Starting /dee2/code/volunteer_pipeline.sh SRR6958175 current disk space = 1550443810816 free memory = 1601634560 SRR6958175 SRAfilesize 70099801f11a6455ce7b12078909b64d SRR6958175.sra SRR6958175.sra file validated SRR6958175 is paired end SRR6958175 is conventional basespace SRR6958175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.87625 30.0 18.0 33.0 18.0 33.0 2 26.9915 29.0 25.0 31.0 18.0 33.0 3 29.9855 31.0 29.0 33.0 27.0 33.0 4 32.24125 33.0 32.0 33.0 32.0 33.0 5 32.68875 33.0 33.0 33.0 32.0 34.0 6 36.45525 38.0 37.0 38.0 34.0 38.0 7 37.36225 38.0 38.0 38.0 37.0 38.0 8 36.1065 38.0 38.0 38.0 33.0 38.0 9 37.26625 38.0 38.0 38.0 36.0 38.0 10-14 36.42529999999999 38.0 36.8 38.0 31.4 38.0 15-19 37.442550000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.6156 38.0 38.0 38.0 38.0 38.0 25-29 37.58995 38.0 38.0 38.0 38.0 38.0 30-34 37.535399999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.29735 38.0 38.0 38.0 37.0 38.0 40-44 37.464999999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.4856 38.0 38.0 38.0 38.0 38.0 50-54 36.66685 38.0 37.6 38.0 33.8 38.0 55-59 37.19055 38.0 38.0 38.0 36.6 38.0 60-64 37.366150000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.3717 38.0 38.0 38.0 37.0 38.0 70-74 37.392849999999996 38.0 38.0 38.0 37.0 38.0 75-79 36.9371 38.0 38.0 38.0 35.2 38.0 80-84 37.193200000000004 38.0 38.0 38.0 36.4 38.0 85-89 37.31285 38.0 38.0 38.0 37.0 38.0 90-94 35.5979 38.0 35.2 38.0 30.0 38.0 95-99 36.94695 38.0 38.0 38.0 35.4 38.0 100-104 36.95575 38.0 38.0 38.0 35.8 38.0 105-109 36.868849999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.76405 38.0 38.0 38.0 35.2 38.0 115-119 36.41735 38.0 37.6 38.0 33.8 38.0 120-124 36.33675 38.0 37.8 38.0 34.0 38.0 125-129 36.32475000000001 38.0 38.0 38.0 34.0 38.0 130-134 36.2737 38.0 38.0 38.0 34.0 38.0 135-139 36.05425 38.0 37.8 38.0 33.0 38.0 140-144 35.6964 38.0 36.4 38.0 31.2 38.0 145-149 35.121 38.0 36.0 38.0 31.0 38.0 150-151 31.226125 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 2.0 22 3.0 23 3.0 24 6.0 25 2.0 26 10.0 27 10.0 28 16.0 29 25.0 30 32.0 31 41.0 32 51.0 33 94.0 34 143.0 35 230.0 36 793.0 37 2527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.74754775425916 13.371192565823439 5.653071760454311 34.22818791946309 2 24.675 15.575 31.0 28.749999999999996 3 21.875 20.175 24.7 33.25 4 25.650000000000002 25.525 23.150000000000002 25.674999999999997 5 24.349999999999998 30.55 23.175 21.925 6 21.525 35.425000000000004 22.925 20.125 7 16.275000000000002 22.625 41.925000000000004 19.175 8 19.2 24.15 29.075 27.575 9 20.424999999999997 21.099999999999998 33.825 24.65 10-14 22.86 27.13 25.255 24.755 15-19 22.439999999999998 26.35 26.490000000000002 24.72 20-24 22.73 26.009999999999998 25.795 25.465 25-29 22.470000000000002 26.445 26.119999999999997 24.965 30-34 22.395 26.369999999999997 26.275 24.959999999999997 35-39 22.855 26.115 26.02 25.009999999999998 40-44 22.745 26.66 25.424999999999997 25.169999999999998 45-49 22.59 26.455000000000002 26.36 24.595 50-54 22.105 26.26 26.415 25.22 55-59 22.875 26.555 26.095000000000002 24.474999999999998 60-64 22.185 25.924999999999997 25.740000000000002 26.150000000000002 65-69 22.685 26.064999999999998 26.105 25.145 70-74 22.91 26.490000000000002 25.685000000000002 24.915000000000003 75-79 22.475 26.200000000000003 25.91 25.415 80-84 22.634999999999998 25.474999999999998 26.32 25.569999999999997 85-89 23.3 25.240000000000002 25.835 25.624999999999996 90-94 23.025000000000002 26.08 25.825 25.069999999999997 95-99 22.695 25.835 26.025 25.445 100-104 22.7 25.77 25.995 25.535000000000004 105-109 22.795 26.135 26.11 24.959999999999997 110-114 22.86 25.75 25.825 25.564999999999998 115-119 23.315 25.740000000000002 26.174999999999997 24.77 120-124 22.755 25.755 25.94 25.55 125-129 22.900000000000002 25.724999999999998 25.715 25.66 130-134 23.015 26.445 25.295 25.245 135-139 22.366118305915293 25.641282064103205 25.881294064703237 26.111305565278265 140-144 22.939999999999998 25.779999999999998 25.759999999999998 25.52 145-149 22.85 25.83 25.590000000000003 25.729999999999997 150-151 22.575 26.137500000000003 25.174999999999997 26.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 4.0 29 6.0 30 7.0 31 11.0 32 23.0 33 27.5 34 29.5 35 38.0 36 50.0 37 71.5 38 89.0 39 118.5 40 155.0 41 173.5 42 201.5 43 212.0 44 220.0 45 225.0 46 208.5 47 208.0 48 194.0 49 169.0 50 168.0 51 147.0 52 129.5 53 123.0 54 101.0 55 87.5 56 77.5 57 76.0 58 72.0 59 64.5 60 56.0 61 54.0 62 53.5 63 44.0 64 38.5 65 39.0 66 30.5 67 29.0 68 31.0 69 30.0 70 24.5 71 13.5 72 13.5 73 13.0 74 9.0 75 7.5 76 6.5 77 4.0 78 2.5 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.525 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2125000000000004 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATCC 10 0.0068343505 144.975 2 TTAACAA 10 0.0068343505 144.975 4 GCTTATG 10 0.0068343505 144.975 4 CGTCTGA 20 0.005940113 28.995 140-144 >>END_MODULE SRR6958175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9665 33.0 33.0 34.0 32.0 34.0 2 33.0685 34.0 33.0 34.0 32.0 34.0 3 33.10525 34.0 33.0 34.0 33.0 34.0 4 33.10175 34.0 33.0 34.0 33.0 34.0 5 32.89375 34.0 33.0 34.0 32.0 34.0 6 37.1115 38.0 38.0 38.0 37.0 38.0 7 37.16975 38.0 38.0 38.0 37.0 38.0 8 37.15025 38.0 38.0 38.0 37.0 38.0 9 37.196 38.0 38.0 38.0 37.0 38.0 10-14 37.2277 38.0 38.0 38.0 37.0 38.0 15-19 37.2593 38.0 38.0 38.0 37.6 38.0 20-24 37.2082 38.0 38.0 38.0 37.0 38.0 25-29 37.09310000000001 38.0 38.0 38.0 36.6 38.0 30-34 37.14205 38.0 38.0 38.0 37.0 38.0 35-39 36.6807 38.0 38.0 38.0 35.4 38.0 40-44 36.5509 38.0 38.0 38.0 34.6 38.0 45-49 36.5128 38.0 38.0 38.0 35.0 38.0 50-54 36.873 38.0 38.0 38.0 36.0 38.0 55-59 35.58729999999999 38.0 36.8 38.0 28.6 38.0 60-64 36.88295 38.0 38.0 38.0 36.0 38.0 65-69 36.884699999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.91550000000001 38.0 38.0 38.0 36.2 38.0 75-79 36.373 38.0 37.6 38.0 33.8 38.0 80-84 36.6063 38.0 38.0 38.0 35.2 38.0 85-89 35.849900000000005 38.0 37.2 38.0 29.8 38.0 90-94 36.12275 38.0 37.8 38.0 33.2 38.0 95-99 36.2745 38.0 38.0 38.0 33.6 38.0 100-104 36.2429 38.0 38.0 38.0 34.0 38.0 105-109 36.247049999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.05555 38.0 38.0 38.0 33.4 38.0 115-119 36.00995 38.0 38.0 38.0 33.4 38.0 120-124 35.635299999999994 38.0 37.4 38.0 31.8 38.0 125-129 35.438250000000004 38.0 36.6 38.0 31.0 38.0 130-134 34.39675 38.0 34.4 38.0 25.8 38.0 135-139 33.524150000000006 38.0 32.8 38.0 21.0 38.0 140-144 34.1969 38.0 35.2 38.0 25.6 38.0 145-149 33.58965 38.0 34.2 38.0 21.2 38.0 150-151 27.8795 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 3.0 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 4.0 15 1.0 16 2.0 17 3.0 18 1.0 19 6.0 20 7.0 21 6.0 22 5.0 23 8.0 24 20.0 25 17.0 26 19.0 27 16.0 28 27.0 29 33.0 30 57.0 31 67.0 32 79.0 33 101.0 34 176.0 35 287.0 36 652.0 37 2376.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.224999999999994 21.075 8.575000000000001 26.125 2 29.475 23.925 27.450000000000003 19.15 3 22.05 25.5 28.525 23.925 4 25.074999999999996 32.074999999999996 21.7 21.15 5 26.200000000000003 34.25 19.425 20.125 6 22.625 36.75 20.925 19.7 7 22.125 19.275000000000002 36.0 22.6 8 22.875 22.85 25.624999999999996 28.65 9 23.575 22.3 26.825 27.3 10-14 25.86 26.455000000000002 23.78 23.905 15-19 25.562556255625562 25.74757475747575 24.62246224622462 24.067406740674066 20-24 24.93623405851463 25.891472868217054 24.946236559139784 24.226056514128533 25-29 25.885 25.790000000000003 24.785 23.54 30-34 25.45 25.290000000000003 25.515 23.745 35-39 25.61512302460492 25.570114022804564 24.81996399279856 23.994798959791957 40-44 25.42127106355318 25.776288814440722 25.236261813090653 23.566178308915443 45-49 25.569999999999997 25.64 24.945 23.845 50-54 25.54127706385319 25.656282814140706 24.941247062353117 23.861193059652983 55-59 26.196309815490775 25.6112805640282 24.8162408120406 23.376168808440422 60-64 25.47 25.82 25.155 23.555 65-69 25.41635408852213 25.946486621655414 25.55138784696174 23.085771442860715 70-74 25.5 25.314999999999998 25.974999999999998 23.21 75-79 25.759999999999998 25.929999999999996 24.91 23.400000000000002 80-84 25.230000000000004 26.169999999999998 25.28 23.32 85-89 25.82145536384096 25.906476619154787 25.206301575393848 23.065766441610403 90-94 25.869999999999997 25.75 24.92 23.46 95-99 25.324999999999996 26.325 25.180000000000003 23.169999999999998 100-104 25.785157031406282 25.500100020004002 25.71514302860572 22.999599919983996 105-109 25.911295564778236 25.591279563978198 25.65128256412821 22.846142307115354 110-114 26.001500375093773 26.641660415103775 24.861215303825958 22.495623905976494 115-119 26.272881864559366 25.842752825847754 24.997499249774933 22.886866059817944 120-124 25.919999999999998 26.43 24.905 22.745 125-129 25.92129606480324 26.351317565878297 24.891244562228113 22.836141807090353 130-134 26.356589147286826 25.916479119779943 25.276319079769944 22.45061265316329 135-139 26.301575393848463 25.571392848212053 25.4913728432108 22.635658914728683 140-144 25.669999999999998 26.450000000000003 25.314999999999998 22.564999999999998 145-149 26.419999999999998 26.21 25.1 22.27 150-151 27.4125 26.6625 24.8625 21.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 2.0 27 1.5 28 1.0 29 3.5 30 6.0 31 10.0 32 17.5 33 26.0 34 35.5 35 42.5 36 45.5 37 53.0 38 78.5 39 115.0 40 137.0 41 157.0 42 173.0 43 185.0 44 190.5 45 185.5 46 193.5 47 212.0 48 194.0 49 166.0 50 165.0 51 153.5 52 139.0 53 125.0 54 110.5 55 88.0 56 84.5 57 85.0 58 76.0 59 71.5 60 68.0 61 68.5 62 62.5 63 54.5 64 50.5 65 50.5 66 49.5 67 49.0 68 52.5 69 45.0 70 29.0 71 22.5 72 19.0 73 16.5 74 12.5 75 7.0 76 2.5 77 2.5 78 2.0 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.005 110-114 0.025 115-119 0.03 120-124 0.0 125-129 0.005 130-134 0.025 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.387499999999999 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.3625 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTTG 10 0.006830828 145.0 6 CTGAACT 10 0.006830828 145.0 7 CTTACAT 10 0.006830828 145.0 1 TCTGAAC 10 0.006830828 145.0 6 GTGTAGG 20 0.00593511 29.0 140-144 >>END_MODULE Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra Read 1184915 spots for SRR6958175.sra Written 1184915 spots for SRR6958175.sra Read 1184904 spots for SRR6958175.sra Written 1184904 spots for SRR6958175.sra SRR ids: ['SRR6958175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1fxkhkqd SRR6958175.sra spots: 23698091 blocks: [[1, 1184904], [1184905, 2369808], [2369809, 3554712], [3554713, 4739616], [4739617, 5924520], [5924521, 7109424], [7109425, 8294328], [8294329, 9479232], [9479233, 10664136], [10664137, 11849040], [11849041, 13033944], [13033945, 14218848], [14218849, 15403752], [15403753, 16588656], [16588657, 17773560], [17773561, 18958464], [18958465, 20143368], [20143369, 21328272], [21328273, 22513176], [22513177, 23698091]] SRR6958175 file size 8008805 SRR6958175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958175 SRR6958175_1.fastq SRR6958175_2.fastq Input file: SRR6958175_1.fastq Paired file: SRR6958175_2.fastq trimmed: SRR6958175-trimmed-pair1.fastq, SRR6958175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:08:48 2024 >> started Fri Dec 6 15:09:15 2024 >> done (27.255s) 23698091 read pairs processed; of these: 30837 ( 0.13%) short read pairs filtered out after trimming by size control 22483 ( 0.09%) empty read pairs filtered out after trimming by size control 23644771 (99.78%) read pairs available; of these: 8964349 (37.91%) trimmed read pairs available after processing 14680422 (62.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 13 0.00% 20 9 0.00% 21 10 0.00% 22 11 0.00% 23 12 0.00% 24 18 0.00% 25 15 0.00% 26 16 0.00% 27 14 0.00% 28 22 0.00% 29 27 0.00% 30 11 0.00% 31 19 0.00% 32 22 0.00% 33 24 0.00% 34 21 0.00% 35 15 0.00% 36 30 0.00% 37 21 0.00% 38 37 0.00% 39 32 0.00% 40 30 0.00% 41 39 0.00% 42 39 0.00% 43 37 0.00% 44 45 0.00% 45 44 0.00% 46 47 0.00% 47 58 0.00% 48 53 0.00% 49 79 0.00% 50 84 0.00% 51 92 0.00% 52 92 0.00% 53 107 0.00% 54 132 0.00% 55 141 0.00% 56 153 0.00% 57 158 0.00% 58 172 0.00% 59 222 0.00% 60 253 0.00% 61 294 0.00% 62 281 0.00% 63 309 0.00% 64 357 0.00% 65 362 0.00% 66 427 0.00% 67 487 0.00% 68 541 0.00% 69 630 0.00% 70 708 0.00% 71 884 0.00% 72 863 0.00% 73 1039 0.00% 74 1096 0.00% 75 1302 0.01% 76 1422 0.01% 77 1643 0.01% 78 1802 0.01% 79 1955 0.01% 80 2324 0.01% 81 2509 0.01% 82 2931 0.01% 83 3228 0.01% 84 5016 0.02% 85 6089 0.03% 86 6414 0.03% 87 6860 0.03% 88 7361 0.03% 89 7680 0.03% 90 8191 0.03% 91 8756 0.04% 92 9371 0.04% 93 10136 0.04% 94 10816 0.05% 95 11409 0.05% 96 12241 0.05% 97 12940 0.05% 98 13401 0.06% 99 14492 0.06% 100 15656 0.07% 101 16889 0.07% 102 18305 0.08% 103 19608 0.08% 104 20539 0.09% 105 21593 0.09% 106 22754 0.10% 107 23619 0.10% 108 24696 0.10% 109 26163 0.11% 110 27000 0.11% 111 29191 0.12% 112 30907 0.13% 113 32911 0.14% 114 35004 0.15% 115 36037 0.15% 116 37517 0.16% 117 38523 0.16% 118 39678 0.17% 119 40622 0.17% 120 42894 0.18% 121 44521 0.19% 122 46865 0.20% 123 49464 0.21% 124 52082 0.22% 125 53727 0.23% 126 55605 0.24% 127 56823 0.24% 128 57968 0.25% 129 59992 0.25% 130 61814 0.26% 131 64416 0.27% 132 67554 0.29% 133 71811 0.30% 134 74641 0.32% 135 77550 0.33% 136 79898 0.34% 137 82174 0.35% 138 85813 0.36% 139 90658 0.38% 140 95592 0.40% 141 102175 0.43% 142 110955 0.47% 143 121057 0.51% 144 136014 0.58% 145 156917 0.66% 146 188373 0.80% 147 242191 1.02% 148 352311 1.49% 149 687015 2.91% 150 4757220 20.12% 151 14680422 62.09% 23644771 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=23 prefix-density=0.28 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=71.14 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.8 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGACAAGGGCATCACAGA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=3.7 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=116.39 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=19.6 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR6958175 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:10:07 Started mapping on | Dec 06 15:10:08 Finished on | Dec 06 15:12:05 Mapping speed, Million of reads per hour | 727.53 Number of input reads | 23644771 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22917163 Uniquely mapped reads % | 96.92% Average mapped length | 295.23 Number of splices: Total | 25371764 Number of splices: Annotated (sjdb) | 23822795 Number of splices: GT/AG | 25028890 Number of splices: GC/AG | 289640 Number of splices: AT/AC | 13161 Number of splices: Non-canonical | 40073 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228421 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 14261 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.71% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 523366 523366 523366 N_multimapping 228421 228421 228421 N_noFeature 955267 22293335 1160898 N_ambiguous 502644 3350 86255 UnstrandedReadsAssigned:21459252 PositiveStrandReadsAssigned:620478 NegativeStrandReadsAssigned:21670010 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958175-trimmed-pair1.fastq SRR6958175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,644,771 reads, 21,693,383 reads pseudoaligned [quant] estimated average fragment length: 257.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR6958175.ke.tsv 35125 SRR6958175.se.tsv 88098 total ==> SRR6958175.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.995 109.069 11.1457 PNS24247 1044 787.603 31.1989 2.75261 PNS24249 1928 1671.6 90.7118 3.77088 PNS24246 1044 787.603 31.1989 2.75261 PNS24248 1044 787.603 31.1989 2.75261 PNS24244 1471 1214.6 48.6225 2.78174 PNS24243 293 92.6631 1 0.749904 KQK14069 1603 1346.6 626.944 32.352 KQK14071 474 235.204 9.0923 2.68622 ==> SRR6958175.se.tsv <== BRADI_1g14170v3 693 BRADI_1g53295v3 787 BRADI_1g59795v3 441 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 649 BRADI_1g74790v3 493 BRADI_1g09890v3 0 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR6958175 completed mapping pipeline successfully