Starting /dee2/code/volunteer_pipeline.sh SRR6958174 current disk space = 1550430040064 free memory = 1603315068 SRR6958174 SRAfilesize 44f7b08c921bc87a95f78f669def70a1 SRR6958174.sra SRR6958174.sra file validated SRR6958174 is paired end SRR6958174 is conventional basespace SRR6958174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.759 18.0 18.0 28.0 18.0 32.0 2 29.252 30.0 28.0 31.0 25.0 33.0 3 31.77225 33.0 31.0 33.0 29.0 33.0 4 32.50375 33.0 33.0 33.0 32.0 34.0 5 32.8185 33.0 33.0 33.0 32.0 34.0 6 37.03775 38.0 37.0 38.0 35.0 38.0 7 37.477 38.0 38.0 38.0 37.0 38.0 8 37.515 38.0 38.0 38.0 38.0 38.0 9 37.64075 38.0 38.0 38.0 38.0 38.0 10-14 37.0933 38.0 38.0 38.0 35.6 38.0 15-19 35.6279 37.6 34.8 38.0 31.0 38.0 20-24 35.873149999999995 38.0 36.2 38.0 28.8 38.0 25-29 37.4875 38.0 38.0 38.0 37.2 38.0 30-34 37.54145 38.0 38.0 38.0 38.0 38.0 35-39 37.477700000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.55465 38.0 38.0 38.0 38.0 38.0 45-49 37.5779 38.0 38.0 38.0 38.0 38.0 50-54 37.5733 38.0 38.0 38.0 38.0 38.0 55-59 37.51434999999999 38.0 38.0 38.0 38.0 38.0 60-64 37.49535 38.0 38.0 38.0 37.8 38.0 65-69 37.4837 38.0 38.0 38.0 38.0 38.0 70-74 37.42515 38.0 38.0 38.0 37.4 38.0 75-79 36.58444999999999 38.0 37.4 38.0 33.6 38.0 80-84 37.29225 38.0 38.0 38.0 37.0 38.0 85-89 37.282849999999996 38.0 38.0 38.0 36.8 38.0 90-94 36.73505 38.0 37.8 38.0 34.6 38.0 95-99 37.15599999999999 38.0 38.0 38.0 36.2 38.0 100-104 37.11125 38.0 38.0 38.0 36.0 38.0 105-109 36.9957 38.0 38.0 38.0 36.0 38.0 110-114 36.97245 38.0 38.0 38.0 35.8 38.0 115-119 36.7376 38.0 38.0 38.0 34.8 38.0 120-124 36.5038 38.0 38.0 38.0 34.6 38.0 125-129 36.49215 38.0 38.0 38.0 34.0 38.0 130-134 36.467650000000006 38.0 38.0 38.0 34.0 38.0 135-139 36.3429 38.0 38.0 38.0 34.0 38.0 140-144 36.168350000000004 38.0 38.0 38.0 33.4 38.0 145-149 35.7934 38.0 37.6 38.0 32.8 38.0 150-151 32.123374999999996 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 1.0 20 2.0 21 3.0 22 1.0 23 5.0 24 8.0 25 1.0 26 6.0 27 7.0 28 10.0 29 18.0 30 33.0 31 46.0 32 39.0 33 76.0 34 107.0 35 217.0 36 704.0 37 2706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.13228585909782 10.263558033451597 7.475924987328941 39.12823112012164 2 24.7 12.375 34.699999999999996 28.225 3 22.400000000000002 14.825 24.125 38.65 4 27.031757939484873 22.95573893473368 21.005251312828207 29.00725181295324 5 26.75 28.4 23.200000000000003 21.65 6 22.15 31.6 23.3 22.95 7 17.474999999999998 23.674999999999997 39.4 19.45 8 20.05 22.95 29.925 27.075 9 20.075000000000003 21.175 33.775 24.975 10-14 23.080000000000002 26.0 26.284999999999997 24.635 15-19 22.919999999999998 24.715 26.295 26.07 20-24 23.080000000000002 25.515 26.02 25.385 25-29 23.06 25.509999999999998 25.785000000000004 25.645 30-34 23.285 24.97 25.979999999999997 25.765 35-39 23.605 24.66 25.869999999999997 25.865 40-44 23.69 24.795 26.119999999999997 25.395 45-49 22.830000000000002 25.224999999999998 25.755 26.19 50-54 23.23 25.290000000000003 25.705 25.775 55-59 22.85 25.040000000000003 26.035000000000004 26.075 60-64 23.27 24.45 26.185000000000002 26.095000000000002 65-69 23.724999999999998 25.195 25.185000000000002 25.895000000000003 70-74 23.345 25.369999999999997 25.405 25.88 75-79 23.630000000000003 24.785 25.47 26.115 80-84 23.435 25.055 25.82 25.69 85-89 23.82 24.595 25.955000000000002 25.629999999999995 90-94 23.505000000000003 24.884999999999998 25.755 25.855 95-99 23.682368236823685 24.532453245324533 25.717571757175715 26.067606760676064 100-104 23.155 25.045 25.735000000000003 26.064999999999998 105-109 23.635 25.105 25.86 25.4 110-114 23.165 25.415 26.07 25.35 115-119 23.95 24.79 25.540000000000003 25.72 120-124 23.669999999999998 24.705 25.419999999999998 26.205000000000002 125-129 23.225 24.965 25.765 26.045 130-134 23.745 25.009999999999998 25.759999999999998 25.485000000000003 135-139 24.08 24.51 25.569999999999997 25.840000000000003 140-144 24.035 25.71 24.98 25.275 145-149 23.66 25.55 24.905 25.885 150-151 23.9125 24.45 25.1 26.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 2.0 28 3.5 29 5.0 30 4.0 31 5.5 32 11.5 33 18.0 34 23.0 35 26.0 36 41.0 37 54.0 38 71.5 39 100.0 40 113.5 41 141.5 42 189.0 43 194.0 44 190.0 45 215.0 46 220.5 47 203.0 48 187.5 49 179.0 50 165.5 51 147.5 52 126.5 53 120.5 54 122.5 55 102.5 56 92.0 57 95.5 58 83.5 59 76.0 60 73.0 61 68.5 62 65.5 63 63.0 64 63.0 65 55.5 66 49.0 67 45.0 68 36.5 69 30.5 70 26.5 71 23.0 72 20.0 73 13.5 74 7.5 75 8.5 76 7.5 77 3.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.7875 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73275 33.0 33.0 34.0 32.0 34.0 2 33.0085 33.0 33.0 34.0 32.0 34.0 3 33.17225 34.0 33.0 34.0 33.0 34.0 4 33.24225 34.0 33.0 34.0 33.0 34.0 5 31.48375 33.0 32.0 34.0 27.0 34.0 6 36.9375 38.0 38.0 38.0 35.0 38.0 7 37.25625 38.0 38.0 38.0 37.0 38.0 8 37.4615 38.0 38.0 38.0 37.0 38.0 9 37.4575 38.0 38.0 38.0 38.0 38.0 10-14 37.426550000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.46205 38.0 38.0 38.0 38.0 38.0 20-24 37.51095 38.0 38.0 38.0 38.0 38.0 25-29 37.4762 38.0 38.0 38.0 38.0 38.0 30-34 37.4621 38.0 38.0 38.0 38.0 38.0 35-39 37.36514999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.12705 38.0 38.0 38.0 36.6 38.0 45-49 37.04915 38.0 38.0 38.0 36.6 38.0 50-54 37.25555 38.0 38.0 38.0 37.0 38.0 55-59 37.4169 38.0 38.0 38.0 38.0 38.0 60-64 37.29395 38.0 38.0 38.0 37.0 38.0 65-69 37.268449999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.2885 38.0 38.0 38.0 37.0 38.0 75-79 37.25965000000001 38.0 38.0 38.0 37.0 38.0 80-84 37.179700000000004 38.0 38.0 38.0 36.8 38.0 85-89 37.1027 38.0 38.0 38.0 36.6 38.0 90-94 37.06054999999999 38.0 38.0 38.0 36.2 38.0 95-99 36.73775 38.0 38.0 38.0 35.0 38.0 100-104 36.87365 38.0 38.0 38.0 35.4 38.0 105-109 36.83965 38.0 38.0 38.0 35.2 38.0 110-114 36.7733 38.0 38.0 38.0 35.0 38.0 115-119 36.6021 38.0 38.0 38.0 34.8 38.0 120-124 35.75905 38.0 36.6 38.0 29.6 38.0 125-129 36.2139 38.0 38.0 38.0 33.8 38.0 130-134 36.22985 38.0 38.0 38.0 33.8 38.0 135-139 35.83669999999999 38.0 37.8 38.0 32.4 38.0 140-144 35.4963 38.0 37.0 38.0 31.2 38.0 145-149 35.01605 38.0 36.0 38.0 30.6 38.0 150-151 28.69675 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 4.0 17 2.0 18 2.0 19 3.0 20 2.0 21 3.0 22 1.0 23 5.0 24 9.0 25 6.0 26 13.0 27 15.0 28 19.0 29 22.0 30 26.0 31 54.0 32 58.0 33 68.0 34 123.0 35 207.0 36 459.0 37 2889.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 18.525 9.725 31.2 2 28.299999999999997 23.925 28.475 19.3 3 20.4801200300075 25.831457864466117 28.75718929732433 24.93123280820205 4 27.800000000000004 29.849999999999998 20.875 21.475 5 27.450000000000003 33.225 20.674999999999997 18.65 6 22.325 37.4 19.975 20.3 7 23.674999999999997 20.549999999999997 33.2 22.575 8 22.775000000000002 25.224999999999998 24.725 27.275 9 23.9 22.75 27.025 26.325 10-14 25.825 26.88 22.805 24.490000000000002 15-19 25.825 25.445 24.759999999999998 23.97 20-24 26.125 25.790000000000003 24.57 23.515 25-29 25.726286314315715 25.91629581479074 24.111205560278016 24.24621231061553 30-34 25.41 26.68 23.805 24.104999999999997 35-39 25.275 25.97 24.385 24.37 40-44 25.580000000000002 25.485000000000003 24.185000000000002 24.75 45-49 25.8 25.665 24.51 24.025 50-54 25.865 25.545 24.44 24.15 55-59 25.130000000000003 24.990000000000002 24.795 25.085 60-64 25.919999999999998 25.285000000000004 24.8 23.995 65-69 25.314999999999998 25.845000000000002 24.42 24.42 70-74 25.645 25.990000000000002 24.355 24.01 75-79 26.045 25.740000000000002 23.995 24.22 80-84 25.316265813290666 26.131306565328266 24.446222311115555 24.106205310265512 85-89 25.845000000000002 25.635 24.035 24.485 90-94 25.75 25.655 24.535 24.060000000000002 95-99 25.985000000000003 25.545 24.785 23.685000000000002 100-104 25.935000000000002 25.490000000000002 23.97 24.605 105-109 25.46 25.71 24.935 23.895 110-114 26.345000000000002 26.165 24.05 23.44 115-119 26.615 26.11 23.78 23.494999999999997 120-124 26.729999999999997 25.995 24.415 22.86 125-129 26.935 25.8 24.41 22.855 130-134 26.779999999999998 25.755 24.335 23.13 135-139 27.894999999999996 25.53 24.33 22.245 140-144 27.37 25.905 24.47 22.255 145-149 27.31136556827841 26.226311315565777 24.311215560778038 22.15110755537777 150-151 26.724999999999998 27.1625 24.425 21.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.0 27 2.5 28 5.5 29 5.0 30 6.5 31 9.0 32 9.5 33 18.0 34 29.5 35 39.5 36 47.0 37 50.5 38 70.0 39 94.5 40 112.5 41 141.5 42 167.5 43 171.5 44 171.5 45 181.5 46 188.5 47 190.0 48 174.5 49 165.0 50 163.5 51 151.0 52 140.5 53 128.5 54 115.5 55 101.0 56 106.0 57 102.5 58 92.5 59 95.0 60 84.0 61 78.5 62 78.5 63 72.0 64 72.5 65 64.0 66 52.5 67 49.0 68 43.0 69 40.5 70 35.5 71 23.5 72 13.5 73 12.0 74 7.0 75 5.0 76 5.0 77 2.5 78 2.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9588623666836 97.425 2 0.7364144235652615 1.4500000000000002 3 0.15236160487557138 0.44999999999999996 4 0.07618080243778569 0.3 5 0.07618080243778569 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 5 0.125 No Hit GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 5 0.125 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104347 spots for SRR6958174.sra Written 1104347 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra Read 1104346 spots for SRR6958174.sra Written 1104346 spots for SRR6958174.sra SRR ids: ['SRR6958174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2rerpusu SRR6958174.sra spots: 22086921 blocks: [[1, 1104346], [1104347, 2208692], [2208693, 3313038], [3313039, 4417384], [4417385, 5521730], [5521731, 6626076], [6626077, 7730422], [7730423, 8834768], [8834769, 9939114], [9939115, 11043460], [11043461, 12147806], [12147807, 13252152], [13252153, 14356498], [14356499, 15460844], [15460845, 16565190], [16565191, 17669536], [17669537, 18773882], [18773883, 19878228], [19878229, 20982574], [20982575, 22086921]] SRR6958174 file size 7462832 SRR6958174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958174 SRR6958174_1.fastq SRR6958174_2.fastq Input file: SRR6958174_1.fastq Paired file: SRR6958174_2.fastq trimmed: SRR6958174-trimmed-pair1.fastq, SRR6958174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:07:52 2024 >> started Fri Dec 6 15:08:13 2024 >> done (21.591s) 22086921 read pairs processed; of these: 10597 ( 0.05%) short read pairs filtered out after trimming by size control 10971 ( 0.05%) empty read pairs filtered out after trimming by size control 22065353 (99.90%) read pairs available; of these: 7739207 (35.07%) trimmed read pairs available after processing 14326146 (64.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 15 0.00% 21 10 0.00% 22 18 0.00% 23 13 0.00% 24 22 0.00% 25 17 0.00% 26 16 0.00% 27 18 0.00% 28 16 0.00% 29 16 0.00% 30 14 0.00% 31 18 0.00% 32 13 0.00% 33 19 0.00% 34 25 0.00% 35 21 0.00% 36 22 0.00% 37 30 0.00% 38 25 0.00% 39 24 0.00% 40 26 0.00% 41 36 0.00% 42 23 0.00% 43 48 0.00% 44 47 0.00% 45 54 0.00% 46 46 0.00% 47 56 0.00% 48 54 0.00% 49 56 0.00% 50 88 0.00% 51 99 0.00% 52 108 0.00% 53 102 0.00% 54 100 0.00% 55 142 0.00% 56 121 0.00% 57 156 0.00% 58 200 0.00% 59 180 0.00% 60 213 0.00% 61 253 0.00% 62 307 0.00% 63 367 0.00% 64 346 0.00% 65 410 0.00% 66 489 0.00% 67 526 0.00% 68 621 0.00% 69 703 0.00% 70 785 0.00% 71 957 0.00% 72 999 0.00% 73 1217 0.01% 74 1339 0.01% 75 1493 0.01% 76 1672 0.01% 77 1872 0.01% 78 2162 0.01% 79 2436 0.01% 80 2558 0.01% 81 2982 0.01% 82 3469 0.02% 83 3830 0.02% 84 4565 0.02% 85 5424 0.02% 86 5968 0.03% 87 6532 0.03% 88 7178 0.03% 89 7609 0.03% 90 8201 0.04% 91 8996 0.04% 92 9575 0.04% 93 10418 0.05% 94 11194 0.05% 95 11963 0.05% 96 12842 0.06% 97 13867 0.06% 98 14736 0.07% 99 15668 0.07% 100 16491 0.07% 101 17559 0.08% 102 19125 0.09% 103 20202 0.09% 104 21441 0.10% 105 22407 0.10% 106 23593 0.11% 107 24873 0.11% 108 25516 0.12% 109 27423 0.12% 110 28711 0.13% 111 29698 0.13% 112 31405 0.14% 113 32618 0.15% 114 33916 0.15% 115 35710 0.16% 116 37444 0.17% 117 38624 0.18% 118 40332 0.18% 119 40861 0.19% 120 42510 0.19% 121 43485 0.20% 122 45436 0.21% 123 46634 0.21% 124 48858 0.22% 125 50757 0.23% 126 52203 0.24% 127 54078 0.25% 128 54867 0.25% 129 57063 0.26% 130 58883 0.27% 131 60546 0.27% 132 62580 0.28% 133 65420 0.30% 134 67272 0.30% 135 69361 0.31% 136 71757 0.33% 137 74666 0.34% 138 76859 0.35% 139 80415 0.36% 140 84223 0.38% 141 89034 0.40% 142 95406 0.43% 143 102152 0.46% 144 112390 0.51% 145 127680 0.58% 146 149873 0.68% 147 191454 0.87% 148 274893 1.25% 149 526823 2.39% 150 4044806 18.33% 151 14326146 64.93% 22065353 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=60.84 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=AATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=25 prefix-density=0.49 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=125.63 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958174 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:08:59 Started mapping on | Dec 06 15:08:59 Finished on | Dec 06 15:11:28 Mapping speed, Million of reads per hour | 533.12 Number of input reads | 22065353 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21332954 Uniquely mapped reads % | 96.68% Average mapped length | 294.92 Number of splices: Total | 24272381 Number of splices: Annotated (sjdb) | 22733406 Number of splices: GT/AG | 23930286 Number of splices: GC/AG | 282707 Number of splices: AT/AC | 9314 Number of splices: Non-canonical | 50074 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270848 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 10887 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470473 470473 470473 N_multimapping 270848 270848 270848 N_noFeature 797559 20695019 998778 N_ambiguous 516284 2989 80548 UnstrandedReadsAssigned:20019111 PositiveStrandReadsAssigned:634946 NegativeStrandReadsAssigned:20253628 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958174-trimmed-pair1.fastq SRR6958174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,065,353 reads, 20,253,823 reads pseudoaligned [quant] estimated average fragment length: 259.545 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR6958174.ke.tsv 35125 SRR6958174.se.tsv 88098 total ==> SRR6958174.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.108 0 0 PNS24247 1044 785.455 49.5276 4.58058 PNS24249 1928 1669.46 65.7259 2.85994 PNS24246 1044 785.455 49.5276 4.58058 PNS24248 1044 785.455 49.5276 4.58058 PNS24244 1471 1212.46 47.6913 2.85738 PNS24243 293 93.7328 0 0 KQK14069 1603 1344.46 3572.77 193.043 KQK14071 474 235.895 44.067 13.5703 ==> SRR6958174.se.tsv <== BRADI_1g14170v3 4068 BRADI_1g53295v3 1094 BRADI_1g59795v3 155 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 403 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 315 BRADI_1g48960v3 0 SRR6958174 completed mapping pipeline successfully