Starting /dee2/code/volunteer_pipeline.sh SRR6958168 current disk space = 1550462631936 free memory = 1601290104 SRR6958168 SRAfilesize ea279fa2e5aeef406920b0210a74414a SRR6958168.sra SRR6958168.sra file validated SRR6958168 is paired end SRR6958168 is conventional basespace SRR6958168 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958168_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.316 18.0 18.0 27.0 18.0 32.0 2 24.4805 27.0 18.0 28.0 18.0 31.0 3 23.747 25.0 18.0 29.0 18.0 31.0 4 26.4375 29.0 25.0 31.0 15.0 33.0 5 29.148 31.0 29.0 33.0 25.0 33.0 6 35.0725 37.0 34.0 38.0 29.0 38.0 7 36.94425 38.0 37.0 38.0 35.0 38.0 8 37.34375 38.0 38.0 38.0 36.0 38.0 9 37.0215 38.0 38.0 38.0 36.0 38.0 10-14 36.9265 38.0 37.6 38.0 34.8 38.0 15-19 37.56535 38.0 38.0 38.0 37.6 38.0 20-24 37.46865 38.0 38.0 38.0 37.6 38.0 25-29 37.4949 38.0 38.0 38.0 37.4 38.0 30-34 37.4889 38.0 38.0 38.0 37.6 38.0 35-39 37.50405000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.56855 38.0 38.0 38.0 38.0 38.0 45-49 37.47365 38.0 38.0 38.0 37.0 38.0 50-54 37.31525 38.0 38.0 38.0 36.8 38.0 55-59 37.053200000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.21045 38.0 38.0 38.0 36.2 38.0 65-69 37.20425 38.0 38.0 38.0 36.2 38.0 70-74 37.08255 38.0 38.0 38.0 35.8 38.0 75-79 36.877700000000004 38.0 38.0 38.0 35.4 38.0 80-84 37.03815 38.0 38.0 38.0 35.8 38.0 85-89 36.95235 38.0 38.0 38.0 35.2 38.0 90-94 36.709 38.0 38.0 38.0 34.4 38.0 95-99 36.61645 38.0 38.0 38.0 34.0 38.0 100-104 36.43855 38.0 37.6 38.0 34.0 38.0 105-109 36.27525 38.0 37.0 38.0 34.0 38.0 110-114 36.0596 38.0 36.8 38.0 32.6 38.0 115-119 35.7238 38.0 36.4 38.0 31.4 38.0 120-124 35.640449999999994 38.0 36.2 38.0 30.8 38.0 125-129 35.18035 38.0 35.6 38.0 29.4 38.0 130-134 35.00345 38.0 34.8 38.0 28.4 38.0 135-139 34.673 38.0 34.2 38.0 28.2 38.0 140-144 34.125750000000004 38.0 33.4 38.0 25.2 38.0 145-149 32.81045 38.0 33.0 38.0 15.6 38.0 150-151 26.541 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 0.0 21 2.0 22 7.0 23 6.0 24 6.0 25 12.0 26 14.0 27 19.0 28 27.0 29 33.0 30 45.0 31 51.0 32 92.0 33 160.0 34 237.0 35 470.0 36 1196.0 37 1618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.579548403841166 6.410589151310667 16.89592525304957 37.1139371917986 2 22.400000000000002 11.525 37.8 28.275 3 19.875 14.05 27.425 38.65 4 23.625 23.075000000000003 23.1 30.2 5 25.75 26.950000000000003 25.575 21.725 6 22.575 32.475 23.775 21.175 7 18.35 24.975 38.2 18.475 8 19.950000000000003 24.95 30.075000000000003 25.025 9 19.0 21.8 34.575 24.625 10-14 22.650000000000002 27.310000000000002 26.619999999999997 23.419999999999998 15-19 21.755 26.284999999999997 27.62 24.34 20-24 22.341117055852795 26.14130706535327 27.301365068253414 24.216210810540527 25-29 21.67 26.450000000000003 26.919999999999998 24.959999999999997 30-34 22.64 26.490000000000002 27.005000000000003 23.865 35-39 22.52 26.13 27.1 24.25 40-44 22.195 26.340000000000003 26.71 24.755 45-49 21.72 26.009999999999998 27.279999999999998 24.990000000000002 50-54 22.12 26.314999999999998 27.105 24.46 55-59 22.259999999999998 25.915 27.150000000000002 24.675 60-64 22.259999999999998 26.05 26.865 24.825 65-69 22.375 26.83 26.200000000000003 24.595 70-74 22.485 26.11 26.93 24.474999999999998 75-79 22.255 25.835 26.91 25.0 80-84 22.215 26.44 26.66 24.685000000000002 85-89 22.195 26.085 26.810000000000002 24.91 90-94 21.955 26.395000000000003 26.915 24.735 95-99 22.08 26.605 26.46 24.855 100-104 21.972197219721973 26.307630763076308 27.20772077207721 24.51245124512451 105-109 22.56 26.025 26.87 24.545 110-114 22.209983477694887 26.055174485555497 27.246783157262307 24.488058879487305 115-119 22.98332582244254 26.18296529968454 26.914025336738273 23.919683541134646 120-124 22.206103051525762 25.732866433216607 27.298649324662332 24.7623811905953 125-129 22.37916353618833 26.41121963436013 27.4129727022289 23.796644127222642 130-134 22.10320836878723 26.462785925221482 26.30261774863607 25.131387957355223 135-139 22.535 26.26 26.490000000000002 24.715 140-144 22.27 26.490000000000002 26.0 25.240000000000002 145-149 22.575 26.700000000000003 26.1 24.625 150-151 23.0375 25.25 26.237500000000004 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 3.0 30 6.0 31 11.5 32 15.0 33 18.5 34 27.5 35 38.0 36 55.0 37 83.0 38 106.0 39 123.5 40 150.0 41 184.0 42 219.5 43 236.5 44 241.5 45 253.5 46 253.0 47 222.0 48 200.5 49 192.5 50 169.5 51 148.5 52 139.0 53 112.5 54 95.0 55 91.0 56 78.5 57 68.0 58 54.5 59 54.0 60 53.5 61 42.0 62 30.5 63 36.0 64 40.0 65 33.0 66 25.5 67 19.0 68 20.0 69 13.5 70 9.0 71 10.5 72 6.5 73 3.0 74 1.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.135 115-119 0.145 120-124 0.05 125-129 0.17500000000000002 130-134 0.105 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.1375 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTGG 10 0.0068343505 144.975 3 TTCCAGG 10 0.0068343505 144.975 9 >>END_MODULE SRR6958168 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958168_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48375 33.0 33.0 34.0 28.0 34.0 2 31.763 33.0 33.0 34.0 27.0 34.0 3 32.6575 33.0 33.0 34.0 30.0 34.0 4 31.45975 33.0 33.0 34.0 27.0 34.0 5 32.6705 33.0 33.0 34.0 31.0 34.0 6 37.1585 38.0 38.0 38.0 36.0 38.0 7 37.43475 38.0 38.0 38.0 37.0 38.0 8 37.5085 38.0 38.0 38.0 38.0 38.0 9 37.53025 38.0 38.0 38.0 38.0 38.0 10-14 37.51265 38.0 38.0 38.0 38.0 38.0 15-19 37.40925 38.0 38.0 38.0 38.0 38.0 20-24 37.459950000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.476350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5134 38.0 38.0 38.0 38.0 38.0 35-39 37.3989 38.0 38.0 38.0 38.0 38.0 40-44 37.32705 38.0 38.0 38.0 37.4 38.0 45-49 36.80094999999999 38.0 37.8 38.0 35.0 38.0 50-54 36.23905 38.0 36.2 38.0 31.8 38.0 55-59 37.2848 38.0 38.0 38.0 37.4 38.0 60-64 37.3833 38.0 38.0 38.0 37.8 38.0 65-69 37.346399999999996 38.0 38.0 38.0 37.6 38.0 70-74 36.761449999999996 38.0 38.0 38.0 35.2 38.0 75-79 37.0571 38.0 38.0 38.0 36.4 38.0 80-84 35.569599999999994 38.0 36.4 38.0 27.6 38.0 85-89 37.075649999999996 38.0 38.0 38.0 36.2 38.0 90-94 37.07535 38.0 38.0 38.0 36.4 38.0 95-99 36.94565 38.0 38.0 38.0 36.0 38.0 100-104 36.87435000000001 38.0 38.0 38.0 35.8 38.0 105-109 36.66455 38.0 38.0 38.0 35.0 38.0 110-114 36.663 38.0 38.0 38.0 35.0 38.0 115-119 36.66590000000001 38.0 38.0 38.0 34.8 38.0 120-124 36.4148 38.0 38.0 38.0 33.6 38.0 125-129 36.16635 38.0 38.0 38.0 33.0 38.0 130-134 35.79495 38.0 37.0 38.0 31.6 38.0 135-139 35.00545 38.0 35.6 38.0 28.0 38.0 140-144 33.29305 38.0 32.8 38.0 21.0 38.0 145-149 32.714 38.0 32.6 38.0 16.8 38.0 150-151 28.027 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 3.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 4.0 16 2.0 17 2.0 18 0.0 19 2.0 20 2.0 21 4.0 22 1.0 23 6.0 24 7.0 25 6.0 26 9.0 27 12.0 28 19.0 29 17.0 30 39.0 31 45.0 32 56.0 33 93.0 34 161.0 35 285.0 36 831.0 37 2381.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.775 19.975 13.200000000000001 33.050000000000004 2 28.199999999999996 25.05 27.625 19.125 3 22.275 28.249999999999996 27.625 21.85 4 24.675 31.95 21.95 21.425 5 27.1 34.175 20.25 18.475 6 21.9 37.075 22.05 18.975 7 21.925 21.575 34.5 22.0 8 22.475 25.45 25.124999999999996 26.950000000000003 9 23.0 24.0 28.549999999999997 24.45 10-14 24.905 27.305 24.685000000000002 23.105 15-19 24.48 27.3 25.39 22.830000000000002 20-24 24.63 28.000000000000004 24.64 22.73 25-29 24.555 26.755000000000003 25.41 23.28 30-34 24.765 26.889999999999997 26.029999999999998 22.314999999999998 35-39 24.875 26.915 25.395 22.814999999999998 40-44 24.535 27.105 25.11 23.25 45-49 24.884999999999998 26.99 25.264999999999997 22.86 50-54 24.8 27.105 25.665 22.43 55-59 25.085 27.275 25.014999999999997 22.625 60-64 24.935 26.825 25.619999999999997 22.62 65-69 24.9 26.76 26.3 22.040000000000003 70-74 25.525 26.495 25.480000000000004 22.5 75-79 24.665 26.47 26.155 22.71 80-84 24.815 26.715 25.779999999999998 22.689999999999998 85-89 25.19 26.32 25.995 22.495 90-94 25.27 27.034999999999997 25.64 22.055 95-99 24.8 27.04 25.945 22.215 100-104 25.025 27.165 25.480000000000004 22.33 105-109 24.445 27.41 25.82 22.325 110-114 25.509999999999998 26.915 25.41 22.165000000000003 115-119 25.224999999999998 26.784999999999997 25.395 22.595000000000002 120-124 25.3 27.68 25.645 21.375 125-129 25.52 27.439999999999998 25.040000000000003 22.0 130-134 25.345000000000002 26.955000000000002 25.31 22.39 135-139 25.06 27.389999999999997 25.94 21.61 140-144 25.740000000000002 27.445000000000004 25.285000000000004 21.529999999999998 145-149 25.795 26.655 25.7 21.85 150-151 25.4375 27.3125 25.912499999999998 21.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.0 27 3.0 28 6.5 29 10.5 30 9.5 31 8.5 32 12.5 33 17.5 34 25.0 35 41.5 36 67.0 37 80.0 38 98.0 39 136.0 40 150.0 41 167.0 42 199.0 43 207.5 44 219.5 45 240.0 46 222.0 47 205.5 48 193.5 49 180.5 50 184.0 51 156.0 52 117.0 53 104.5 54 110.0 55 89.5 56 72.0 57 78.0 58 81.0 59 75.0 60 66.5 61 61.5 62 44.5 63 38.5 64 42.5 65 39.5 66 28.5 67 26.5 68 26.0 69 16.0 70 12.5 71 10.0 72 7.0 73 4.0 74 2.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.725 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.775 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACTT 10 0.006830828 145.0 2 AAAAAAA 40 0.0076550315 18.125 70-74 >>END_MODULE Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884252 spots for SRR6958168.sra Written 884252 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra Read 884240 spots for SRR6958168.sra Written 884240 spots for SRR6958168.sra SRR ids: ['SRR6958168.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lgdngh8j SRR6958168.sra spots: 17684812 blocks: [[1, 884240], [884241, 1768480], [1768481, 2652720], [2652721, 3536960], [3536961, 4421200], [4421201, 5305440], [5305441, 6189680], [6189681, 7073920], [7073921, 7958160], [7958161, 8842400], [8842401, 9726640], [9726641, 10610880], [10610881, 11495120], [11495121, 12379360], [12379361, 13263600], [13263601, 14147840], [14147841, 15032080], [15032081, 15916320], [15916321, 16800560], [16800561, 17684812]] SRR6958168 file size 5971102 SRR6958168 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958168 SRR6958168_1.fastq SRR6958168_2.fastq Input file: SRR6958168_1.fastq Paired file: SRR6958168_2.fastq trimmed: SRR6958168-trimmed-pair1.fastq, SRR6958168-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:55:13 2024 >> started Fri Dec 6 14:55:33 2024 >> done (19.985s) 17684812 read pairs processed; of these: 9548 ( 0.05%) short read pairs filtered out after trimming by size control 11998 ( 0.07%) empty read pairs filtered out after trimming by size control 17663266 (99.88%) read pairs available; of these: 8002673 (45.31%) trimmed read pairs available after processing 9660593 (54.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 8 0.00% 30 8 0.00% 31 7 0.00% 32 4 0.00% 33 8 0.00% 34 11 0.00% 35 12 0.00% 36 12 0.00% 37 9 0.00% 38 19 0.00% 39 12 0.00% 40 11 0.00% 41 20 0.00% 42 23 0.00% 43 22 0.00% 44 19 0.00% 45 24 0.00% 46 26 0.00% 47 31 0.00% 48 41 0.00% 49 44 0.00% 50 62 0.00% 51 70 0.00% 52 53 0.00% 53 70 0.00% 54 77 0.00% 55 89 0.00% 56 90 0.00% 57 108 0.00% 58 115 0.00% 59 146 0.00% 60 173 0.00% 61 179 0.00% 62 189 0.00% 63 236 0.00% 64 261 0.00% 65 295 0.00% 66 330 0.00% 67 340 0.00% 68 446 0.00% 69 483 0.00% 70 517 0.00% 71 613 0.00% 72 745 0.00% 73 833 0.00% 74 905 0.01% 75 1019 0.01% 76 1216 0.01% 77 1353 0.01% 78 1417 0.01% 79 1621 0.01% 80 1870 0.01% 81 1986 0.01% 82 2261 0.01% 83 2510 0.01% 84 3047 0.02% 85 3582 0.02% 86 3924 0.02% 87 4275 0.02% 88 4493 0.03% 89 4721 0.03% 90 4965 0.03% 91 5533 0.03% 92 5898 0.03% 93 6347 0.04% 94 6978 0.04% 95 7404 0.04% 96 7931 0.04% 97 8244 0.05% 98 8653 0.05% 99 9234 0.05% 100 9625 0.05% 101 10366 0.06% 102 10828 0.06% 103 11482 0.07% 104 12103 0.07% 105 12772 0.07% 106 13596 0.08% 107 14099 0.08% 108 14503 0.08% 109 15601 0.09% 110 16167 0.09% 111 16746 0.09% 112 17319 0.10% 113 18443 0.10% 114 19236 0.11% 115 20666 0.12% 116 21233 0.12% 117 22196 0.13% 118 22977 0.13% 119 23630 0.13% 120 24831 0.14% 121 26079 0.15% 122 26640 0.15% 123 28110 0.16% 124 29751 0.17% 125 30738 0.17% 126 32185 0.18% 127 33930 0.19% 128 35588 0.20% 129 37876 0.21% 130 40785 0.23% 131 41035 0.23% 132 43314 0.25% 133 46496 0.26% 134 49043 0.28% 135 51910 0.29% 136 55404 0.31% 137 59377 0.34% 138 62917 0.36% 139 68365 0.39% 140 75114 0.43% 141 82495 0.47% 142 92687 0.52% 143 103578 0.59% 144 121244 0.69% 145 148589 0.84% 146 187133 1.06% 147 255504 1.45% 148 396686 2.25% 149 814550 4.61% 150 4458809 25.24% 151 9660593 54.69% 17663266 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=34.58 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=1.7 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=416.24 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.7 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958168 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:56:29 Started mapping on | Dec 06 14:56:29 Finished on | Dec 06 14:58:10 Mapping speed, Million of reads per hour | 629.58 Number of input reads | 17663266 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17314633 Uniquely mapped reads % | 98.03% Average mapped length | 296.15 Number of splices: Total | 20470422 Number of splices: Annotated (sjdb) | 19254257 Number of splices: GT/AG | 20205228 Number of splices: GC/AG | 244690 Number of splices: AT/AC | 7716 Number of splices: Non-canonical | 12788 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111746 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 10591 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 241055 241055 241055 N_multimapping 111746 111746 111746 N_noFeature 603367 16797582 747093 N_ambiguous 435611 2129 63058 UnstrandedReadsAssigned:16275655 PositiveStrandReadsAssigned:514922 NegativeStrandReadsAssigned:16504482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958168 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958168-trimmed-pair1.fastq SRR6958168-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,663,266 reads, 16,523,551 reads pseudoaligned [quant] estimated average fragment length: 239.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958168.ke.tsv 35125 SRR6958168.se.tsv 88098 total ==> SRR6958168.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.906 0 0 PNS24247 1044 805.498 54.9739 6.39776 PNS24249 1928 1689.5 26.8402 1.48924 PNS24246 1044 805.498 54.9739 6.39776 PNS24248 1044 805.498 54.9739 6.39776 PNS24244 1471 1232.5 20.2382 1.53929 PNS24243 293 87.915 0 0 KQK14069 1603 1364.5 7220.03 496.023 KQK14071 474 241.114 113.2 44.0109 ==> SRR6958168.se.tsv <== BRADI_1g14170v3 8232 BRADI_1g53295v3 144 BRADI_1g59795v3 267 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 159 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR6958168 completed mapping pipeline successfully