Starting /dee2/code/volunteer_pipeline.sh SRR6958176 current disk space = 1550440222720 free memory = 1603828344 SRR6958176 SRAfilesize d0c0d02ea99c589648a2066911371432 SRR6958176.sra SRR6958176.sra file validated SRR6958176 is paired end SRR6958176 is conventional basespace SRR6958176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.768 18.0 18.0 31.0 18.0 32.0 2 29.735 30.0 27.0 33.0 27.0 33.0 3 30.2745 31.0 29.0 33.0 27.0 33.0 4 31.45125 33.0 31.0 33.0 29.0 33.0 5 32.1905 33.0 32.0 33.0 31.0 33.0 6 36.58175 38.0 37.0 38.0 34.0 38.0 7 37.19675 38.0 38.0 38.0 36.0 38.0 8 37.39175 38.0 38.0 38.0 37.0 38.0 9 37.3765 38.0 38.0 38.0 37.0 38.0 10-14 37.434000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.42425 38.0 38.0 38.0 37.2 38.0 20-24 37.512 38.0 38.0 38.0 37.4 38.0 25-29 37.3812 38.0 38.0 38.0 37.0 38.0 30-34 37.39595 38.0 38.0 38.0 37.0 38.0 35-39 37.283950000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.18814999999999 38.0 38.0 38.0 36.2 38.0 45-49 37.18545 38.0 38.0 38.0 36.2 38.0 50-54 37.2263 38.0 38.0 38.0 36.8 38.0 55-59 37.06570000000001 38.0 38.0 38.0 35.8 38.0 60-64 37.0108 38.0 38.0 38.0 35.6 38.0 65-69 37.0341 38.0 38.0 38.0 36.0 38.0 70-74 37.0981 38.0 38.0 38.0 36.0 38.0 75-79 36.950849999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.6322 38.0 38.0 38.0 34.4 38.0 85-89 36.649899999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.6302 38.0 38.0 38.0 34.4 38.0 95-99 36.58565 38.0 38.0 38.0 34.0 38.0 100-104 36.443799999999996 38.0 37.8 38.0 34.0 38.0 105-109 36.257099999999994 38.0 37.2 38.0 33.4 38.0 110-114 36.0017 38.0 37.0 38.0 32.4 38.0 115-119 35.9764 38.0 36.6 38.0 32.4 38.0 120-124 35.656499999999994 38.0 36.0 38.0 31.2 38.0 125-129 35.457499999999996 38.0 36.0 38.0 30.4 38.0 130-134 35.350049999999996 38.0 35.6 38.0 30.0 38.0 135-139 35.1377 38.0 35.0 38.0 28.4 38.0 140-144 34.75305 38.0 35.0 38.0 27.8 38.0 145-149 33.92184999999999 38.0 34.4 38.0 24.2 38.0 150-151 29.806375000000003 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 1.0 21 1.0 22 5.0 23 2.0 24 6.0 25 7.0 26 16.0 27 17.0 28 29.0 29 24.0 30 45.0 31 66.0 32 87.0 33 138.0 34 175.0 35 345.0 36 905.0 37 2123.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.161206448257932 18.096723868954758 7.098283931357255 44.64378575143006 2 19.81981981981982 13.663663663663664 34.234234234234236 32.28228228228228 3 17.175 16.475 27.55 38.800000000000004 4 22.575 26.200000000000003 21.0 30.225 5 23.817863397548162 28.19614711033275 26.26970227670753 21.71628721541156 6 22.900000000000002 33.925 21.925 21.25 7 18.5 25.75 38.025 17.724999999999998 8 18.5 26.075 30.3 25.124999999999996 9 19.55 22.25 33.525 24.675 10-14 21.98 27.800000000000004 25.575 24.645 15-19 21.709999999999997 26.22 26.71 25.36 20-24 21.884999999999998 26.75 26.229999999999997 25.135 25-29 21.455 27.005000000000003 25.85 25.69 30-34 21.834999999999997 26.795 26.455000000000002 24.915000000000003 35-39 21.73 26.555 26.009999999999998 25.705 40-44 22.015 26.584999999999997 26.205000000000002 25.195 45-49 22.145 26.25 25.91 25.695 50-54 22.295 26.58 25.869999999999997 25.255 55-59 22.134999999999998 26.43 25.52 25.915 60-64 22.57 25.895000000000003 25.83 25.705 65-69 22.125 26.064999999999998 26.334999999999997 25.474999999999998 70-74 22.314999999999998 26.71 25.165 25.81 75-79 22.5 25.905 25.595000000000002 26.0 80-84 22.25 25.85 26.085 25.814999999999998 85-89 22.425 26.13 25.82 25.624999999999996 90-94 22.814999999999998 25.8 25.785000000000004 25.6 95-99 22.465 26.085 25.61 25.840000000000003 100-104 22.509999999999998 25.790000000000003 26.369999999999997 25.330000000000002 105-109 22.54 24.92 26.474999999999998 26.064999999999998 110-114 22.975 26.185000000000002 25.635 25.205 115-119 22.935 25.874999999999996 25.435000000000002 25.755 120-124 22.36 25.865 25.69 26.085 125-129 23.11 25.275 25.94 25.674999999999997 130-134 23.04 25.61 25.814999999999998 25.535000000000004 135-139 22.975 25.3 25.595000000000002 26.13 140-144 23.39 25.355 25.979999999999997 25.275 145-149 23.419999999999998 25.81 25.169999999999998 25.6 150-151 23.867900925694272 24.993745308981737 24.993745308981737 26.144608456342254 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 3.5 30 12.0 31 15.0 32 13.0 33 23.0 34 42.0 35 51.0 36 62.0 37 86.0 38 104.0 39 123.0 40 144.5 41 155.0 42 179.0 43 210.0 44 223.0 45 215.5 46 210.0 47 222.5 48 213.5 49 196.0 50 173.0 51 135.5 52 120.5 53 107.0 54 99.0 55 98.0 56 83.0 57 70.5 58 69.0 59 71.5 60 58.5 61 45.5 62 41.5 63 41.0 64 42.5 65 33.5 66 31.5 67 29.5 68 24.0 69 24.5 70 19.5 71 17.5 72 18.5 73 13.5 74 8.0 75 8.0 76 4.5 77 2.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.1 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.85 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCGG 10 0.006582306 146.7848 145 >>END_MODULE SRR6958176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.945 33.0 33.0 34.0 32.0 34.0 2 32.86225 34.0 33.0 34.0 32.0 34.0 3 33.049 34.0 33.0 34.0 32.0 34.0 4 33.06025 34.0 33.0 34.0 32.0 34.0 5 33.05175 34.0 33.0 34.0 33.0 34.0 6 37.178 38.0 38.0 38.0 37.0 38.0 7 37.1405 38.0 38.0 38.0 37.0 38.0 8 37.07675 38.0 38.0 38.0 37.0 38.0 9 37.0735 38.0 38.0 38.0 36.0 38.0 10-14 36.9985 38.0 38.0 38.0 36.2 38.0 15-19 36.81915 38.0 38.0 38.0 36.0 38.0 20-24 36.95155 38.0 38.0 38.0 36.2 38.0 25-29 37.0239 38.0 38.0 38.0 36.6 38.0 30-34 37.03255 38.0 38.0 38.0 36.6 38.0 35-39 37.0404 38.0 38.0 38.0 37.0 38.0 40-44 36.97335 38.0 38.0 38.0 36.2 38.0 45-49 36.96705 38.0 38.0 38.0 36.0 38.0 50-54 36.86855 38.0 38.0 38.0 35.8 38.0 55-59 36.9377 38.0 38.0 38.0 36.0 38.0 60-64 36.86315 38.0 38.0 38.0 35.8 38.0 65-69 36.763 38.0 38.0 38.0 35.2 38.0 70-74 36.6553 38.0 38.0 38.0 34.6 38.0 75-79 36.447500000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.4485 38.0 38.0 38.0 34.2 38.0 85-89 36.330349999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.29665 38.0 38.0 38.0 33.8 38.0 95-99 36.24445 38.0 38.0 38.0 33.8 38.0 100-104 36.152750000000005 38.0 38.0 38.0 33.4 38.0 105-109 36.01355 38.0 37.4 38.0 32.8 38.0 110-114 35.68835 38.0 36.8 38.0 30.8 38.0 115-119 35.59075 38.0 36.4 38.0 31.0 38.0 120-124 35.4009 38.0 36.0 38.0 30.6 38.0 125-129 35.3709 38.0 36.0 38.0 30.6 38.0 130-134 34.918150000000004 38.0 35.2 38.0 28.4 38.0 135-139 34.59345 38.0 35.0 38.0 26.8 38.0 140-144 34.123000000000005 38.0 34.6 38.0 24.2 38.0 145-149 33.618449999999996 38.0 33.8 38.0 21.4 38.0 150-151 28.677500000000002 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 4.0 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 0.0 15 2.0 16 3.0 17 0.0 18 5.0 19 2.0 20 4.0 21 6.0 22 5.0 23 9.0 24 16.0 25 17.0 26 13.0 27 24.0 28 34.0 29 49.0 30 51.0 31 60.0 32 92.0 33 114.0 34 158.0 35 268.0 36 702.0 37 2344.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55863965991498 17.75443860965241 13.078269567391848 34.60865216304076 2 31.15778944736184 22.1055263815954 27.60690172543136 19.129782445611404 3 22.9057264316079 25.85646411602901 26.881720430107524 24.356089022255563 4 25.324999999999996 30.2 21.45 23.025000000000002 5 28.432108027006752 31.83295823955989 20.080020005001252 19.654913728432106 6 23.525 37.15 20.3 19.025 7 22.325 20.225 34.975 22.475 8 24.275 24.125 25.624999999999996 25.974999999999998 9 23.849999999999998 21.675 28.9 25.575 10-14 26.045 26.75 23.18 24.025 15-19 26.205000000000002 25.64 24.375 23.78 20-24 25.83 25.990000000000002 24.875 23.305 25-29 26.575 25.369999999999997 24.795 23.26 30-34 26.064999999999998 25.759999999999998 24.85 23.325000000000003 35-39 25.705 26.135 24.745 23.415 40-44 25.75 25.674999999999997 25.009999999999998 23.565 45-49 25.785000000000004 26.419999999999998 24.77 23.025000000000002 50-54 25.91 26.06 24.9 23.13 55-59 26.290000000000003 25.674999999999997 25.074999999999996 22.96 60-64 26.305 25.8 25.03 22.865 65-69 25.77 26.179999999999996 25.15 22.900000000000002 70-74 26.27 26.295 24.185000000000002 23.25 75-79 25.77 25.755 25.6 22.875 80-84 25.835 25.795 25.22 23.150000000000002 85-89 25.525 25.86 26.009999999999998 22.605 90-94 25.624999999999996 25.419999999999998 25.755 23.200000000000003 95-99 25.215 26.36 25.47 22.955000000000002 100-104 25.72 25.540000000000003 25.3 23.44 105-109 25.929999999999996 25.575 25.490000000000002 23.005 110-114 25.650000000000002 26.235000000000003 25.230000000000004 22.884999999999998 115-119 26.275 26.26 24.91 22.555 120-124 26.045 25.785000000000004 25.72 22.45 125-129 26.345000000000002 25.97 25.264999999999997 22.42 130-134 26.015 25.840000000000003 25.729999999999997 22.415 135-139 26.784999999999997 25.96 25.09 22.165000000000003 140-144 27.07 25.779999999999998 24.98 22.17 145-149 26.86 25.790000000000003 25.155 22.195 150-151 26.93846923461731 25.60030015007504 25.550275137568786 21.91095547773887 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.5 29 4.0 30 3.5 31 2.0 32 10.5 33 15.5 34 23.5 35 37.5 36 45.0 37 61.5 38 83.5 39 110.5 40 125.5 41 144.0 42 167.5 43 180.5 44 196.5 45 213.0 46 218.5 47 206.0 48 186.0 49 188.5 50 182.5 51 153.0 52 134.5 53 117.0 54 116.5 55 114.5 56 104.0 57 101.5 58 86.5 59 70.5 60 64.0 61 57.5 62 60.0 63 56.0 64 47.5 65 48.0 66 42.5 67 35.5 68 33.5 69 27.5 70 23.5 71 29.0 72 24.0 73 12.0 74 8.5 75 5.0 76 3.5 77 4.0 78 2.5 79 1.5 80 1.5 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCT 10 0.006830828 145.0 3 AAACATT 10 0.006830828 145.0 4 AGAACTT 10 0.006830828 145.0 1 AAAACAT 10 0.006830828 145.0 3 AACATTA 10 0.006830828 145.0 5 >>END_MODULE Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016691 spots for SRR6958176.sra Written 1016691 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra Read 1016681 spots for SRR6958176.sra Written 1016681 spots for SRR6958176.sra SRR ids: ['SRR6958176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y7v9cfh7 SRR6958176.sra spots: 20333630 blocks: [[1, 1016681], [1016682, 2033362], [2033363, 3050043], [3050044, 4066724], [4066725, 5083405], [5083406, 6100086], [6100087, 7116767], [7116768, 8133448], [8133449, 9150129], [9150130, 10166810], [10166811, 11183491], [11183492, 12200172], [12200173, 13216853], [13216854, 14233534], [14233535, 15250215], [15250216, 16266896], [16266897, 17283577], [17283578, 18300258], [18300259, 19316939], [19316940, 20333630]] SRR6958176 file size 6868699 SRR6958176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958176 SRR6958176_1.fastq SRR6958176_2.fastq Input file: SRR6958176_1.fastq Paired file: SRR6958176_2.fastq trimmed: SRR6958176-trimmed-pair1.fastq, SRR6958176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:09:08 2024 >> started Fri Dec 6 15:09:44 2024 >> done (36.261s) 20333630 read pairs processed; of these: 10229 ( 0.05%) short read pairs filtered out after trimming by size control 7814 ( 0.04%) empty read pairs filtered out after trimming by size control 20315587 (99.91%) read pairs available; of these: 7255251 (35.71%) trimmed read pairs available after processing 13060336 (64.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 6 0.00% 25 5 0.00% 26 1 0.00% 27 2 0.00% 28 4 0.00% 29 10 0.00% 30 7 0.00% 31 3 0.00% 32 4 0.00% 33 6 0.00% 34 5 0.00% 35 6 0.00% 36 6 0.00% 37 7 0.00% 38 7 0.00% 39 9 0.00% 40 7 0.00% 41 13 0.00% 42 11 0.00% 43 14 0.00% 44 19 0.00% 45 18 0.00% 46 15 0.00% 47 26 0.00% 48 20 0.00% 49 24 0.00% 50 26 0.00% 51 20 0.00% 52 36 0.00% 53 39 0.00% 54 43 0.00% 55 54 0.00% 56 49 0.00% 57 58 0.00% 58 56 0.00% 59 88 0.00% 60 85 0.00% 61 89 0.00% 62 111 0.00% 63 131 0.00% 64 166 0.00% 65 174 0.00% 66 195 0.00% 67 200 0.00% 68 237 0.00% 69 258 0.00% 70 290 0.00% 71 335 0.00% 72 387 0.00% 73 504 0.00% 74 536 0.00% 75 608 0.00% 76 685 0.00% 77 761 0.00% 78 844 0.00% 79 946 0.00% 80 1157 0.01% 81 1278 0.01% 82 1469 0.01% 83 1660 0.01% 84 2285 0.01% 85 2824 0.01% 86 3007 0.01% 87 3258 0.02% 88 3459 0.02% 89 3674 0.02% 90 3996 0.02% 91 4361 0.02% 92 4498 0.02% 93 5058 0.02% 94 5605 0.03% 95 5795 0.03% 96 6398 0.03% 97 7007 0.03% 98 7194 0.04% 99 7772 0.04% 100 8386 0.04% 101 8913 0.04% 102 9587 0.05% 103 10374 0.05% 104 11005 0.05% 105 11613 0.06% 106 12592 0.06% 107 13203 0.06% 108 14002 0.07% 109 15007 0.07% 110 15277 0.08% 111 16273 0.08% 112 17592 0.09% 113 18278 0.09% 114 19340 0.10% 115 20560 0.10% 116 21747 0.11% 117 22544 0.11% 118 24154 0.12% 119 25110 0.12% 120 26017 0.13% 121 27208 0.13% 122 28426 0.14% 123 29952 0.15% 124 31726 0.16% 125 32668 0.16% 126 34796 0.17% 127 36595 0.18% 128 38147 0.19% 129 39919 0.20% 130 41814 0.21% 131 44115 0.22% 132 45989 0.23% 133 48471 0.24% 134 50807 0.25% 135 53464 0.26% 136 56971 0.28% 137 59978 0.30% 138 62950 0.31% 139 67875 0.33% 140 72701 0.36% 141 77661 0.38% 142 86265 0.42% 143 94838 0.47% 144 108013 0.53% 145 127632 0.63% 146 162308 0.80% 147 209723 1.03% 148 324030 1.59% 149 662970 3.26% 150 4065628 20.01% 151 13060336 64.29% 20315587 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=6.40 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=4.0 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=56.26 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.4 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGACAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.59 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=3.7 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=31 fanout-score=61.44 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=10.5 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGGTGGACATCAGAAAGTATACTGTGTTTTACCACCCT SRR6958176 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:10:27 Started mapping on | Dec 06 15:10:27 Finished on | Dec 06 15:12:02 Mapping speed, Million of reads per hour | 769.85 Number of input reads | 20315587 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19891627 Uniquely mapped reads % | 97.91% Average mapped length | 296.93 Number of splices: Total | 21382412 Number of splices: Annotated (sjdb) | 20204537 Number of splices: GT/AG | 21108166 Number of splices: GC/AG | 235918 Number of splices: AT/AC | 8764 Number of splices: Non-canonical | 29564 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217780 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 12878 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 212800 212800 212800 N_multimapping 217780 217780 217780 N_noFeature 566846 19281514 715262 N_ambiguous 529404 2179 69744 UnstrandedReadsAssigned:18795377 PositiveStrandReadsAssigned:607934 NegativeStrandReadsAssigned:19106621 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958176-trimmed-pair1.fastq SRR6958176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,315,587 reads, 19,121,016 reads pseudoaligned [quant] estimated average fragment length: 249.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958176.ke.tsv 35125 SRR6958176.se.tsv 88098 total ==> SRR6958176.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.577 33.2859 3.38566 PNS24247 1044 795.232 56.0039 4.92527 PNS24249 1928 1679.23 60.9477 2.53835 PNS24246 1044 795.232 56.0039 4.92527 PNS24248 1044 795.232 56.0039 4.92527 PNS24244 1471 1222.23 73.7546 4.22028 PNS24243 293 86.111 0 0 KQK14069 1603 1354.23 2653.99 137.06 KQK14071 474 234.538 57.8851 17.2607 ==> SRR6958176.se.tsv <== BRADI_1g14170v3 3070 BRADI_1g53295v3 478 BRADI_1g59795v3 373 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 438 BRADI_1g74790v3 412 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 1 SRR6958176 completed mapping pipeline successfully