Starting /dee2/code/volunteer_pipeline.sh SRR6958171 current disk space = 1516059889664 free memory = 1596826604 SRR6958171 SRAfilesize b8ec6f52d6b34609d4b50d27cb63c5f2 SRR6958171.sra SRR6958171.sra file validated SRR6958171 is paired end SRR6958171 is conventional basespace SRR6958171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.76575 18.0 18.0 33.0 18.0 33.0 2 28.0645 28.0 27.0 33.0 18.0 33.0 3 30.60525 31.0 29.0 33.0 27.0 34.0 4 32.43825 33.0 33.0 33.0 31.0 34.0 5 32.91375 33.0 33.0 33.0 32.0 34.0 6 35.995 37.0 36.0 38.0 33.0 38.0 7 37.23775 38.0 37.0 38.0 36.0 38.0 8 36.3975 38.0 37.0 38.0 34.0 38.0 9 37.336 38.0 38.0 38.0 36.0 38.0 10-14 37.5745 38.0 38.0 38.0 37.4 38.0 15-19 37.56235 38.0 38.0 38.0 37.8 38.0 20-24 37.4802 38.0 38.0 38.0 37.4 38.0 25-29 37.593900000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.673249999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.582100000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.581849999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.5575 38.0 38.0 38.0 37.8 38.0 50-54 37.2572 38.0 38.0 38.0 36.4 38.0 55-59 37.040800000000004 38.0 38.0 38.0 35.6 38.0 60-64 37.069500000000005 38.0 38.0 38.0 35.8 38.0 65-69 37.17255 38.0 38.0 38.0 35.8 38.0 70-74 37.1897 38.0 38.0 38.0 36.0 38.0 75-79 37.14635 38.0 38.0 38.0 36.0 38.0 80-84 37.002500000000005 38.0 38.0 38.0 35.8 38.0 85-89 37.005700000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.95545 38.0 38.0 38.0 35.4 38.0 95-99 36.766000000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.58615 38.0 38.0 38.0 34.2 38.0 105-109 36.461650000000006 38.0 37.8 38.0 34.0 38.0 110-114 36.3271 38.0 37.4 38.0 33.8 38.0 115-119 36.15905 38.0 37.0 38.0 33.4 38.0 120-124 36.01435 38.0 37.0 38.0 32.8 38.0 125-129 35.76610000000001 38.0 36.0 38.0 31.4 38.0 130-134 35.701150000000005 38.0 36.0 38.0 31.4 38.0 135-139 35.250299999999996 38.0 35.4 38.0 30.6 38.0 140-144 34.8 38.0 34.6 38.0 28.0 38.0 145-149 34.0555 38.0 33.2 38.0 25.6 38.0 150-151 29.987625 35.5 27.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 5.0 20 2.0 21 0.0 22 4.0 23 7.0 24 3.0 25 5.0 26 7.0 27 10.0 28 16.0 29 25.0 30 22.0 31 52.0 32 70.0 33 116.0 34 164.0 35 342.0 36 972.0 37 2176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.9543823680164 25.884161968221424 5.2280881599179905 29.93336750384418 2 23.28664332166083 12.08104052026013 34.967483741870936 29.664832416208103 3 21.099999999999998 18.575 26.474999999999998 33.85 4 27.175 23.200000000000003 23.075000000000003 26.55 5 26.0 31.15 21.825 21.025 6 22.275 33.800000000000004 23.45 20.474999999999998 7 17.4 24.6 39.900000000000006 18.099999999999998 8 18.6 24.525 30.65 26.224999999999998 9 20.075000000000003 23.075000000000003 33.300000000000004 23.549999999999997 10-14 22.505 28.01 26.965 22.52 15-19 22.505 27.05 27.005000000000003 23.44 20-24 22.689999999999998 27.02 26.82 23.47 25-29 22.1 27.639999999999997 26.51 23.75 30-34 22.015 27.55 26.715 23.72 35-39 22.155 27.445000000000004 27.339999999999996 23.06 40-44 22.27 27.779999999999998 26.540000000000003 23.41 45-49 22.36 27.77 26.229999999999997 23.64 50-54 22.650000000000002 27.105 26.185000000000002 24.060000000000002 55-59 22.585 27.115000000000002 26.77 23.53 60-64 22.55951190238048 27.000400080016 26.325265053010604 24.114822964592918 65-69 22.785 26.865 25.945 24.404999999999998 70-74 22.305 26.575 26.810000000000002 24.310000000000002 75-79 21.875 27.405 26.645000000000003 24.075 80-84 22.37 26.805 27.005000000000003 23.82 85-89 22.025 27.21 26.935 23.830000000000002 90-94 22.465 27.115000000000002 26.66 23.76 95-99 22.555 26.400000000000002 26.455000000000002 24.59 100-104 23.03 27.145000000000003 25.974999999999998 23.849999999999998 105-109 22.66 27.025 26.705000000000002 23.61 110-114 22.78 27.279999999999998 25.995 23.945 115-119 23.84 27.305 26.205000000000002 22.650000000000002 120-124 23.305 26.650000000000002 25.885 24.16 125-129 22.795 27.315 25.805 24.085 130-134 22.53 27.005000000000003 26.174999999999997 24.29 135-139 22.675 27.125 25.779999999999998 24.42 140-144 22.14 27.115000000000002 25.995 24.75 145-149 23.29 26.56 25.85 24.3 150-151 22.9875 26.174999999999997 25.7125 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 4.0 27 5.5 28 4.0 29 6.5 30 11.0 31 14.0 32 23.5 33 39.0 34 48.0 35 54.0 36 70.5 37 92.5 38 114.0 39 135.5 40 161.5 41 195.5 42 217.5 43 229.5 44 247.5 45 253.0 46 240.5 47 218.0 48 196.5 49 173.0 50 153.5 51 130.5 52 113.5 53 105.5 54 92.0 55 80.0 56 68.0 57 58.0 58 55.5 59 51.0 60 40.0 61 35.5 62 30.5 63 31.0 64 30.0 65 24.0 66 24.0 67 25.0 68 19.5 69 18.5 70 17.5 71 9.5 72 6.0 73 5.0 74 4.5 75 4.5 76 3.0 77 2.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.02 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0125 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.037500000000000006 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.15 0.0 0.0 0.0 0.025 82-83 0.175 0.0 0.0 0.0 0.025 84-85 0.2 0.0 0.0 0.0 0.025 86-87 0.2375 0.0 0.0 0.0 0.025 88-89 0.275 0.0 0.0 0.0 0.025 90-91 0.275 0.0 0.0 0.0 0.025 92-93 0.30000000000000004 0.0 0.0 0.0 0.025 94-95 0.4375 0.0 0.0 0.0 0.025 96-97 0.575 0.0 0.0 0.0 0.025 98-99 0.7625 0.0 0.0 0.0 0.025 100-101 0.8374999999999999 0.0 0.0 0.0 0.025 102-103 1.0125000000000002 0.0 0.0 0.0 0.025 104-105 1.225 0.0 0.0 0.0 0.025 106-107 1.35 0.0 0.0 0.0 0.025 108-109 1.7000000000000002 0.0 0.0 0.0 0.025 110-111 2.05 0.0 0.0 0.0 0.025 112-113 2.4625000000000004 0.0 0.0 0.0 0.025 114-115 2.85 0.0 0.0 0.0 0.025 116-117 3.3125 0.0 0.0 0.0 0.025 118-119 3.85 0.0 0.0 0.0 0.025 120-121 4.237500000000001 0.0 0.0 0.0 0.025 122-123 4.699999999999999 0.0 0.0 0.0 0.025 124-125 5.225 0.0 0.0 0.0 0.025 126-127 5.925 0.0 0.0 0.0 0.025 128-129 6.550000000000001 0.0 0.0 0.0 0.025 130-131 7.1375 0.0 0.0 0.0 0.025 132-133 7.5125 0.0 0.0 0.0 0.025 134-135 8.175 0.0 0.0 0.0 0.025 136-137 9.0 0.0 0.0 0.0 0.025 138-139 9.675 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 55 0.0025175211 15.816817 140-144 AGATCGG 55 0.0025175211 15.816817 135-139 >>END_MODULE SRR6958171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16525 33.0 33.0 34.0 33.0 34.0 2 33.2695 34.0 33.0 34.0 33.0 34.0 3 33.34925 34.0 33.0 34.0 33.0 34.0 4 33.27725 34.0 33.0 34.0 33.0 34.0 5 33.36925 34.0 33.0 34.0 33.0 34.0 6 37.52025 38.0 38.0 38.0 38.0 38.0 7 37.53575 38.0 38.0 38.0 38.0 38.0 8 37.5105 38.0 38.0 38.0 38.0 38.0 9 37.5315 38.0 38.0 38.0 38.0 38.0 10-14 37.5178 38.0 38.0 38.0 38.0 38.0 15-19 37.54324999999999 38.0 38.0 38.0 38.0 38.0 20-24 36.9054 38.0 38.0 38.0 34.8 38.0 25-29 37.558800000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.56815 38.0 38.0 38.0 38.0 38.0 35-39 36.803000000000004 38.0 37.8 38.0 34.4 38.0 40-44 37.51765 38.0 38.0 38.0 37.8 38.0 45-49 37.5355 38.0 38.0 38.0 38.0 38.0 50-54 37.50525 38.0 38.0 38.0 38.0 38.0 55-59 36.655950000000004 38.0 37.4 38.0 32.0 38.0 60-64 37.43429999999999 38.0 38.0 38.0 37.8 38.0 65-69 37.448699999999995 38.0 38.0 38.0 37.8 38.0 70-74 37.41675 38.0 38.0 38.0 37.2 38.0 75-79 37.340149999999994 38.0 38.0 38.0 37.2 38.0 80-84 37.320499999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.2957 38.0 38.0 38.0 36.8 38.0 90-94 37.178250000000006 38.0 38.0 38.0 37.0 38.0 95-99 37.08815 38.0 38.0 38.0 36.2 38.0 100-104 36.8153 38.0 38.0 38.0 35.4 38.0 105-109 35.9387 38.0 36.6 38.0 31.0 38.0 110-114 36.015950000000004 38.0 37.2 38.0 32.4 38.0 115-119 36.751850000000005 38.0 38.0 38.0 34.8 38.0 120-124 35.0433 38.0 35.6 38.0 26.4 38.0 125-129 35.9434 38.0 37.0 38.0 32.0 38.0 130-134 35.004450000000006 38.0 35.0 38.0 27.4 38.0 135-139 32.649 36.8 30.0 38.0 21.4 38.0 140-144 34.82615 38.0 34.8 38.0 29.6 38.0 145-149 34.5035 38.0 36.0 38.0 27.6 38.0 150-151 28.620375 34.5 18.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 3.0 18 1.0 19 7.0 20 1.0 21 1.0 22 3.0 23 7.0 24 5.0 25 4.0 26 9.0 27 17.0 28 16.0 29 16.0 30 29.0 31 32.0 32 61.0 33 74.0 34 150.0 35 320.0 36 949.0 37 2288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.275 22.725 8.075000000000001 23.925 2 28.9 24.525 28.4 18.175 3 22.625 25.25 31.05 21.075 4 25.424999999999997 32.800000000000004 21.6 20.175 5 26.075 34.775 20.474999999999998 18.675 6 22.1 37.95 20.599999999999998 19.35 7 21.025 21.349999999999998 35.75 21.875 8 23.1 24.775 25.424999999999997 26.700000000000003 9 23.775 22.35 28.549999999999997 25.324999999999996 10-14 24.93 27.744999999999997 24.84 22.485 15-19 25.255 26.705000000000002 25.7 22.34 20-24 24.57 26.895000000000003 25.94 22.595000000000002 25-29 24.305 26.915 26.119999999999997 22.66 30-34 23.765 27.134999999999998 26.490000000000002 22.61 35-39 24.9 26.86 25.805 22.435 40-44 24.39 26.375 26.155 23.080000000000002 45-49 24.695 26.634999999999998 26.215 22.455 50-54 24.065 26.69 26.41 22.835 55-59 24.87 26.424999999999997 25.835 22.869999999999997 60-64 24.41 26.615 25.75 23.225 65-69 23.71 26.939999999999998 26.474999999999998 22.875 70-74 24.395 25.7 26.640000000000004 23.265 75-79 24.759999999999998 26.085 26.35 22.805 80-84 24.27 26.8 26.36 22.57 85-89 23.985 27.075 26.505000000000003 22.435 90-94 24.38 26.115 26.58 22.925 95-99 24.12 26.645000000000003 26.740000000000002 22.495 100-104 24.555 26.515 26.655 22.275 105-109 24.29 27.284999999999997 26.075 22.35 110-114 24.404999999999998 27.279999999999998 26.075 22.24 115-119 24.765 26.840000000000003 26.44 21.955 120-124 25.235000000000003 26.784999999999997 26.1 21.88 125-129 25.31 27.224999999999998 25.624999999999996 21.84 130-134 25.41 26.619999999999997 26.615 21.355 135-139 25.155 27.32 25.755 21.77 140-144 25.655 27.47 25.705 21.17 145-149 26.43 27.26 25.979999999999997 20.330000000000002 150-151 26.737499999999997 27.650000000000002 25.75 19.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 3.0 27 5.5 28 6.0 29 5.5 30 7.5 31 19.0 32 30.0 33 34.5 34 42.0 35 44.5 36 51.0 37 67.5 38 93.5 39 123.0 40 149.0 41 185.5 42 210.5 43 211.5 44 216.0 45 224.0 46 241.0 47 226.0 48 203.5 49 194.0 50 166.5 51 144.0 52 122.0 53 107.5 54 90.5 55 80.5 56 78.0 57 74.0 58 64.5 59 56.5 60 50.0 61 44.5 62 49.0 63 44.5 64 37.5 65 35.0 66 30.5 67 26.5 68 24.5 69 15.0 70 11.5 71 13.0 72 8.0 73 8.0 74 7.0 75 3.5 76 2.5 77 2.0 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34393136512742 98.425 2 0.45420136260408783 0.8999999999999999 3 0.1514004542013626 0.44999999999999996 4 0.025233409033560434 0.1 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 6.699999999999999 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 55 0.0025160722 15.818182 140-144 AGATCGG 60 0.004491891 14.500001 135-139 >>END_MODULE Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665266 spots for SRR6958171.sra Written 665266 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra Read 665255 spots for SRR6958171.sra Written 665255 spots for SRR6958171.sra SRR ids: ['SRR6958171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hqpocyoi SRR6958171.sra spots: 13305111 blocks: [[1, 665255], [665256, 1330510], [1330511, 1995765], [1995766, 2661020], [2661021, 3326275], [3326276, 3991530], [3991531, 4656785], [4656786, 5322040], [5322041, 5987295], [5987296, 6652550], [6652551, 7317805], [7317806, 7983060], [7983061, 8648315], [8648316, 9313570], [9313571, 9978825], [9978826, 10644080], [10644081, 11309335], [11309336, 11974590], [11974591, 12639845], [12639846, 13305111]] SRR6958171 file size 4486965 SRR6958171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958171 SRR6958171_1.fastq SRR6958171_2.fastq Input file: SRR6958171_1.fastq Paired file: SRR6958171_2.fastq trimmed: SRR6958171-trimmed-pair1.fastq, SRR6958171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:12:27 2024 >> started Thu Dec 12 02:12:43 2024 >> done (15.962s) 13305111 read pairs processed; of these: 6859 ( 0.05%) short read pairs filtered out after trimming by size control 8664 ( 0.07%) empty read pairs filtered out after trimming by size control 13289588 (99.88%) read pairs available; of these: 7674548 (57.75%) trimmed read pairs available after processing 5615040 (42.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 10 0.00% 21 6 0.00% 22 13 0.00% 23 16 0.00% 24 18 0.00% 25 21 0.00% 26 21 0.00% 27 18 0.00% 28 17 0.00% 29 14 0.00% 30 20 0.00% 31 20 0.00% 32 10 0.00% 33 17 0.00% 34 25 0.00% 35 23 0.00% 36 20 0.00% 37 27 0.00% 38 24 0.00% 39 19 0.00% 40 29 0.00% 41 38 0.00% 42 31 0.00% 43 37 0.00% 44 38 0.00% 45 32 0.00% 46 41 0.00% 47 48 0.00% 48 52 0.00% 49 49 0.00% 50 76 0.00% 51 84 0.00% 52 73 0.00% 53 104 0.00% 54 87 0.00% 55 112 0.00% 56 114 0.00% 57 131 0.00% 58 150 0.00% 59 161 0.00% 60 204 0.00% 61 218 0.00% 62 245 0.00% 63 285 0.00% 64 257 0.00% 65 299 0.00% 66 382 0.00% 67 383 0.00% 68 434 0.00% 69 507 0.00% 70 576 0.00% 71 637 0.00% 72 804 0.01% 73 840 0.01% 74 925 0.01% 75 1124 0.01% 76 1449 0.01% 77 1591 0.01% 78 1549 0.01% 79 1768 0.01% 80 1851 0.01% 81 2145 0.02% 82 2389 0.02% 83 2717 0.02% 84 3207 0.02% 85 3689 0.03% 86 3978 0.03% 87 4427 0.03% 88 4804 0.04% 89 5055 0.04% 90 5482 0.04% 91 5999 0.05% 92 6654 0.05% 93 7038 0.05% 94 7884 0.06% 95 8484 0.06% 96 9024 0.07% 97 9754 0.07% 98 10242 0.08% 99 11099 0.08% 100 12351 0.09% 101 14018 0.11% 102 13993 0.11% 103 14577 0.11% 104 15653 0.12% 105 16441 0.12% 106 17554 0.13% 107 18595 0.14% 108 19431 0.15% 109 20445 0.15% 110 21187 0.16% 111 22584 0.17% 112 23566 0.18% 113 24803 0.19% 114 26438 0.20% 115 28157 0.21% 116 29138 0.22% 117 30538 0.23% 118 31242 0.24% 119 32132 0.24% 120 33645 0.25% 121 35066 0.26% 122 36647 0.28% 123 38593 0.29% 124 40970 0.31% 125 42562 0.32% 126 44534 0.34% 127 46051 0.35% 128 48312 0.36% 129 50448 0.38% 130 52839 0.40% 131 54736 0.41% 132 58050 0.44% 133 60460 0.45% 134 64269 0.48% 135 67853 0.51% 136 71206 0.54% 137 75440 0.57% 138 79944 0.60% 139 86963 0.65% 140 91588 0.69% 141 100463 0.76% 142 111640 0.84% 143 125894 0.95% 144 143060 1.08% 145 172369 1.30% 146 211935 1.59% 147 282398 2.12% 148 419909 3.16% 149 823269 6.19% 150 3538327 26.62% 151 5615040 42.25% 13289588 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=46.17 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=15 prefix-density=0.38 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=130.34 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.7 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR6958171 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:13:43 Started mapping on | Dec 12 02:13:44 Finished on | Dec 12 02:15:24 Mapping speed, Million of reads per hour | 478.43 Number of input reads | 13289588 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12894845 Uniquely mapped reads % | 97.03% Average mapped length | 292.09 Number of splices: Total | 13893057 Number of splices: Annotated (sjdb) | 13041619 Number of splices: GT/AG | 13696195 Number of splices: GC/AG | 160666 Number of splices: AT/AC | 5541 Number of splices: Non-canonical | 30655 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161353 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 6042 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237784 237784 237784 N_multimapping 161353 161353 161353 N_noFeature 575724 12494593 706600 N_ambiguous 312221 1748 43090 UnstrandedReadsAssigned:12006900 PositiveStrandReadsAssigned:398504 NegativeStrandReadsAssigned:12145155 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958171-trimmed-pair1.fastq SRR6958171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,289,588 reads, 12,144,359 reads pseudoaligned [quant] estimated average fragment length: 219.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR6958171.ke.tsv 35125 SRR6958171.se.tsv 88098 total ==> SRR6958171.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.947 0 0 PNS24247 1044 825.63 42.1049 6.46675 PNS24249 1928 1709.63 29.7391 2.20579 PNS24246 1044 825.63 42.1049 6.46675 PNS24248 1044 825.63 42.1049 6.46675 PNS24244 1471 1252.63 18.9463 1.91797 PNS24243 293 100.366 1 1.26344 KQK14069 1603 1384.63 2280.46 208.847 KQK14071 474 259.657 37.654 18.3887 ==> SRR6958171.se.tsv <== BRADI_1g14170v3 2562 BRADI_1g53295v3 617 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 251 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 218 BRADI_1g48960v3 0 SRR6958171 completed mapping pipeline successfully