Starting /dee2/code/volunteer_pipeline.sh SRR6958169 current disk space = 1550446325760 free memory = 1596848892 SRR6958169 SRAfilesize 7512eefab3900b0bdd02d602fbe65077 SRR6958169.sra SRR6958169.sra file validated SRR6958169 is paired end SRR6958169 is conventional basespace SRR6958169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.62425 31.0 18.0 33.0 18.0 33.0 2 30.16875 31.0 28.0 33.0 27.0 33.0 3 29.94175 31.0 29.0 33.0 25.0 33.0 4 29.956 31.0 29.0 33.0 25.0 33.0 5 31.68375 33.0 32.0 33.0 30.0 33.0 6 36.687 38.0 37.0 38.0 34.0 38.0 7 36.98425 38.0 38.0 38.0 35.0 38.0 8 37.00975 38.0 38.0 38.0 35.0 38.0 9 37.09825 38.0 38.0 38.0 36.0 38.0 10-14 37.275999999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.44415 38.0 38.0 38.0 37.2 38.0 20-24 37.3683 38.0 38.0 38.0 37.0 38.0 25-29 37.18320000000001 38.0 38.0 38.0 36.4 38.0 30-34 37.01925 38.0 38.0 38.0 36.0 38.0 35-39 36.8573 38.0 38.0 38.0 35.2 38.0 40-44 36.94695 38.0 38.0 38.0 35.6 38.0 45-49 36.930350000000004 38.0 38.0 38.0 35.2 38.0 50-54 36.5902 38.0 38.0 38.0 34.2 38.0 55-59 36.621300000000005 38.0 38.0 38.0 34.2 38.0 60-64 36.9045 38.0 38.0 38.0 35.2 38.0 65-69 36.8658 38.0 38.0 38.0 35.0 38.0 70-74 36.63545 38.0 38.0 38.0 34.4 38.0 75-79 36.05105 38.0 37.2 38.0 32.2 38.0 80-84 35.9148 38.0 36.8 38.0 31.6 38.0 85-89 36.17555 38.0 37.0 38.0 33.2 38.0 90-94 36.202549999999995 38.0 37.0 38.0 33.0 38.0 95-99 35.8939 38.0 36.8 38.0 32.2 38.0 100-104 35.0779 38.0 35.6 38.0 28.0 38.0 105-109 34.7031 38.0 34.8 38.0 25.8 38.0 110-114 35.113800000000005 38.0 35.0 38.0 28.6 38.0 115-119 34.68825 38.0 34.8 38.0 26.4 38.0 120-124 34.64385 38.0 34.6 38.0 27.0 38.0 125-129 34.28365 38.0 34.2 38.0 24.4 38.0 130-134 34.19015 38.0 34.2 38.0 24.2 38.0 135-139 33.3553 37.8 33.6 38.0 19.8 38.0 140-144 32.2521 36.2 32.2 38.0 14.4 38.0 145-149 30.46335 35.8 29.4 38.0 8.8 38.0 150-151 25.36625 32.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 5.0 19 4.0 20 3.0 21 9.0 22 10.0 23 9.0 24 16.0 25 15.0 26 29.0 27 33.0 28 42.0 29 57.0 30 74.0 31 117.0 32 118.0 33 219.0 34 309.0 35 549.0 36 1060.0 37 1317.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.69484083424808 10.373216245883645 6.915477497255764 35.01646542261251 2 24.6 11.225 32.675 31.5 3 23.075000000000003 15.25 24.55 37.125 4 28.4 21.099999999999998 22.275 28.225 5 28.050000000000004 24.8 23.45 23.7 6 24.5 29.25 23.724999999999998 22.525000000000002 7 20.150000000000002 23.724999999999998 35.375 20.75 8 22.7 22.975 27.825 26.5 9 21.325 22.8 31.225 24.65 10-14 23.755000000000003 25.074999999999996 25.169999999999998 26.0 15-19 23.955000000000002 23.98 25.235000000000003 26.83 20-24 24.585 24.2 25.52 25.695 25-29 24.5 23.5 25.5 26.5 30-34 24.115000000000002 24.415 24.765 26.705000000000002 35-39 23.855 24.145 25.624999999999996 26.375 40-44 24.525 24.635 24.725 26.115 45-49 24.63 24.21 25.264999999999997 25.895000000000003 50-54 24.060000000000002 24.05 25.380000000000003 26.51 55-59 24.11 24.04 24.87 26.979999999999997 60-64 24.32 24.5 24.435000000000002 26.745 65-69 24.395 24.62 24.515 26.47 70-74 24.505 24.165 24.68 26.650000000000002 75-79 24.990000000000002 23.87 24.63 26.51 80-84 24.66 24.145 24.925 26.27 85-89 24.325 23.84 24.795 27.04 90-94 24.325 24.18 25.195 26.3 95-99 24.345 23.39 25.205 27.060000000000002 100-104 25.05 23.630000000000003 25.095 26.224999999999998 105-109 24.834999999999997 23.405 25.135 26.625 110-114 24.83 23.605 25.355 26.21 115-119 24.535 24.240000000000002 24.975 26.25 120-124 24.8 24.465 24.315 26.419999999999998 125-129 25.3 24.23 24.375 26.095000000000002 130-134 24.82 24.18 24.215 26.784999999999997 135-139 24.72 24.525 24.185000000000002 26.57 140-144 25.295 24.5 23.880000000000003 26.325 145-149 24.19 24.884999999999998 24.474999999999998 26.450000000000003 150-151 24.1875 24.9875 23.3 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.5 29 3.0 30 4.5 31 5.0 32 8.5 33 12.5 34 20.5 35 26.0 36 28.5 37 39.5 38 56.0 39 78.0 40 101.5 41 130.5 42 155.5 43 163.5 44 172.5 45 176.0 46 184.5 47 197.0 48 193.0 49 183.0 50 173.5 51 161.5 52 139.0 53 118.5 54 116.5 55 106.0 56 101.5 57 102.0 58 79.0 59 69.0 60 76.0 61 79.0 62 85.0 63 85.0 64 82.0 65 87.5 66 77.0 67 55.5 68 44.5 69 39.5 70 32.5 71 32.0 72 30.5 73 25.5 74 20.0 75 12.5 76 8.5 77 7.5 78 6.0 79 2.0 80 2.0 81 2.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.449999999999999 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.5 0.0 0.0 0.0 0.0 136-137 8.275 0.0 0.0 0.0 0.0 138-139 8.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4745 33.0 33.0 34.0 32.0 34.0 2 32.569 33.0 33.0 34.0 32.0 34.0 3 32.472 33.0 33.0 34.0 31.0 34.0 4 32.321 33.0 33.0 34.0 31.0 34.0 5 32.26825 33.0 33.0 34.0 31.0 34.0 6 36.1135 38.0 38.0 38.0 33.0 38.0 7 36.23725 38.0 38.0 38.0 33.0 38.0 8 36.09525 38.0 38.0 38.0 33.0 38.0 9 36.18425 38.0 38.0 38.0 33.0 38.0 10-14 36.3176 38.0 38.0 38.0 34.0 38.0 15-19 36.5319 38.0 38.0 38.0 34.6 38.0 20-24 36.63725 38.0 38.0 38.0 35.0 38.0 25-29 36.6206 38.0 38.0 38.0 35.0 38.0 30-34 36.529700000000005 38.0 38.0 38.0 35.0 38.0 35-39 36.39645 38.0 38.0 38.0 34.2 38.0 40-44 36.23185 38.0 38.0 38.0 33.8 38.0 45-49 36.2225 38.0 38.0 38.0 33.6 38.0 50-54 36.30005 38.0 38.0 38.0 34.0 38.0 55-59 36.3163 38.0 38.0 38.0 34.0 38.0 60-64 36.17055 38.0 38.0 38.0 33.6 38.0 65-69 36.04545 38.0 38.0 38.0 33.2 38.0 70-74 35.96845 38.0 38.0 38.0 32.8 38.0 75-79 35.7939 38.0 37.2 38.0 31.8 38.0 80-84 35.77515 38.0 37.2 38.0 31.8 38.0 85-89 35.722500000000004 38.0 37.2 38.0 31.6 38.0 90-94 35.563 38.0 37.0 38.0 31.0 38.0 95-99 35.23395 38.0 36.4 38.0 29.0 38.0 100-104 34.9775 38.0 36.0 38.0 28.0 38.0 105-109 34.72135 38.0 35.2 38.0 27.0 38.0 110-114 34.68285 38.0 35.0 38.0 26.6 38.0 115-119 34.444500000000005 38.0 35.0 38.0 24.8 38.0 120-124 34.29025 38.0 35.0 38.0 24.2 38.0 125-129 33.84085 38.0 34.4 38.0 22.2 38.0 130-134 33.497400000000006 38.0 34.0 38.0 21.0 38.0 135-139 32.9199 38.0 33.6 38.0 14.4 38.0 140-144 32.21095 38.0 31.6 38.0 13.2 38.0 145-149 30.788249999999998 36.4 30.4 38.0 8.6 38.0 150-151 25.280749999999998 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 6.0 4 4.0 5 1.0 6 3.0 7 2.0 8 1.0 9 3.0 10 3.0 11 1.0 12 3.0 13 5.0 14 7.0 15 2.0 16 3.0 17 7.0 18 12.0 19 5.0 20 8.0 21 8.0 22 14.0 23 14.0 24 16.0 25 33.0 26 37.0 27 46.0 28 35.0 29 59.0 30 70.0 31 97.0 32 126.0 33 159.0 34 239.0 35 387.0 36 775.0 37 1789.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 18.55 13.125 30.75 2 29.962453066332916 22.853566958698373 24.130162703379224 23.053817271589487 3 23.52941176470588 24.60575719649562 28.21026282853567 23.654568210262827 4 26.207759699624532 30.76345431789737 20.100125156445557 22.92866082603254 5 28.46057571964956 31.038798498122656 18.773466833541928 21.727158948685858 6 24.030037546933666 34.06758448060075 19.67459324155194 22.22778473091364 7 23.623623623623622 19.594594594594593 31.106106106106107 25.675675675675674 8 24.84984984984985 23.4984984984985 21.67167167167167 29.97997997997998 9 24.574574574574577 22.02202202202202 25.875875875875877 27.52752752752753 10-14 26.17271589486859 26.082603254067582 22.5531914893617 25.19148936170213 15-19 26.256507809371243 24.899879855826992 23.463155786944334 25.380456547857428 20-24 26.815838213946037 25.02878310056565 23.196676177604246 24.958702507884066 25-29 26.424066473120433 24.69716688357193 23.075382921213336 25.803383722094303 30-34 25.974871101767032 24.79851829604045 23.982579966962007 25.244030635230512 35-39 26.218840724797275 25.422965261787965 23.315647211933126 25.04254680148163 40-44 26.88554126420099 24.2830689154697 23.14698964015815 25.684400180171163 45-49 26.666666666666668 24.82982982982983 23.21821821821822 25.285285285285287 50-54 26.90825366634967 24.90615145903198 23.56974823564743 24.615846638970922 55-59 26.91325892186796 24.480704739976975 23.514690424946195 25.09134591320887 60-64 26.480452520398458 24.122741152325176 24.26290233768834 25.133903989588024 65-69 26.43672406888266 25.48057669203044 22.967561073287946 25.11513816579896 70-74 26.69069429844321 24.633328327576713 23.246733743805375 25.429243630174703 75-79 26.819501451596757 24.93242566823506 23.315647211933126 24.93242566823506 80-84 26.850507982583455 24.993744056854013 23.542365246984637 24.6133827135779 85-89 27.49524476924617 24.772249474421866 23.050355390930022 24.68215036540194 90-94 26.308939833817195 24.802282510761838 23.7311042146361 25.157673440784862 95-99 26.43540071081744 24.368023226710715 24.072683586124043 25.123892476347798 100-104 27.037037037037038 24.924924924924923 23.48848848848849 24.54954954954955 105-109 26.61294359077031 24.836077881775864 23.920116121928025 24.630862405525804 110-114 26.512838480404426 24.8911356924771 23.474648380799838 25.121377446318633 115-119 27.108463887081435 25.691976575404173 22.83397567445818 24.36558386305621 120-124 27.541164105900606 24.788549121665582 23.807617236374558 23.862669536059254 125-129 27.093029074713503 25.16639143271781 23.289796326877845 24.450783165690837 130-134 27.24224224224224 25.480480480480484 23.363363363363362 23.913913913913916 135-139 28.193193193193196 25.63063063063063 23.21821821821822 22.95795795795796 140-144 27.790011009908916 25.843258933039735 23.28595736162546 23.080772695425882 145-149 28.008008008008005 26.196196196196198 23.05805805805806 22.73773773773774 150-151 28.832436491052434 25.2784382430234 22.82567888874984 23.06344637717432 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 2.5 30 3.0 31 7.5 32 8.0 33 5.5 34 14.5 35 22.0 36 29.5 37 45.5 38 59.0 39 85.0 40 110.0 41 124.5 42 140.0 43 145.0 44 162.5 45 174.5 46 178.5 47 183.0 48 162.0 49 155.5 50 158.0 51 145.0 52 138.0 53 130.5 54 110.5 55 103.5 56 97.5 57 95.5 58 99.5 59 99.0 60 99.5 61 85.0 62 87.0 63 85.5 64 75.0 65 74.0 66 80.0 67 71.5 68 55.5 69 54.0 70 48.5 71 44.0 72 36.5 73 29.0 74 27.0 75 22.5 76 12.5 77 5.5 78 3.0 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.125 5 0.125 6 0.125 7 0.1 8 0.1 9 0.1 10-14 0.125 15-19 0.12 20-24 0.11499999999999999 25-29 0.11 30-34 0.11499999999999999 35-39 0.11 40-44 0.095 45-49 0.1 50-54 0.105 55-59 0.105 60-64 0.11499999999999999 65-69 0.12 70-74 0.11499999999999999 75-79 0.11 80-84 0.095 85-89 0.11 90-94 0.11 95-99 0.11499999999999999 100-104 0.1 105-109 0.105 110-114 0.105 115-119 0.105 120-124 0.095 125-129 0.08499999999999999 130-134 0.1 135-139 0.1 140-144 0.09 145-149 0.1 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.7323232323232324 1.4500000000000002 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.475 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.550000000000001 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 30-34 >>END_MODULE Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1139006 spots for SRR6958169.sra Written 1139006 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra Read 1138994 spots for SRR6958169.sra Written 1138994 spots for SRR6958169.sra SRR ids: ['SRR6958169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ahblsb4 SRR6958169.sra spots: 22779892 blocks: [[1, 1138994], [1138995, 2277988], [2277989, 3416982], [3416983, 4555976], [4555977, 5694970], [5694971, 6833964], [6833965, 7972958], [7972959, 9111952], [9111953, 10250946], [10250947, 11389940], [11389941, 12528934], [12528935, 13667928], [13667929, 14806922], [14806923, 15945916], [15945917, 17084910], [17084911, 18223904], [18223905, 19362898], [19362899, 20501892], [20501893, 21640886], [21640887, 22779892]] SRR6958169 file size 7697657 SRR6958169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958169 SRR6958169_1.fastq SRR6958169_2.fastq Input file: SRR6958169_1.fastq Paired file: SRR6958169_2.fastq trimmed: SRR6958169-trimmed-pair1.fastq, SRR6958169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:56:41 2024 >> started Fri Dec 6 14:57:12 2024 >> done (31.363s) 22779892 read pairs processed; of these: 42248 ( 0.19%) short read pairs filtered out after trimming by size control 42424 ( 0.19%) empty read pairs filtered out after trimming by size control 22695220 (99.63%) read pairs available; of these: 10945287 (48.23%) trimmed read pairs available after processing 11749933 (51.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 7 0.00% 29 8 0.00% 30 9 0.00% 31 10 0.00% 32 15 0.00% 33 13 0.00% 34 11 0.00% 35 14 0.00% 36 10 0.00% 37 12 0.00% 38 15 0.00% 39 14 0.00% 40 26 0.00% 41 32 0.00% 42 28 0.00% 43 27 0.00% 44 27 0.00% 45 27 0.00% 46 38 0.00% 47 36 0.00% 48 44 0.00% 49 51 0.00% 50 63 0.00% 51 70 0.00% 52 63 0.00% 53 96 0.00% 54 106 0.00% 55 104 0.00% 56 125 0.00% 57 144 0.00% 58 175 0.00% 59 185 0.00% 60 208 0.00% 61 241 0.00% 62 248 0.00% 63 317 0.00% 64 360 0.00% 65 372 0.00% 66 420 0.00% 67 481 0.00% 68 574 0.00% 69 627 0.00% 70 690 0.00% 71 858 0.00% 72 1023 0.00% 73 1117 0.00% 74 1257 0.01% 75 1432 0.01% 76 1601 0.01% 77 1765 0.01% 78 1972 0.01% 79 2310 0.01% 80 2617 0.01% 81 3070 0.01% 82 3556 0.02% 83 4137 0.02% 84 6121 0.03% 85 7092 0.03% 86 7559 0.03% 87 8220 0.04% 88 8583 0.04% 89 9031 0.04% 90 9943 0.04% 91 10812 0.05% 92 11523 0.05% 93 12593 0.06% 94 13952 0.06% 95 15232 0.07% 96 16058 0.07% 97 17536 0.08% 98 18294 0.08% 99 19788 0.09% 100 21312 0.09% 101 23005 0.10% 102 24550 0.11% 103 27150 0.12% 104 28357 0.12% 105 30258 0.13% 106 32618 0.14% 107 34105 0.15% 108 35989 0.16% 109 37761 0.17% 110 39558 0.17% 111 41529 0.18% 112 44682 0.20% 113 46527 0.21% 114 49824 0.22% 115 52539 0.23% 116 55112 0.24% 117 56224 0.25% 118 58727 0.26% 119 60409 0.27% 120 62140 0.27% 121 64431 0.28% 122 67168 0.30% 123 70366 0.31% 124 73695 0.32% 125 77470 0.34% 126 79628 0.35% 127 82228 0.36% 128 84491 0.37% 129 86840 0.38% 130 89219 0.39% 131 92996 0.41% 132 96910 0.43% 133 101120 0.45% 134 104953 0.46% 135 108815 0.48% 136 113461 0.50% 137 116630 0.51% 138 121757 0.54% 139 128119 0.56% 140 134459 0.59% 141 143634 0.63% 142 154733 0.68% 143 169320 0.75% 144 191134 0.84% 145 219712 0.97% 146 262490 1.16% 147 342182 1.51% 148 499937 2.20% 149 999275 4.40% 150 4980496 21.95% 151 11749933 51.77% 22695220 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=13 prefix-density=0.63 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=56.79 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=87.83 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958169 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:58:00 Started mapping on | Dec 06 14:58:00 Finished on | Dec 06 14:59:58 Mapping speed, Million of reads per hour | 692.40 Number of input reads | 22695220 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21970910 Uniquely mapped reads % | 96.81% Average mapped length | 292.61 Number of splices: Total | 24135768 Number of splices: Annotated (sjdb) | 22673137 Number of splices: GT/AG | 23802253 Number of splices: GC/AG | 291410 Number of splices: AT/AC | 9916 Number of splices: Non-canonical | 32189 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223694 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 22962 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 522988 522988 522988 N_multimapping 223694 223694 223694 N_noFeature 575697 21375978 732084 N_ambiguous 522992 2747 85863 UnstrandedReadsAssigned:20872221 PositiveStrandReadsAssigned:592185 NegativeStrandReadsAssigned:21152963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958169-trimmed-pair1.fastq SRR6958169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,695,220 reads, 21,204,645 reads pseudoaligned [quant] estimated average fragment length: 237.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR6958169.ke.tsv 35125 SRR6958169.se.tsv 88098 total ==> SRR6958169.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.36 73.5476 6.97377 PNS24247 1044 807.952 52.4819 4.31365 PNS24249 1928 1691.95 102.266 4.01389 PNS24246 1044 807.952 52.4819 4.31365 PNS24248 1044 807.952 52.4819 4.31365 PNS24244 1471 1234.95 48.7403 2.62095 PNS24243 293 99.5319 0 0 KQK14069 1603 1366.95 6549.38 318.176 KQK14071 474 248.511 123.6 33.0289 ==> SRR6958169.se.tsv <== BRADI_1g14170v3 7168 BRADI_1g53295v3 230 BRADI_1g59795v3 357 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 325 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 390 BRADI_1g48960v3 0 SRR6958169 completed mapping pipeline successfully