% 70 472 0.00% 71 516 0.00% 72 554 0.00% 73 606 0.00% 74 729 0.00% 75 761 0.00% 76 876 0.00% 77 978 0.00% 78 1052 0.00% 79 1190 0.01% 80 1341 0.01% 81 1570 0.01% 82 1830 0.01% 83 2106 0.01% 84 4228 0.02% 85 5381 0.02% 86 5479 0.02% 87 5483 0.02% 88 5587 0.02% 89 5668 0.02% 90 5973 0.03% 91 6186 0.03% 92 6327 0.03% 93 6785 0.03% 94 7339 0.03% 95 7575 0.03% 96 8056 0.04% 97 8454 0.04% 98 8751 0.04% 99 9561 0.04% 100 10047 0.04% 101 10574 0.05% 102 11374 0.05% 103 11946 0.05% 104 12966 0.06% 105 13944 0.06% 106 14455 0.06% 107 15401 0.07% 108 16071 0.07% 109 17142 0.07% 110 17767 0.08% 111 19064 0.08% 112 20461 0.09% 113 21533 0.09% 114 23086 0.10% 115 24481 0.11% 116 25642 0.11% 117 27036 0.12% 118 28161 0.12% 119 29038 0.13% 120 30318 0.13% 121 31782 0.14% 122 33666 0.15% 123 35732 0.16% 124 38020 0.17% 125 40584 0.18% 126 43084 0.19% 127 44897 0.20% 128 46960 0.20% 129 49566 0.22% 130 51757 0.22% 131 54443 0.24% 132 58401 0.25% 133 62447 0.27% 134 66237 0.29% 135 71603 0.31% 136 74980 0.33% 137 80269 0.35% 138 85306 0.37% 139 92414 0.40% 140 101265 0.44% 141 111196 0.48% 142 124660 0.54% 143 142429 0.62% 144 167538 0.73% 145 204130 0.89% 146 257529 1.12% 147 354664 1.54% 148 551699 2.40% 149 1126651 4.90% 150 5865272 25.49% 151 12412753 53.95% 23007915 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=16 prefix-density=0.79 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=38.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=20 prefix-density=0.53 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=56.08 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=11.1 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958166 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:06:47 Started mapping on | Dec 06 15:06:48 Finished on | Dec 06 15:46:23 Mapping speed, Million of reads per hour | 34.88 Number of input reads | 23007915 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22049351 Uniquely mapped reads % | 95.83% Average mapped length | 295.80 Number of splices: Total | 25406234 Number of splices: Annotated (sjdb) | 23882902 Number of splices: GT/AG | 25047624 Number of splices: GC/AG | 302862 Number of splices: AT/AC | 9697 Number of splices: Non-canonical | 46051 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265562 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 10629 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721724 721724 721724 N_multimapping 265562 265562 265562 N_noFeature 688902 21404532 842006 N_ambiguous 579088 2817 88183 UnstrandedReadsAssigned:20781361 PositiveStrandReadsAssigned:642002 NegativeStrandReadsAssigned:21119162 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958166-trimmed-pair1.fastq SRR6958166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,007,915 reads, 21,110,867 reads pseudoaligned [quant] estimated average fragment length: 255.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958166.ke.tsv 35125 SRR6958166.se.tsv 88098 total ==> SRR6958166.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.539 0 0 PNS24247 1044 789.134 80.6604 6.82795 PNS24249 1928 1673.13 60.0533 2.39765 PNS24246 1044 789.134 80.6604 6.82795 PNS24248 1044 789.134 80.6604 6.82795 PNS24244 1471 1216.13 45.9655 2.52483 PNS24243 293 83.5792 0 0 KQK14069 1603 1348.13 6509.65 322.556 KQK14071 474 229.998 129.973 37.7492 ==> SRR6958166.se.tsv <== BRADI_1g14170v3 7423 BRADI_1g53295v3 1578 BRADI_1g59795v3 132 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 479 BRADI_1g74790v3 160 BRADI_1g09890v3 0 BRADI_1g77505v3 354 BRADI_1g48960v3 0 SRR6958166 completed mapping pipeline successfully