Starting /dee2/code/volunteer_pipeline.sh SRR6958173 current disk space = 1550466932736 free memory = 1599253496 SRR6958173 SRAfilesize c45e615e811f6d01f3e144a9fdb17d74 SRR6958173.sra SRR6958173.sra file validated SRR6958173 is paired end SRR6958173 is conventional basespace SRR6958173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.39825 33.0 25.0 33.0 18.0 34.0 2 31.05 33.0 30.0 33.0 27.0 34.0 3 31.7365 33.0 31.0 33.0 29.0 34.0 4 32.12225 33.0 33.0 33.0 30.0 34.0 5 32.89 33.0 33.0 34.0 31.0 34.0 6 36.657 38.0 37.0 38.0 34.0 38.0 7 37.26625 38.0 38.0 38.0 36.0 38.0 8 37.34925 38.0 38.0 38.0 36.0 38.0 9 37.5 38.0 38.0 38.0 37.0 38.0 10-14 37.487 38.0 38.0 38.0 37.4 38.0 15-19 37.4259 38.0 38.0 38.0 37.0 38.0 20-24 37.48285 38.0 38.0 38.0 37.2 38.0 25-29 37.49604999999999 38.0 38.0 38.0 37.4 38.0 30-34 37.50635 38.0 38.0 38.0 37.6 38.0 35-39 37.2378 38.0 38.0 38.0 36.6 38.0 40-44 37.507400000000004 38.0 38.0 38.0 37.4 38.0 45-49 37.347899999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.309000000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.010450000000006 38.0 38.0 38.0 35.6 38.0 60-64 37.28314999999999 38.0 38.0 38.0 36.8 38.0 65-69 36.84595 38.0 37.8 38.0 34.6 38.0 70-74 37.001 38.0 37.8 38.0 35.4 38.0 75-79 36.6163 38.0 37.6 38.0 34.0 38.0 80-84 37.03075 38.0 38.0 38.0 36.0 38.0 85-89 37.03015 38.0 38.0 38.0 36.0 38.0 90-94 36.92295 38.0 38.0 38.0 35.4 38.0 95-99 36.77335 38.0 38.0 38.0 34.8 38.0 100-104 36.62495 38.0 38.0 38.0 34.4 38.0 105-109 36.463750000000005 38.0 37.8 38.0 34.0 38.0 110-114 36.376000000000005 38.0 37.4 38.0 34.0 38.0 115-119 36.165749999999996 38.0 37.0 38.0 33.2 38.0 120-124 35.9022 38.0 36.8 38.0 32.4 38.0 125-129 35.89104999999999 38.0 36.6 38.0 32.6 38.0 130-134 35.60505 38.0 36.0 38.0 31.6 38.0 135-139 34.25855 38.0 34.0 38.0 24.8 38.0 140-144 30.63365 34.4 24.8 38.0 19.2 38.0 145-149 33.52645 38.0 33.0 38.0 23.2 38.0 150-151 28.764125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 0.0 19 2.0 20 1.0 21 3.0 22 0.0 23 3.0 24 6.0 25 5.0 26 13.0 27 15.0 28 24.0 29 34.0 30 37.0 31 43.0 32 86.0 33 113.0 34 217.0 35 395.0 36 1073.0 37 1922.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.52744943525085 10.979774100341476 4.964539007092199 27.528237457315473 2 25.974999999999998 11.15 32.95 29.925 3 21.15 18.275 24.3 36.275 4 26.875 26.0 21.85 25.275 5 25.4 28.799999999999997 23.825 21.975 6 23.35 32.125 23.525 21.0 7 17.150000000000002 26.05 39.074999999999996 17.724999999999998 8 18.975 25.8 29.325000000000003 25.900000000000002 9 18.925 23.075000000000003 33.1 24.9 10-14 22.425 27.11 26.790000000000003 23.674999999999997 15-19 22.830000000000002 26.25 26.75 24.169999999999998 20-24 22.95114755737787 26.88634431721586 26.64133206660333 23.52117605880294 25-29 22.555 26.889999999999997 26.715 23.84 30-34 22.875 26.924999999999997 26.855 23.345 35-39 22.93 26.125 26.674999999999997 24.27 40-44 23.195 26.55 26.63 23.625 45-49 22.78 26.27 26.515 24.435000000000002 50-54 23.235 26.565 25.785000000000004 24.415 55-59 22.475 25.990000000000002 26.755000000000003 24.779999999999998 60-64 22.775000000000002 26.145000000000003 26.935 24.145 65-69 22.6 26.095000000000002 26.590000000000003 24.715 70-74 22.715 26.305 26.185000000000002 24.795 75-79 23.075000000000003 25.900000000000002 26.224999999999998 24.8 80-84 23.015 26.150000000000002 26.39 24.445 85-89 22.605 26.015 26.69 24.69 90-94 23.01 26.545 25.929999999999996 24.515 95-99 23.24 25.629999999999995 26.215 24.915000000000003 100-104 23.35116755837792 25.911295564778236 26.516325816290813 24.221211060553028 105-109 23.62 25.790000000000003 26.705000000000002 23.885 110-114 22.98614930746537 26.286314315715785 26.491324566228315 24.23621181059053 115-119 23.414365746298518 26.845738295318128 25.735294117647058 24.004601840736296 120-124 23.13 26.900000000000002 25.91 24.060000000000002 125-129 22.730911638146704 25.522866006204342 27.02892024417092 24.717302111478034 130-134 23.085 26.284999999999997 26.275 24.355 135-139 22.905 26.355 25.424999999999997 25.314999999999998 140-144 22.965 26.479999999999997 25.47 25.085 145-149 23.195 25.729999999999997 25.82 25.255 150-151 23.974999999999998 26.275 24.6625 25.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 3.0 28 5.5 29 6.5 30 11.0 31 14.5 32 18.0 33 30.0 34 37.5 35 50.0 36 75.0 37 84.0 38 89.0 39 119.0 40 162.5 41 195.0 42 198.5 43 206.5 44 219.0 45 222.5 46 227.5 47 207.0 48 184.5 49 182.5 50 160.5 51 142.0 52 123.5 53 103.0 54 97.5 55 84.5 56 79.0 57 75.5 58 70.5 59 61.0 60 55.0 61 53.0 62 41.0 63 40.0 64 44.5 65 34.0 66 28.5 67 30.0 68 24.5 69 21.0 70 19.0 71 15.5 72 11.5 73 9.0 74 9.5 75 7.0 76 3.5 77 1.0 78 1.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.04 120-124 0.0 125-129 0.06999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.2125000000000004 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.612500000000001 0.0 0.0 0.0 0.0 136-137 6.050000000000001 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTGC 10 0.0060887975 150.61038 1 TTCAATA 10 0.006836113 144.9625 7 CTGGTGG 10 0.006836113 144.9625 7 TCATGTT 10 0.006836113 144.9625 5 GGTCGTC 10 0.006836113 144.9625 9 CTGCTGG 20 3.5913987E-4 108.72187 4 TGCTGGT 35 0.003315817 62.12679 5 >>END_MODULE SRR6958173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1125 33.0 33.0 34.0 33.0 34.0 2 33.227 34.0 33.0 34.0 33.0 34.0 3 33.2935 34.0 33.0 34.0 33.0 34.0 4 33.25425 34.0 33.0 34.0 33.0 34.0 5 33.299 34.0 33.0 34.0 33.0 34.0 6 37.41925 38.0 38.0 38.0 38.0 38.0 7 37.49925 38.0 38.0 38.0 38.0 38.0 8 37.4745 38.0 38.0 38.0 38.0 38.0 9 37.43275 38.0 38.0 38.0 38.0 38.0 10-14 37.3624 38.0 38.0 38.0 37.8 38.0 15-19 36.844950000000004 38.0 38.0 38.0 34.8 38.0 20-24 37.35295 38.0 38.0 38.0 38.0 38.0 25-29 37.46315 38.0 38.0 38.0 38.0 38.0 30-34 37.4647 38.0 38.0 38.0 38.0 38.0 35-39 36.562850000000005 38.0 37.4 38.0 32.0 38.0 40-44 37.378550000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.31705 38.0 38.0 38.0 37.4 38.0 50-54 37.3471 38.0 38.0 38.0 37.2 38.0 55-59 37.29455 38.0 38.0 38.0 37.0 38.0 60-64 37.2177 38.0 38.0 38.0 37.0 38.0 65-69 37.191900000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.1361 38.0 38.0 38.0 37.0 38.0 75-79 37.13595 38.0 38.0 38.0 37.0 38.0 80-84 36.0398 38.0 36.0 38.0 32.0 38.0 85-89 36.4764 38.0 37.4 38.0 33.8 38.0 90-94 35.4808 38.0 36.2 38.0 29.8 38.0 95-99 34.261849999999995 37.8 33.2 38.0 25.6 38.0 100-104 34.7336 38.0 34.2 38.0 27.6 38.0 105-109 36.3482 38.0 37.8 38.0 34.0 38.0 110-114 36.4491 38.0 38.0 38.0 33.6 38.0 115-119 36.201699999999995 38.0 38.0 38.0 33.0 38.0 120-124 35.973749999999995 38.0 38.0 38.0 32.4 38.0 125-129 35.240300000000005 38.0 36.6 38.0 28.8 38.0 130-134 35.49645 38.0 37.2 38.0 30.6 38.0 135-139 34.85735 38.0 36.0 38.0 27.8 38.0 140-144 32.00065 36.6 30.0 38.0 19.2 38.0 145-149 28.8331 35.0 24.2 38.0 3.8 38.0 150-151 20.768875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 7.0 15 3.0 16 3.0 17 2.0 18 5.0 19 4.0 20 3.0 21 3.0 22 8.0 23 11.0 24 10.0 25 11.0 26 9.0 27 18.0 28 23.0 29 38.0 30 40.0 31 66.0 32 83.0 33 149.0 34 224.0 35 432.0 36 1238.0 37 1597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.349999999999994 21.7 7.7 23.25 2 28.275 23.75 28.9 19.075 3 24.0 25.05 28.999999999999996 21.95 4 25.05 33.45 21.15 20.349999999999998 5 25.474999999999998 35.375 20.3 18.85 6 22.45 36.575 21.075 19.900000000000002 7 22.35 21.575 34.9 21.175 8 23.325000000000003 26.174999999999997 23.825 26.674999999999997 9 22.6 23.175 29.275000000000002 24.95 10-14 25.31 27.76 23.955000000000002 22.975 15-19 25.2 26.265 25.490000000000002 23.044999999999998 20-24 24.775 26.845000000000002 25.374999999999996 23.005 25-29 24.83 26.11 25.2 23.86 30-34 25.0 27.075 24.795 23.13 35-39 24.685000000000002 26.31 25.495 23.51 40-44 24.395 26.179999999999996 25.919999999999998 23.505000000000003 45-49 24.69 26.179999999999996 25.895000000000003 23.235 50-54 24.92872505376882 25.744010403641276 25.779022657930277 23.54824188465963 55-59 24.85 26.07 25.86 23.22 60-64 24.77119279819955 26.291572893223307 25.926481620405102 23.010752688172044 65-69 23.775 27.175 25.775 23.275000000000002 70-74 25.23888138476162 26.28945920256141 25.338936415028268 23.13272299764871 75-79 25.168809083179113 26.374230980843294 25.809033161606564 22.64792677437103 80-84 24.712298609026316 26.548584008806163 25.622936055238664 23.11618132692885 85-89 24.59852919105508 26.539596778228024 25.60908499674821 23.252789033968682 90-94 24.768715307296095 26.83902585387808 25.41381207181077 22.97844676701505 95-99 25.055 26.715 25.240000000000002 22.99 100-104 24.05 26.669999999999998 25.75 23.53 105-109 24.431107776944234 27.181795448862218 25.791447861965494 22.595648912228057 110-114 24.855 26.650000000000002 25.335 23.16 115-119 25.170034006801362 26.350270054010807 25.49009801960392 22.989597919583918 120-124 25.127512751275127 26.74767476747675 25.147514751475146 22.977297729772978 125-129 25.36253625362536 26.892689268926894 24.962496249624962 22.782278227822783 130-134 25.72 27.01 24.98 22.29 135-139 25.496374093523382 26.281570392598148 25.291322830707674 22.930732683170792 140-144 25.395 26.575 25.174999999999997 22.855 145-149 25.900000000000002 26.895000000000003 25.095 22.11 150-151 25.018754688672168 26.78169542385596 26.156539134783696 22.043010752688172 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.0 25 0.5 26 1.5 27 3.0 28 5.5 29 8.5 30 13.0 31 15.5 32 17.5 33 24.0 34 32.0 35 44.5 36 57.0 37 72.5 38 88.5 39 117.5 40 163.5 41 185.5 42 186.5 43 193.5 44 210.0 45 217.5 46 214.0 47 202.0 48 181.5 49 163.0 50 155.0 51 148.0 52 133.5 53 115.0 54 103.0 55 93.5 56 81.0 57 81.0 58 82.0 59 73.5 60 56.0 61 50.0 62 54.0 63 47.5 64 48.5 65 48.0 66 35.0 67 32.5 68 27.5 69 26.0 70 26.0 71 17.0 72 14.0 73 10.5 74 6.5 75 4.5 76 3.0 77 2.0 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.034999999999999996 55-59 0.0 60-64 0.025 65-69 0.0 70-74 0.055 75-79 0.034999999999999996 80-84 0.06999999999999999 85-89 0.055 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.02 120-124 0.01 125-129 0.01 130-134 0.0 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.5806614491290077 1.15 3 0.15147689977278464 0.44999999999999996 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.0875000000000004 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTAC 10 0.0069071017 144.46251 145 CGAAAAC 10 0.0069071017 144.46251 3 >>END_MODULE Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727486 spots for SRR6958173.sra Written 727486 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra Read 727484 spots for SRR6958173.sra Written 727484 spots for SRR6958173.sra SRR ids: ['SRR6958173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q9l01b_l SRR6958173.sra spots: 14549682 blocks: [[1, 727484], [727485, 1454968], [1454969, 2182452], [2182453, 2909936], [2909937, 3637420], [3637421, 4364904], [4364905, 5092388], [5092389, 5819872], [5819873, 6547356], [6547357, 7274840], [7274841, 8002324], [8002325, 8729808], [8729809, 9457292], [9457293, 10184776], [10184777, 10912260], [10912261, 11639744], [11639745, 12367228], [12367229, 13094712], [13094713, 13822196], [13822197, 14549682]] SRR6958173 file size 4908709 SRR6958173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958173 SRR6958173_1.fastq SRR6958173_2.fastq Input file: SRR6958173_1.fastq Paired file: SRR6958173_2.fastq trimmed: SRR6958173-trimmed-pair1.fastq, SRR6958173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:59:02 2024 >> started Fri Dec 6 14:59:21 2024 >> done (19.178s) 14549682 read pairs processed; of these: 9027 ( 0.06%) short read pairs filtered out after trimming by size control 10199 ( 0.07%) empty read pairs filtered out after trimming by size control 14530456 (99.87%) read pairs available; of these: 6028607 (41.49%) trimmed read pairs available after processing 8501849 (58.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 8 0.00% 21 3 0.00% 22 15 0.00% 23 15 0.00% 24 19 0.00% 25 15 0.00% 26 22 0.00% 27 19 0.00% 28 11 0.00% 29 19 0.00% 30 12 0.00% 31 15 0.00% 32 17 0.00% 33 15 0.00% 34 15 0.00% 35 13 0.00% 36 14 0.00% 37 16 0.00% 38 20 0.00% 39 29 0.00% 40 27 0.00% 41 28 0.00% 42 32 0.00% 43 41 0.00% 44 22 0.00% 45 26 0.00% 46 33 0.00% 47 40 0.00% 48 42 0.00% 49 46 0.00% 50 62 0.00% 51 60 0.00% 52 58 0.00% 53 67 0.00% 54 85 0.00% 55 100 0.00% 56 103 0.00% 57 116 0.00% 58 123 0.00% 59 152 0.00% 60 172 0.00% 61 233 0.00% 62 203 0.00% 63 213 0.00% 64 250 0.00% 65 287 0.00% 66 315 0.00% 67 363 0.00% 68 442 0.00% 69 490 0.00% 70 525 0.00% 71 645 0.00% 72 704 0.00% 73 789 0.01% 74 829 0.01% 75 1030 0.01% 76 1200 0.01% 77 1354 0.01% 78 1370 0.01% 79 1541 0.01% 80 1683 0.01% 81 1949 0.01% 82 2196 0.02% 83 2490 0.02% 84 3246 0.02% 85 3595 0.02% 86 3818 0.03% 87 4282 0.03% 88 4472 0.03% 89 4894 0.03% 90 5412 0.04% 91 5805 0.04% 92 6372 0.04% 93 6897 0.05% 94 7568 0.05% 95 7972 0.05% 96 8572 0.06% 97 9265 0.06% 98 9998 0.07% 99 10949 0.08% 100 13703 0.09% 101 15653 0.11% 102 12162 0.08% 103 12982 0.09% 104 13767 0.09% 105 14667 0.10% 106 15733 0.11% 107 16067 0.11% 108 16868 0.12% 109 17606 0.12% 110 18282 0.13% 111 19383 0.13% 112 20460 0.14% 113 21474 0.15% 114 22683 0.16% 115 23717 0.16% 116 24800 0.17% 117 25945 0.18% 118 26595 0.18% 119 27133 0.19% 120 28150 0.19% 121 29174 0.20% 122 30096 0.21% 123 31591 0.22% 124 32887 0.23% 125 34549 0.24% 126 35936 0.25% 127 37070 0.26% 128 37951 0.26% 129 38954 0.27% 130 40591 0.28% 131 42237 0.29% 132 43888 0.30% 133 45951 0.32% 134 47176 0.32% 135 49648 0.34% 136 51532 0.35% 137 53695 0.37% 138 56312 0.39% 139 58901 0.41% 140 62847 0.43% 141 67373 0.46% 142 72181 0.50% 143 79306 0.55% 144 89572 0.62% 145 104741 0.72% 146 126756 0.87% 147 169000 1.16% 148 250940 1.73% 149 505295 3.48% 150 3168651 21.81% 151 8501849 58.51% 14530456 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=33 prefix-density=0.48 prefix-fanout=2.3 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=64.15 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.0 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=26 prefix-density=0.26 prefix-fanout=2.6 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=126.06 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR6958173 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:00:08 Started mapping on | Dec 06 15:00:09 Finished on | Dec 06 15:02:19 Mapping speed, Million of reads per hour | 402.38 Number of input reads | 14530456 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13951793 Uniquely mapped reads % | 96.02% Average mapped length | 294.43 Number of splices: Total | 15145800 Number of splices: Annotated (sjdb) | 14160641 Number of splices: GT/AG | 14926928 Number of splices: GC/AG | 176989 Number of splices: AT/AC | 6255 Number of splices: Non-canonical | 35628 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186248 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 8800 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399135 399135 399135 N_multimapping 186248 186248 186248 N_noFeature 704615 13521359 857439 N_ambiguous 329636 2244 52238 UnstrandedReadsAssigned:12917542 PositiveStrandReadsAssigned:428190 NegativeStrandReadsAssigned:13042116 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958173-trimmed-pair1.fastq SRR6958173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,530,456 reads, 13,042,259 reads pseudoaligned [quant] estimated average fragment length: 236.52 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR6958173.ke.tsv 35125 SRR6958173.se.tsv 88098 total ==> SRR6958173.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.729 0 0 PNS24247 1044 808.48 43.8643 6.42145 PNS24249 1928 1692.48 33.1283 2.31668 PNS24246 1044 808.48 43.8643 6.42145 PNS24248 1044 808.48 43.8643 6.42145 PNS24244 1471 1235.48 34.279 3.28385 PNS24243 293 94.5344 0 0 KQK14069 1603 1367.48 2875 248.833 KQK14071 474 245.752 71.6858 34.5244 ==> SRR6958173.se.tsv <== BRADI_1g14170v3 3484 BRADI_1g53295v3 918 BRADI_1g59795v3 158 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 280 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 266 BRADI_1g48960v3 0 SRR6958173 completed mapping pipeline successfully