Starting /dee2/code/volunteer_pipeline.sh SRR6958170 current disk space = 1550450786304 free memory = 1336642416 SRR6958170 SRAfilesize a59364db6b418ba12e9ec8e6636114fa SRR6958170.sra SRR6958170.sra file validated SRR6958170 is paired end SRR6958170 is conventional basespace SRR6958170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.69025 32.0 18.0 33.0 18.0 34.0 2 30.67925 31.0 29.0 33.0 27.0 34.0 3 31.769 33.0 31.0 33.0 29.0 34.0 4 32.55375 33.0 33.0 33.0 32.0 34.0 5 32.92925 33.0 33.0 34.0 32.0 34.0 6 36.965 38.0 37.0 38.0 35.0 38.0 7 37.347 38.0 38.0 38.0 36.0 38.0 8 37.34825 38.0 38.0 38.0 36.0 38.0 9 37.61575 38.0 38.0 38.0 38.0 38.0 10-14 37.0477 38.0 38.0 38.0 35.4 38.0 15-19 35.6676 37.6 35.0 38.0 31.2 38.0 20-24 35.90845 38.0 36.6 38.0 29.0 38.0 25-29 37.5145 38.0 38.0 38.0 37.6 38.0 30-34 37.58585 38.0 38.0 38.0 38.0 38.0 35-39 37.512750000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.574850000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.5992 38.0 38.0 38.0 38.0 38.0 50-54 37.5979 38.0 38.0 38.0 38.0 38.0 55-59 37.5092 38.0 38.0 38.0 37.8 38.0 60-64 37.4795 38.0 38.0 38.0 37.8 38.0 65-69 37.47535 38.0 38.0 38.0 38.0 38.0 70-74 37.453100000000006 38.0 38.0 38.0 37.6 38.0 75-79 36.68055 38.0 37.6 38.0 33.8 38.0 80-84 37.35085 38.0 38.0 38.0 37.0 38.0 85-89 37.3854 38.0 38.0 38.0 37.0 38.0 90-94 36.82809999999999 38.0 37.8 38.0 34.8 38.0 95-99 37.2167 38.0 38.0 38.0 36.4 38.0 100-104 37.188550000000006 38.0 38.0 38.0 36.6 38.0 105-109 37.071200000000005 38.0 38.0 38.0 36.0 38.0 110-114 37.0533 38.0 38.0 38.0 36.0 38.0 115-119 36.8782 38.0 38.0 38.0 35.4 38.0 120-124 36.63605 38.0 38.0 38.0 34.6 38.0 125-129 36.70905 38.0 38.0 38.0 34.6 38.0 130-134 36.6428 38.0 38.0 38.0 34.8 38.0 135-139 36.4859 38.0 38.0 38.0 34.0 38.0 140-144 36.3803 38.0 38.0 38.0 34.0 38.0 145-149 36.00945 38.0 38.0 38.0 33.0 38.0 150-151 32.355125 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 2.0 18 0.0 19 1.0 20 2.0 21 0.0 22 3.0 23 2.0 24 4.0 25 3.0 26 5.0 27 6.0 28 13.0 29 22.0 30 19.0 31 35.0 32 38.0 33 65.0 34 103.0 35 199.0 36 629.0 37 2843.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.527143581938105 11.770674784373414 6.037544393708777 40.664637239979704 2 24.45 12.075 33.35 30.125 3 22.95 16.775000000000002 23.65 36.625 4 26.700000000000003 21.85 21.825 29.625 5 26.575 28.249999999999996 23.1 22.075 6 23.53088272068017 32.38309577394349 22.380595148787197 21.705426356589147 7 17.974999999999998 22.325 39.25 20.45 8 19.8 22.475 29.875 27.85 9 19.25 21.05 34.2 25.5 10-14 23.405 25.965 25.69 24.94 15-19 23.21 24.959999999999997 26.255 25.575 20-24 23.14 25.16 26.445 25.255 25-29 23.655 24.605 25.990000000000002 25.75 30-34 23.851192559627982 24.87124356217811 25.441272063603183 25.83629181459073 35-39 23.93478695739148 25.09501900380076 25.56011202240448 25.41008201640328 40-44 23.705000000000002 24.89 26.19 25.215 45-49 23.56 24.77 25.669999999999998 26.0 50-54 23.494999999999997 24.9 25.180000000000003 26.424999999999997 55-59 24.02 25.259999999999998 25.324999999999996 25.395 60-64 23.605 24.67 25.480000000000004 26.245 65-69 24.30864629694454 24.828724308646297 25.17877681652248 25.683852577886686 70-74 24.016200810040502 25.05125256262813 25.51627581379069 25.416270813540677 75-79 24.005000000000003 24.92 25.424999999999997 25.650000000000002 80-84 24.14620731036552 24.696234811740585 25.331266563328164 25.82629131456573 85-89 23.875 24.935 25.11 26.08 90-94 24.825 24.6 24.865000000000002 25.71 95-99 23.954790958191637 24.71994398879776 24.65493098619724 26.67033406681336 100-104 23.880000000000003 24.740000000000002 25.66 25.72 105-109 23.931196559827992 24.216210810540527 25.556277813890695 26.296314815740786 110-114 24.17620881044052 24.46122306115306 25.5962798139907 25.766288314415718 115-119 24.456222811140556 25.09125456272814 24.566228311415568 25.886294314715734 120-124 24.7 24.740000000000002 24.75 25.81 125-129 23.854770954190837 24.60992198439688 25.63012602520504 25.905181036207242 130-134 24.485 25.2 24.205 26.11 135-139 24.305 24.834999999999997 24.63 26.229999999999997 140-144 24.945 24.935 24.7 25.419999999999998 145-149 24.86 24.765 24.73 25.645 150-151 24.837500000000002 24.8 24.6875 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.0 29 2.0 30 5.5 31 8.0 32 7.0 33 16.0 34 31.5 35 33.5 36 41.0 37 66.0 38 70.5 39 89.5 40 134.5 41 146.5 42 156.5 43 171.5 44 194.0 45 214.5 46 209.0 47 180.0 48 165.0 49 177.0 50 167.5 51 145.5 52 132.0 53 122.0 54 104.0 55 93.0 56 91.0 57 92.5 58 88.5 59 85.5 60 89.5 61 76.5 62 66.5 63 70.5 64 72.0 65 61.5 66 47.0 67 45.0 68 49.5 69 45.5 70 35.5 71 27.0 72 19.5 73 18.0 74 12.5 75 6.5 76 3.5 77 1.0 78 1.5 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTCT 10 0.0067427144 145.6076 3 CCTTCTT 10 0.0067427144 145.6076 4 ATAGATT 10 0.0067427144 145.6076 6 AGTTGAA 10 0.0067427144 145.6076 5 GAAGATA 10 0.0070045046 143.7875 145 CTGGCTA 10 0.0070045046 143.7875 9 TCTTTCT 10 0.0070045046 143.7875 7 TAGATTT 10 0.0070045046 143.7875 7 >>END_MODULE SRR6958170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81175 33.0 33.0 34.0 32.0 34.0 2 33.11375 33.0 33.0 34.0 32.0 34.0 3 33.20625 34.0 33.0 34.0 33.0 34.0 4 33.28375 34.0 33.0 34.0 33.0 34.0 5 31.48375 33.0 32.0 34.0 27.0 34.0 6 36.9815 38.0 38.0 38.0 36.0 38.0 7 37.2985 38.0 38.0 38.0 37.0 38.0 8 37.396 38.0 38.0 38.0 37.0 38.0 9 37.42925 38.0 38.0 38.0 38.0 38.0 10-14 37.44485 38.0 38.0 38.0 38.0 38.0 15-19 37.4972 38.0 38.0 38.0 38.0 38.0 20-24 37.47715000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.45455 38.0 38.0 38.0 38.0 38.0 30-34 37.4478 38.0 38.0 38.0 38.0 38.0 35-39 37.29025 38.0 38.0 38.0 37.6 38.0 40-44 37.0495 38.0 38.0 38.0 36.8 38.0 45-49 37.047200000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.290499999999994 38.0 38.0 38.0 37.4 38.0 55-59 37.37474999999999 38.0 38.0 38.0 38.0 38.0 60-64 37.30485 38.0 38.0 38.0 37.6 38.0 65-69 37.27739999999999 38.0 38.0 38.0 37.2 38.0 70-74 37.2568 38.0 38.0 38.0 37.4 38.0 75-79 37.2354 38.0 38.0 38.0 37.0 38.0 80-84 37.14455 38.0 38.0 38.0 36.8 38.0 85-89 37.0552 38.0 38.0 38.0 36.6 38.0 90-94 36.97965 38.0 38.0 38.0 36.2 38.0 95-99 36.715999999999994 38.0 38.0 38.0 35.2 38.0 100-104 36.839299999999994 38.0 38.0 38.0 35.8 38.0 105-109 36.834900000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.77545 38.0 38.0 38.0 35.2 38.0 115-119 36.5847 38.0 38.0 38.0 34.8 38.0 120-124 35.5854 38.0 36.6 38.0 29.2 38.0 125-129 36.12335 38.0 38.0 38.0 33.6 38.0 130-134 36.187599999999996 38.0 38.0 38.0 33.8 38.0 135-139 35.7973 38.0 38.0 38.0 32.4 38.0 140-144 35.3765 38.0 37.2 38.0 30.6 38.0 145-149 34.849849999999996 38.0 36.0 38.0 29.8 38.0 150-151 28.427125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 3.0 5 1.0 6 2.0 7 0.0 8 1.0 9 1.0 10 1.0 11 4.0 12 1.0 13 1.0 14 2.0 15 0.0 16 1.0 17 4.0 18 3.0 19 3.0 20 3.0 21 5.0 22 5.0 23 3.0 24 5.0 25 11.0 26 5.0 27 15.0 28 12.0 29 24.0 30 23.0 31 45.0 32 55.0 33 75.0 34 94.0 35 204.0 36 498.0 37 2887.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 18.7 9.975000000000001 32.525 2 29.925 23.75 27.175 19.15 3 21.075 24.75 29.125 25.05 4 25.424999999999997 30.25 20.549999999999997 23.775 5 28.749999999999996 32.15 19.650000000000002 19.45 6 22.55 36.0 20.724999999999998 20.724999999999998 7 22.25 20.424999999999997 34.525 22.8 8 22.475 22.85 25.874999999999996 28.799999999999997 9 23.625 22.45 27.950000000000003 25.974999999999998 10-14 26.25 25.330000000000002 23.125 25.295 15-19 25.365 25.56 23.830000000000002 25.245 20-24 25.53 25.615 24.18 24.675 25-29 25.61 24.88 24.37 25.14 30-34 25.21 24.79 24.765 25.235000000000003 35-39 25.52 25.355 24.195 24.93 40-44 25.509999999999998 25.69 23.895 24.905 45-49 25.75 25.505 23.93 24.815 50-54 26.650000000000002 24.795 24.25 24.305 55-59 26.340000000000003 24.77 24.36 24.529999999999998 60-64 25.855 24.779999999999998 24.635 24.73 65-69 26.009999999999998 25.674999999999997 24.005000000000003 24.310000000000002 70-74 26.290000000000003 24.65 24.23 24.83 75-79 25.935000000000002 25.014999999999997 24.09 24.959999999999997 80-84 26.174999999999997 24.89 24.295 24.64 85-89 25.86 24.815 24.779999999999998 24.545 90-94 25.645 24.709999999999997 24.675 24.97 95-99 25.935000000000002 25.040000000000003 24.44 24.585 100-104 26.424999999999997 25.165 23.935000000000002 24.474999999999998 105-109 26.135 25.69 23.73 24.445 110-114 25.94 25.785000000000004 24.34 23.935000000000002 115-119 27.034999999999997 25.605 23.43 23.93 120-124 26.68 26.125 23.835 23.36 125-129 27.025 26.045 23.27 23.66 130-134 26.979999999999997 25.35 23.64 24.03 135-139 26.985 25.6 24.08 23.335 140-144 26.865 26.009999999999998 23.68 23.445 145-149 27.339999999999996 26.14 23.26 23.26 150-151 27.6 25.687500000000004 24.1375 22.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 3.0 28 4.5 29 4.5 30 7.0 31 11.0 32 11.5 33 10.0 34 15.5 35 25.0 36 32.5 37 44.5 38 72.5 39 95.0 40 109.5 41 142.5 42 157.0 43 160.5 44 176.5 45 184.5 46 185.5 47 181.0 48 176.5 49 178.0 50 169.0 51 143.5 52 129.0 53 115.5 54 104.0 55 95.0 56 89.0 57 99.0 58 98.5 59 98.5 60 95.0 61 89.0 62 78.5 63 67.5 64 72.5 65 74.5 66 68.5 67 54.0 68 53.5 69 52.0 70 39.5 71 34.0 72 26.5 73 18.5 74 14.0 75 10.5 76 7.0 77 3.0 78 2.0 79 2.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54628921193573 96.6 2 1.224177505738332 2.4 3 0.07651109410864575 0.22499999999999998 4 0.02550369803621525 0.1 5 0.102014792144861 0.5 6 0.0 0.0 7 0.02550369803621525 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.8375 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.512499999999999 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTG 10 0.006830828 145.0 7 CTGGTGG 10 0.006830828 145.0 8 ATTCAGA 10 0.006830828 145.0 6 AAAAAAA 30 0.0014437955 24.166668 20-24 >>END_MODULE Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056857 spots for SRR6958170.sra Written 1056857 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra Read 1056856 spots for SRR6958170.sra Written 1056856 spots for SRR6958170.sra SRR ids: ['SRR6958170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jeozgt56 SRR6958170.sra spots: 21137121 blocks: [[1, 1056856], [1056857, 2113712], [2113713, 3170568], [3170569, 4227424], [4227425, 5284280], [5284281, 6341136], [6341137, 7397992], [7397993, 8454848], [8454849, 9511704], [9511705, 10568560], [10568561, 11625416], [11625417, 12682272], [12682273, 13739128], [13739129, 14795984], [14795985, 15852840], [15852841, 16909696], [16909697, 17966552], [17966553, 19023408], [19023409, 20080264], [20080265, 21137121]] SRR6958170 file size 7140976 SRR6958170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958170 SRR6958170_1.fastq SRR6958170_2.fastq Input file: SRR6958170_1.fastq Paired file: SRR6958170_2.fastq trimmed: SRR6958170-trimmed-pair1.fastq, SRR6958170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:58:07 2024 >> started Fri Dec 6 14:58:33 2024 >> done (25.975s) 21137121 read pairs processed; of these: 14338 ( 0.07%) short read pairs filtered out after trimming by size control 13313 ( 0.06%) empty read pairs filtered out after trimming by size control 21109470 (99.87%) read pairs available; of these: 7353126 (34.83%) trimmed read pairs available after processing 13756344 (65.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 4 0.00% 20 11 0.00% 21 13 0.00% 22 15 0.00% 23 17 0.00% 24 12 0.00% 25 8 0.00% 26 9 0.00% 27 11 0.00% 28 13 0.00% 29 21 0.00% 30 21 0.00% 31 23 0.00% 32 13 0.00% 33 15 0.00% 34 25 0.00% 35 24 0.00% 36 17 0.00% 37 21 0.00% 38 18 0.00% 39 28 0.00% 40 21 0.00% 41 41 0.00% 42 33 0.00% 43 34 0.00% 44 33 0.00% 45 35 0.00% 46 42 0.00% 47 58 0.00% 48 39 0.00% 49 63 0.00% 50 56 0.00% 51 73 0.00% 52 88 0.00% 53 78 0.00% 54 98 0.00% 55 106 0.00% 56 125 0.00% 57 112 0.00% 58 150 0.00% 59 160 0.00% 60 192 0.00% 61 212 0.00% 62 247 0.00% 63 291 0.00% 64 286 0.00% 65 324 0.00% 66 341 0.00% 67 436 0.00% 68 469 0.00% 69 519 0.00% 70 590 0.00% 71 718 0.00% 72 775 0.00% 73 923 0.00% 74 1001 0.00% 75 1218 0.01% 76 1293 0.01% 77 1528 0.01% 78 1574 0.01% 79 1811 0.01% 80 1901 0.01% 81 2373 0.01% 82 2623 0.01% 83 3022 0.01% 84 3879 0.02% 85 4669 0.02% 86 4983 0.02% 87 5448 0.03% 88 5735 0.03% 89 6220 0.03% 90 6592 0.03% 91 7414 0.04% 92 7789 0.04% 93 8632 0.04% 94 9130 0.04% 95 9793 0.05% 96 10578 0.05% 97 11147 0.05% 98 11888 0.06% 99 12919 0.06% 100 13821 0.07% 101 14449 0.07% 102 15620 0.07% 103 16873 0.08% 104 17875 0.08% 105 19186 0.09% 106 20109 0.10% 107 21126 0.10% 108 22410 0.11% 109 23655 0.11% 110 24568 0.12% 111 25943 0.12% 112 27107 0.13% 113 28370 0.13% 114 29824 0.14% 115 31796 0.15% 116 33307 0.16% 117 33868 0.16% 118 35391 0.17% 119 36312 0.17% 120 37578 0.18% 121 39394 0.19% 122 40800 0.19% 123 42129 0.20% 124 44517 0.21% 125 46434 0.22% 126 47407 0.22% 127 49158 0.23% 128 50277 0.24% 129 51831 0.25% 130 53736 0.25% 131 55324 0.26% 132 57834 0.27% 133 60640 0.29% 134 61627 0.29% 135 64995 0.31% 136 66717 0.32% 137 68887 0.33% 138 71751 0.34% 139 75279 0.36% 140 78397 0.37% 141 83418 0.40% 142 88896 0.42% 143 95401 0.45% 144 105297 0.50% 145 120186 0.57% 146 140904 0.67% 147 178948 0.85% 148 257965 1.22% 149 499302 2.37% 150 3973210 18.82% 151 13756344 65.17% 21109470 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=16 prefix-density=1.07 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=33.54 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=14 prefix-density=0.71 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=64.76 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.8 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958170 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:59:41 Started mapping on | Dec 06 14:59:41 Finished on | Dec 06 15:01:38 Mapping speed, Million of reads per hour | 649.52 Number of input reads | 21109470 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20670099 Uniquely mapped reads % | 97.92% Average mapped length | 295.67 Number of splices: Total | 22984356 Number of splices: Annotated (sjdb) | 21550981 Number of splices: GT/AG | 22679506 Number of splices: GC/AG | 263433 Number of splices: AT/AC | 8345 Number of splices: Non-canonical | 33072 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153827 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 11333 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296137 296137 296137 N_multimapping 153827 153827 153827 N_noFeature 736757 20062273 921771 N_ambiguous 505590 2822 83790 UnstrandedReadsAssigned:19427752 PositiveStrandReadsAssigned:605004 NegativeStrandReadsAssigned:19664538 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958170-trimmed-pair1.fastq SRR6958170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,109,470 reads, 19,652,017 reads pseudoaligned [quant] estimated average fragment length: 259.123 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6958170.ke.tsv 35125 SRR6958170.se.tsv 88098 total ==> SRR6958170.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.354 0 0 PNS24247 1044 785.877 69.306 6.66162 PNS24249 1928 1669.88 32.3523 1.46347 PNS24246 1044 785.877 69.306 6.66162 PNS24248 1044 785.877 69.306 6.66162 PNS24244 1471 1212.88 19.7297 1.22876 PNS24243 293 93.0246 0 0 KQK14069 1603 1344.88 7806.31 438.457 KQK14071 474 235.024 119.111 38.2829 ==> SRR6958170.se.tsv <== BRADI_1g14170v3 8951 BRADI_1g53295v3 224 BRADI_1g59795v3 397 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 197 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 SRR6958170 completed mapping pipeline successfully