Starting /dee2/code/volunteer_pipeline.sh SRR6958172 current disk space = 1550459039744 free memory = 1604289024 SRR6958172 SRAfilesize db8e1051f04021d4e263b041dc7aa892 SRR6958172.sra SRR6958172.sra file validated SRR6958172 is paired end SRR6958172 is conventional basespace SRR6958172 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.58875 32.0 25.0 33.0 18.0 33.0 2 29.13125 31.0 27.0 33.0 18.0 33.0 3 30.19375 31.0 29.0 33.0 27.0 33.0 4 30.31725 31.0 29.0 33.0 27.0 33.0 5 31.572 33.0 32.0 33.0 28.0 33.0 6 35.973 38.0 36.0 38.0 33.0 38.0 7 36.98825 38.0 37.0 38.0 35.0 38.0 8 37.28625 38.0 38.0 38.0 36.0 38.0 9 37.30025 38.0 38.0 38.0 36.0 38.0 10-14 37.325450000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.43985 38.0 38.0 38.0 37.2 38.0 20-24 37.34685 38.0 38.0 38.0 37.0 38.0 25-29 37.125449999999994 38.0 38.0 38.0 36.2 38.0 30-34 37.02835 38.0 38.0 38.0 35.8 38.0 35-39 36.78335 38.0 38.0 38.0 35.2 38.0 40-44 36.894400000000005 38.0 38.0 38.0 35.2 38.0 45-49 36.86795 38.0 38.0 38.0 35.2 38.0 50-54 36.513850000000005 38.0 38.0 38.0 33.8 38.0 55-59 36.60825 38.0 38.0 38.0 34.6 38.0 60-64 36.8416 38.0 38.0 38.0 35.0 38.0 65-69 36.75825 38.0 38.0 38.0 34.6 38.0 70-74 36.50345 38.0 38.0 38.0 34.0 38.0 75-79 35.9573 38.0 37.0 38.0 31.4 38.0 80-84 35.761649999999996 38.0 37.0 38.0 30.8 38.0 85-89 36.05475 38.0 37.0 38.0 32.2 38.0 90-94 36.15005 38.0 37.0 38.0 33.0 38.0 95-99 35.885149999999996 38.0 36.8 38.0 31.8 38.0 100-104 35.006949999999996 38.0 35.4 38.0 27.6 38.0 105-109 34.710750000000004 38.0 34.6 38.0 25.8 38.0 110-114 34.865899999999996 38.0 34.8 38.0 26.8 38.0 115-119 34.65675 38.0 34.8 38.0 26.2 38.0 120-124 34.4738 38.0 34.6 38.0 25.4 38.0 125-129 34.1688 38.0 34.0 38.0 23.8 38.0 130-134 33.967949999999995 38.0 34.0 38.0 22.6 38.0 135-139 33.16985 37.8 33.4 38.0 18.6 38.0 140-144 32.27295 36.6 32.4 38.0 14.4 38.0 145-149 30.55265 36.0 29.6 38.0 9.0 38.0 150-151 25.434624999999997 32.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 3.0 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 2.0 20 3.0 21 3.0 22 11.0 23 8.0 24 12.0 25 19.0 26 40.0 27 35.0 28 44.0 29 80.0 30 75.0 31 112.0 32 136.0 33 204.0 34 305.0 35 483.0 36 1096.0 37 1318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35166031573217 8.573761567773545 10.39738704409363 38.67719107240065 2 24.15 11.5 34.375 29.975 3 20.75 16.475 25.4 37.375 4 25.75 22.325 22.475 29.45 5 25.25 27.1 24.125 23.525 6 24.525 30.275000000000002 23.125 22.075 7 18.6 23.525 38.975 18.9 8 20.599999999999998 23.425 29.5 26.474999999999998 9 20.275000000000002 21.15 33.825 24.75 10-14 22.48 26.615 25.874999999999996 25.03 15-19 22.3 25.540000000000003 26.05 26.11 20-24 22.43 25.405 26.825 25.34 25-29 22.86 25.324999999999996 26.045 25.77 30-34 22.825 25.135 26.634999999999998 25.405 35-39 23.1 25.905 25.955000000000002 25.040000000000003 40-44 23.13 25.345000000000002 25.900000000000002 25.624999999999996 45-49 22.765 25.53 25.900000000000002 25.805 50-54 22.7 25.22 26.66 25.419999999999998 55-59 22.919999999999998 25.505 25.36 26.215 60-64 23.095 25.235000000000003 26.27 25.4 65-69 22.655 25.424999999999997 25.935000000000002 25.985000000000003 70-74 23.369999999999997 24.765 25.905 25.96 75-79 23.22 25.180000000000003 25.88 25.72 80-84 22.884999999999998 24.905 25.935000000000002 26.275 85-89 23.09 25.4 25.419999999999998 26.090000000000003 90-94 23.785 25.314999999999998 25.615 25.285000000000004 95-99 23.28 25.115 25.69 25.915 100-104 23.7 24.48 25.919999999999998 25.900000000000002 105-109 23.59 24.490000000000002 26.08 25.840000000000003 110-114 23.57 24.785 25.755 25.89 115-119 24.060000000000002 24.815 25.490000000000002 25.635 120-124 23.79 25.145 25.564999999999998 25.5 125-129 23.615 24.94 25.66 25.785000000000004 130-134 23.645 25.295 25.25 25.81 135-139 23.775 24.505 25.55 26.169999999999998 140-144 23.76 24.54 25.990000000000002 25.71 145-149 24.02 24.47 25.674999999999997 25.835 150-151 23.8125 25.124999999999996 25.424999999999997 25.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.5 29 2.0 30 3.5 31 5.0 32 8.0 33 18.0 34 27.0 35 37.0 36 47.0 37 53.5 38 83.0 39 106.5 40 122.0 41 160.5 42 189.0 43 194.5 44 193.5 45 200.5 46 215.0 47 214.5 48 199.0 49 193.5 50 189.5 51 159.5 52 133.0 53 121.5 54 120.0 55 107.0 56 91.0 57 84.0 58 76.5 59 80.5 60 71.0 61 55.0 62 49.0 63 53.0 64 55.5 65 51.5 66 42.5 67 37.5 68 36.5 69 28.0 70 21.5 71 17.0 72 13.5 73 12.5 74 6.5 75 4.5 76 3.5 77 0.5 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAT 10 0.0068396386 144.9375 4 GTCGCTG 10 0.0068396386 144.9375 2 >>END_MODULE SRR6958172 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958172_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.599 33.0 33.0 34.0 32.0 34.0 2 32.64975 33.0 33.0 34.0 32.0 34.0 3 32.51975 33.0 33.0 34.0 31.0 34.0 4 32.447 33.0 33.0 34.0 31.0 34.0 5 32.45625 33.0 33.0 34.0 31.0 34.0 6 36.2745 38.0 38.0 38.0 34.0 38.0 7 36.4655 38.0 38.0 38.0 34.0 38.0 8 36.359 38.0 38.0 38.0 34.0 38.0 9 36.34325 38.0 38.0 38.0 33.0 38.0 10-14 36.43874999999999 38.0 38.0 38.0 34.0 38.0 15-19 36.633300000000006 38.0 38.0 38.0 34.6 38.0 20-24 36.74395 38.0 38.0 38.0 35.4 38.0 25-29 36.716449999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.710750000000004 38.0 38.0 38.0 35.4 38.0 35-39 36.55315 38.0 38.0 38.0 34.6 38.0 40-44 36.36335 38.0 38.0 38.0 33.8 38.0 45-49 36.321999999999996 38.0 38.0 38.0 33.6 38.0 50-54 36.534000000000006 38.0 38.0 38.0 34.2 38.0 55-59 36.581900000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.416349999999994 38.0 38.0 38.0 34.0 38.0 65-69 36.31715 38.0 38.0 38.0 33.8 38.0 70-74 36.1996 38.0 38.0 38.0 33.4 38.0 75-79 36.055600000000005 38.0 37.8 38.0 32.6 38.0 80-84 35.99895 38.0 37.8 38.0 32.8 38.0 85-89 35.94285 38.0 37.4 38.0 32.8 38.0 90-94 35.8387 38.0 37.2 38.0 32.2 38.0 95-99 35.54925 38.0 37.0 38.0 30.4 38.0 100-104 35.25715 38.0 36.4 38.0 29.0 38.0 105-109 35.030899999999995 38.0 36.0 38.0 27.8 38.0 110-114 35.07345 38.0 36.0 38.0 28.4 38.0 115-119 34.935550000000006 38.0 35.8 38.0 27.6 38.0 120-124 34.749750000000006 38.0 35.0 38.0 27.4 38.0 125-129 34.27290000000001 38.0 35.0 38.0 24.4 38.0 130-134 33.805699999999995 38.0 34.2 38.0 21.8 38.0 135-139 33.4108 38.0 34.0 38.0 19.8 38.0 140-144 32.6571 38.0 32.4 38.0 13.8 38.0 145-149 31.48385 37.6 30.4 38.0 10.8 38.0 150-151 26.240250000000003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 5.0 5 1.0 6 3.0 7 0.0 8 1.0 9 0.0 10 4.0 11 2.0 12 2.0 13 1.0 14 5.0 15 7.0 16 2.0 17 7.0 18 9.0 19 5.0 20 8.0 21 9.0 22 18.0 23 22.0 24 21.0 25 31.0 26 27.0 27 25.0 28 47.0 29 65.0 30 61.0 31 84.0 32 104.0 33 149.0 34 214.0 35 348.0 36 797.0 37 1906.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 19.125 12.125 31.374999999999996 2 29.146860145108832 22.71703777833375 26.56992744558419 21.56617463097323 3 23.3983983983984 25.425425425425423 27.952952952952952 23.223223223223226 4 26.676676676676674 30.905905905905907 20.52052052052052 21.896896896896898 5 25.975975975975974 33.28328328328328 20.37037037037037 20.37037037037037 6 24.3 34.9 20.25 20.549999999999997 7 22.2 18.575 36.05 23.175 8 23.799999999999997 23.075000000000003 23.75 29.375 9 23.45 22.25 27.825 26.474999999999998 10-14 26.18630931546577 26.091304565228263 23.581179058952948 24.141207060353018 15-19 25.05375806370956 25.693854078111716 24.69870480572086 24.55368305245787 20-24 26.221311065553277 25.546277313865694 23.981199059953 24.251212560628034 25-29 26.226311315565777 26.146307315365767 23.581179058952948 24.046202310115504 30-34 25.36 25.85 24.435000000000002 24.355 35-39 25.840000000000003 24.965 24.855 24.34 40-44 25.965 25.074999999999996 24.855 24.104999999999997 45-49 25.7 25.2 24.63 24.47 50-54 26.31 25.674999999999997 24.295 23.72 55-59 25.6 26.21 24.240000000000002 23.95 60-64 25.74128706435322 25.37626881344067 24.57122856142807 24.311215560778038 65-69 25.701285064253216 25.92629631481574 24.331216560828043 24.041202060103007 70-74 25.70757075707571 25.457545754575456 24.847484748474848 23.98739873987399 75-79 26.02 25.855 24.55 23.575 80-84 26.1 25.314999999999998 24.7 23.885 85-89 26.56 25.319999999999997 24.36 23.76 90-94 25.496274813740687 25.426271313565678 24.65123256162808 24.426221311065554 95-99 25.938890833625045 25.92888933340001 24.753713056958542 23.3785067760164 100-104 26.56 25.055 24.5 23.885 105-109 25.865 25.695 24.69 23.75 110-114 26.135 26.340000000000003 23.895 23.630000000000003 115-119 26.616330816540827 25.501275063753187 24.401220061003052 23.481174058702937 120-124 25.915 26.87 23.974999999999998 23.24 125-129 25.56 25.759999999999998 24.88 23.799999999999997 130-134 26.305 25.745 24.779999999999998 23.169999999999998 135-139 26.0 25.82 24.7 23.48 140-144 26.314999999999998 26.075 24.715 22.895 145-149 26.119999999999997 26.005 24.73 23.145 150-151 27.0 25.324999999999996 24.887500000000003 22.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 0.5 28 0.5 29 1.5 30 3.0 31 6.5 32 11.0 33 15.0 34 20.0 35 27.5 36 38.5 37 52.0 38 72.5 39 91.5 40 115.0 41 144.5 42 163.5 43 187.5 44 203.5 45 195.0 46 183.0 47 178.5 48 193.0 49 196.5 50 173.5 51 153.5 52 138.0 53 121.0 54 107.0 55 101.5 56 95.5 57 87.5 58 96.0 59 98.5 60 76.0 61 66.0 62 69.5 63 64.0 64 60.5 65 65.0 66 60.5 67 49.5 68 50.0 69 46.5 70 37.0 71 28.0 72 17.5 73 12.5 74 8.0 75 4.5 76 3.5 77 3.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.015 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1077602 spots for SRR6958172.sra Written 1077602 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra Read 1077599 spots for SRR6958172.sra Written 1077599 spots for SRR6958172.sra SRR ids: ['SRR6958172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oycg920r SRR6958172.sra spots: 21551983 blocks: [[1, 1077599], [1077600, 2155198], [2155199, 3232797], [3232798, 4310396], [4310397, 5387995], [5387996, 6465594], [6465595, 7543193], [7543194, 8620792], [8620793, 9698391], [9698392, 10775990], [10775991, 11853589], [11853590, 12931188], [12931189, 14008787], [14008788, 15086386], [15086387, 16163985], [16163986, 17241584], [17241585, 18319183], [18319184, 19396782], [19396783, 20474381], [20474382, 21551983]] SRR6958172 file size 7281559 SRR6958172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958172 SRR6958172_1.fastq SRR6958172_2.fastq Input file: SRR6958172_1.fastq Paired file: SRR6958172_2.fastq trimmed: SRR6958172-trimmed-pair1.fastq, SRR6958172-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:59:47 2024 >> started Fri Dec 6 15:00:12 2024 >> done (25.104s) 21551983 read pairs processed; of these: 28945 ( 0.13%) short read pairs filtered out after trimming by size control 29258 ( 0.14%) empty read pairs filtered out after trimming by size control 21493780 (99.73%) read pairs available; of these: 8877510 (41.30%) trimmed read pairs available after processing 12616270 (58.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 7 0.00% 23 1 0.00% 24 4 0.00% 25 0 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 10 0.00% 30 5 0.00% 31 9 0.00% 32 3 0.00% 33 6 0.00% 34 9 0.00% 35 7 0.00% 36 13 0.00% 37 11 0.00% 38 14 0.00% 39 14 0.00% 40 10 0.00% 41 18 0.00% 42 14 0.00% 43 17 0.00% 44 13 0.00% 45 14 0.00% 46 27 0.00% 47 23 0.00% 48 32 0.00% 49 45 0.00% 50 30 0.00% 51 34 0.00% 52 55 0.00% 53 57 0.00% 54 62 0.00% 55 58 0.00% 56 61 0.00% 57 96 0.00% 58 85 0.00% 59 101 0.00% 60 94 0.00% 61 111 0.00% 62 105 0.00% 63 144 0.00% 64 144 0.00% 65 170 0.00% 66 205 0.00% 67 198 0.00% 68 186 0.00% 69 253 0.00% 70 305 0.00% 71 351 0.00% 72 373 0.00% 73 369 0.00% 74 464 0.00% 75 490 0.00% 76 551 0.00% 77 588 0.00% 78 645 0.00% 79 722 0.00% 80 835 0.00% 81 1033 0.00% 82 1112 0.01% 83 1375 0.01% 84 2535 0.01% 85 3384 0.02% 86 3276 0.02% 87 3380 0.02% 88 3437 0.02% 89 3573 0.02% 90 3665 0.02% 91 3936 0.02% 92 4096 0.02% 93 4368 0.02% 94 4664 0.02% 95 5012 0.02% 96 5237 0.02% 97 5562 0.03% 98 5826 0.03% 99 6224 0.03% 100 6643 0.03% 101 7127 0.03% 102 7649 0.04% 103 8159 0.04% 104 8782 0.04% 105 9333 0.04% 106 10325 0.05% 107 10348 0.05% 108 11039 0.05% 109 11824 0.06% 110 12320 0.06% 111 13310 0.06% 112 14436 0.07% 113 14975 0.07% 114 16300 0.08% 115 17427 0.08% 116 18080 0.08% 117 19239 0.09% 118 20190 0.09% 119 20954 0.10% 120 22124 0.10% 121 23696 0.11% 122 24680 0.11% 123 26445 0.12% 124 28044 0.13% 125 30039 0.14% 126 31696 0.15% 127 33509 0.16% 128 35089 0.16% 129 37708 0.18% 130 39435 0.18% 131 42114 0.20% 132 44995 0.21% 133 48512 0.23% 134 51600 0.24% 135 54921 0.26% 136 59786 0.28% 137 63281 0.29% 138 68629 0.32% 139 74427 0.35% 140 81452 0.38% 141 90054 0.42% 142 102066 0.47% 143 118007 0.55% 144 138164 0.64% 145 168082 0.78% 146 214250 1.00% 147 296108 1.38% 148 461422 2.15% 149 971016 4.52% 150 5057721 23.53% 151 12616270 58.70% 21493780 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=17 prefix-density=0.49 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=45.12 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=6.9 sequence=AACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCACCTCATCGTCGTACACCCGGGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=3.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=157.35 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=21.8 sequence=CAAGAAGAAGGT SRR6958172 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:00:55 Started mapping on | Dec 06 15:00:55 Finished on | Dec 06 15:02:42 Mapping speed, Million of reads per hour | 723.16 Number of input reads | 21493780 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20873499 Uniquely mapped reads % | 97.11% Average mapped length | 297.35 Number of splices: Total | 24975774 Number of splices: Annotated (sjdb) | 23596804 Number of splices: GT/AG | 24646969 Number of splices: GC/AG | 296240 Number of splices: AT/AC | 13245 Number of splices: Non-canonical | 19320 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173766 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 11848 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.63% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464581 464581 464581 N_multimapping 173766 173766 173766 N_noFeature 680646 20370357 814574 N_ambiguous 440191 2767 72005 UnstrandedReadsAssigned:19752662 PositiveStrandReadsAssigned:500375 NegativeStrandReadsAssigned:19986920 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958172 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958172-trimmed-pair1.fastq SRR6958172-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,493,780 reads, 20,059,682 reads pseudoaligned [quant] estimated average fragment length: 271.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR6958172.ke.tsv 35125 SRR6958172.se.tsv 88098 total ==> SRR6958172.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.536 0 0 PNS24247 1044 773.928 63.1351 6.03523 PNS24249 1928 1657.93 63.0954 2.8155 PNS24246 1044 773.928 63.1351 6.03523 PNS24248 1044 773.928 63.1351 6.03523 PNS24244 1471 1200.93 43.4994 2.67972 PNS24243 293 78.3373 1 0.944398 KQK14069 1603 1332.93 874.706 48.5489 KQK14071 474 218.156 4.70279 1.59482 ==> SRR6958172.se.tsv <== BRADI_1g14170v3 930 BRADI_1g53295v3 428 BRADI_1g59795v3 274 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 528 BRADI_1g74790v3 292 BRADI_1g09890v3 0 BRADI_1g77505v3 346 BRADI_1g48960v3 0 SRR6958172 completed mapping pipeline successfully