Starting /dee2/code/volunteer_pipeline.sh SRR6958177 current disk space = 1550463369216 free memory = 1601620688 SRR6958177 SRAfilesize 77b5e222f08154254ca1a8883ea9e024 SRR6958177.sra SRR6958177.sra file validated SRR6958177 is paired end SRR6958177 is conventional basespace SRR6958177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9935 32.0 18.0 33.0 18.0 33.0 2 24.18625 25.0 18.0 29.0 18.0 33.0 3 27.62275 29.0 27.0 31.0 18.0 33.0 4 29.2725 31.0 28.0 33.0 25.0 33.0 5 30.161 32.0 31.0 33.0 25.0 33.0 6 36.0205 37.0 36.0 38.0 33.0 38.0 7 36.73675 38.0 37.0 38.0 34.0 38.0 8 36.974 38.0 38.0 38.0 35.0 38.0 9 37.0335 38.0 38.0 38.0 36.0 38.0 10-14 37.03775 38.0 38.0 38.0 36.0 38.0 15-19 37.12125 38.0 38.0 38.0 36.0 38.0 20-24 37.055550000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.021699999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.91005 38.0 38.0 38.0 35.2 38.0 35-39 36.540049999999994 38.0 38.0 38.0 34.2 38.0 40-44 36.6877 38.0 38.0 38.0 34.6 38.0 45-49 36.481100000000005 38.0 38.0 38.0 33.4 38.0 50-54 36.098699999999994 38.0 37.4 38.0 32.0 38.0 55-59 36.105399999999996 38.0 37.2 38.0 32.4 38.0 60-64 36.6327 38.0 38.0 38.0 34.2 38.0 65-69 36.4183 38.0 37.8 38.0 33.6 38.0 70-74 35.7799 38.0 36.4 38.0 30.6 38.0 75-79 35.5943 38.0 36.2 38.0 29.8 38.0 80-84 35.75404999999999 38.0 36.6 38.0 31.0 38.0 85-89 35.9557 38.0 36.6 38.0 31.8 38.0 90-94 35.8238 38.0 36.6 38.0 31.4 38.0 95-99 34.794000000000004 38.0 35.0 38.0 26.0 38.0 100-104 34.598200000000006 38.0 34.8 38.0 25.2 38.0 105-109 33.932649999999995 38.0 34.0 38.0 22.2 38.0 110-114 34.19114999999999 38.0 34.2 38.0 23.8 38.0 115-119 33.4411 38.0 33.6 38.0 19.0 38.0 120-124 33.57899999999999 38.0 33.8 38.0 19.4 38.0 125-129 33.334649999999996 38.0 33.6 38.0 17.8 38.0 130-134 32.3791 36.6 31.8 38.0 15.8 38.0 135-139 31.790450000000003 36.0 30.6 38.0 14.0 38.0 140-144 29.863100000000003 34.8 25.8 38.0 10.8 38.0 145-149 27.71225 34.0 18.6 38.0 2.0 38.0 150-151 23.435499999999998 31.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 2.0 17 4.0 18 3.0 19 9.0 20 5.0 21 12.0 22 16.0 23 19.0 24 24.0 25 36.0 26 41.0 27 66.0 28 85.0 29 92.0 30 126.0 31 131.0 32 202.0 33 248.0 34 372.0 35 547.0 36 1007.0 37 946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.226859283039055 8.747993579454254 5.430711610486892 31.594435527019797 2 29.125 10.45 31.7 28.725 3 21.075 15.174999999999999 27.1 36.65 4 28.849999999999998 21.15 22.975 27.025 5 26.875 25.8 24.15 23.175 6 23.95 29.975 23.375 22.7 7 18.85 25.650000000000002 36.85 18.65 8 20.95 23.7 28.275 27.075 9 20.599999999999998 20.65 33.125 25.624999999999996 10-14 23.580000000000002 25.905 25.540000000000003 24.975 15-19 23.53 24.39 25.8 26.279999999999998 20-24 23.625 25.19 25.82 25.365 25-29 23.735 25.155 25.21 25.900000000000002 30-34 23.799999999999997 24.145 25.990000000000002 26.064999999999998 35-39 24.18 24.33 25.455 26.035000000000004 40-44 23.655 25.005 25.72 25.619999999999997 45-49 23.365 24.68 25.874999999999996 26.08 50-54 23.7 24.42 25.795 26.085 55-59 23.665 24.415 25.695 26.224999999999998 60-64 23.845 24.705 24.95 26.5 65-69 24.2 24.404999999999998 25.629999999999995 25.765 70-74 24.495 24.215 25.419999999999998 25.869999999999997 75-79 23.695 24.025 26.365 25.915 80-84 24.07 24.884999999999998 25.305 25.740000000000002 85-89 24.375 24.115000000000002 25.52 25.990000000000002 90-94 24.005000000000003 24.435000000000002 25.735000000000003 25.825 95-99 24.575 24.224999999999998 25.21 25.990000000000002 100-104 24.285 24.42 25.319999999999997 25.974999999999998 105-109 24.11 24.335 25.83 25.724999999999998 110-114 23.97 23.865 25.885 26.279999999999998 115-119 23.830000000000002 24.72 25.095 26.355 120-124 24.235 24.51 25.495 25.759999999999998 125-129 23.945 24.154999999999998 25.4 26.5 130-134 24.465 23.94 26.025 25.569999999999997 135-139 24.16 24.14 25.430000000000003 26.27 140-144 24.05 24.099999999999998 25.635 26.215 145-149 24.345 24.295 25.77 25.590000000000003 150-151 24.85 24.625 24.2 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 1.0 28 2.0 29 2.0 30 3.0 31 5.5 32 6.5 33 12.0 34 19.5 35 30.0 36 46.5 37 54.0 38 62.0 39 84.0 40 109.0 41 133.0 42 152.0 43 183.0 44 188.5 45 189.0 46 204.0 47 202.0 48 194.5 49 172.0 50 169.0 51 174.0 52 152.5 53 132.5 54 113.0 55 91.0 56 99.0 57 101.0 58 87.0 59 87.0 60 91.0 61 87.5 62 75.5 63 62.0 64 62.0 65 64.0 66 50.5 67 40.5 68 35.5 69 32.5 70 32.5 71 26.5 72 24.0 73 22.0 74 13.0 75 6.5 76 3.5 77 2.5 78 3.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.550000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.5558362809499747 1.0999999999999999 3 0.17685699848408287 0.525 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTA 10 0.0068396386 144.9375 5 CAGTAAG 10 0.0068396386 144.9375 8 TTTTATC 10 0.0068396386 144.9375 4 TCAGTAA 10 0.0068396386 144.9375 7 >>END_MODULE SRR6958177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23125 33.0 33.0 34.0 31.0 34.0 2 32.1655 33.0 33.0 34.0 30.0 34.0 3 32.38275 33.0 33.0 34.0 31.0 34.0 4 32.0075 33.0 33.0 34.0 30.0 34.0 5 32.213 33.0 33.0 34.0 31.0 34.0 6 35.47025 38.0 37.0 38.0 29.0 38.0 7 35.81075 38.0 37.0 38.0 31.0 38.0 8 35.94275 38.0 37.0 38.0 31.0 38.0 9 36.1765 38.0 38.0 38.0 33.0 38.0 10-14 36.05030000000001 38.0 38.0 38.0 32.2 38.0 15-19 36.346999999999994 38.0 38.0 38.0 33.6 38.0 20-24 36.50465 38.0 38.0 38.0 34.4 38.0 25-29 36.51365 38.0 38.0 38.0 34.2 38.0 30-34 36.22095 38.0 38.0 38.0 33.4 38.0 35-39 36.268800000000006 38.0 38.0 38.0 33.8 38.0 40-44 36.087149999999994 38.0 38.0 38.0 32.8 38.0 45-49 36.03645 38.0 37.8 38.0 32.6 38.0 50-54 36.011750000000006 38.0 37.4 38.0 32.4 38.0 55-59 35.95215 38.0 37.2 38.0 32.2 38.0 60-64 35.6716 38.0 37.0 38.0 30.6 38.0 65-69 35.6744 38.0 37.0 38.0 30.0 38.0 70-74 35.45655 38.0 36.8 38.0 29.2 38.0 75-79 35.30535 38.0 36.2 38.0 29.0 38.0 80-84 35.2138 38.0 36.0 38.0 29.0 38.0 85-89 35.0912 38.0 36.0 38.0 28.4 38.0 90-94 34.86725 38.0 35.6 38.0 27.4 38.0 95-99 34.5403 38.0 35.0 38.0 25.2 38.0 100-104 33.6776 38.0 34.0 38.0 18.2 38.0 105-109 33.6144 38.0 34.0 38.0 19.0 38.0 110-114 33.34135 38.0 34.0 38.0 16.2 38.0 115-119 32.6383 37.6 32.2 38.0 15.0 38.0 120-124 32.50385 37.4 32.4 38.0 14.8 38.0 125-129 32.257549999999995 37.4 32.2 38.0 14.6 38.0 130-134 31.55745 36.4 30.6 38.0 13.8 38.0 135-139 30.476300000000002 36.0 28.4 38.0 12.8 38.0 140-144 29.9655 35.0 28.0 38.0 10.8 38.0 145-149 27.9398 33.8 20.8 38.0 2.0 38.0 150-151 22.189 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 9.0 4 0.0 5 2.0 6 3.0 7 3.0 8 0.0 9 3.0 10 2.0 11 3.0 12 2.0 13 4.0 14 3.0 15 12.0 16 4.0 17 10.0 18 10.0 19 15.0 20 15.0 21 15.0 22 25.0 23 29.0 24 36.0 25 39.0 26 44.0 27 65.0 28 61.0 29 101.0 30 119.0 31 142.0 32 171.0 33 195.0 34 323.0 35 525.0 36 876.0 37 1122.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.52026013006503 19.559779889944974 10.25512756378189 29.664832416208103 2 29.375 24.275 24.85 21.5 3 23.200000000000003 25.174999999999997 27.35 24.275 4 26.0 30.475 20.424999999999997 23.1 5 26.6 32.9 18.95 21.55 6 23.3 35.75 19.675 21.275 7 23.799999999999997 19.2 33.0 24.0 8 23.925 23.5 23.275000000000002 29.299999999999997 9 24.95 23.400000000000002 25.75 25.900000000000002 10-14 25.985000000000003 25.995 22.705000000000002 25.314999999999998 15-19 26.495 25.345000000000002 23.865 24.295 20-24 25.755 25.965 23.825 24.455 25-29 25.745 25.535000000000004 23.635 25.085 30-34 25.990000000000002 25.080000000000002 23.77 25.16 35-39 26.340000000000003 25.25 23.630000000000003 24.779999999999998 40-44 26.165 25.515 23.724999999999998 24.595 45-49 26.174999999999997 25.5 23.755000000000003 24.57 50-54 26.325 24.64 23.990000000000002 25.045 55-59 25.955000000000002 24.775 24.060000000000002 25.21 60-64 26.534999999999997 24.715 24.19 24.560000000000002 65-69 25.91 25.44 23.549999999999997 25.1 70-74 26.16 25.305 23.72 24.815 75-79 26.235000000000003 24.759999999999998 23.97 25.035 80-84 26.029999999999998 24.73 24.555 24.685000000000002 85-89 26.545 24.37 24.23 24.855 90-94 26.27 25.215 24.05 24.465 95-99 26.575 25.1 23.84 24.485 100-104 26.96 24.709999999999997 23.630000000000003 24.7 105-109 25.419999999999998 25.66 24.775 24.145 110-114 26.43 25.61 23.5 24.46 115-119 26.490000000000002 24.81 23.794999999999998 24.905 120-124 26.66 25.619999999999997 23.995 23.724999999999998 125-129 26.06 25.119999999999997 24.125 24.695 130-134 26.87 24.965 24.044999999999998 24.12 135-139 26.515 24.785 24.775 23.925 140-144 26.985 26.075 23.669999999999998 23.27 145-149 26.619999999999997 25.290000000000003 23.7 24.39 150-151 26.5375 25.0 25.174999999999997 23.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 2.0 29 2.5 30 3.0 31 4.0 32 6.5 33 9.5 34 11.5 35 20.0 36 31.5 37 45.5 38 60.0 39 71.0 40 92.0 41 125.5 42 157.0 43 170.0 44 182.5 45 194.5 46 197.0 47 191.5 48 183.5 49 178.0 50 165.0 51 144.0 52 133.0 53 132.0 54 122.5 55 108.5 56 99.0 57 97.5 58 93.5 59 88.0 60 84.0 61 94.0 62 96.0 63 83.0 64 70.5 65 62.0 66 69.0 67 61.0 68 50.0 69 54.5 70 41.0 71 30.0 72 26.5 73 17.0 74 11.0 75 8.0 76 8.0 77 5.0 78 2.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70030581039755 96.825 2 1.019367991845056 2.0 3 0.1529051987767584 0.44999999999999996 4 0.05096839959225281 0.2 5 0.0 0.0 6 0.025484199796126403 0.15 7 0.025484199796126403 0.17500000000000002 8 0.025484199796126403 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 8 0.2 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit GTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199551 spots for SRR6958177.sra Written 1199551 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra Read 1199547 spots for SRR6958177.sra Written 1199547 spots for SRR6958177.sra SRR ids: ['SRR6958177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dhm1rxhw SRR6958177.sra spots: 23990944 blocks: [[1, 1199547], [1199548, 2399094], [2399095, 3598641], [3598642, 4798188], [4798189, 5997735], [5997736, 7197282], [7197283, 8396829], [8396830, 9596376], [9596377, 10795923], [10795924, 11995470], [11995471, 13195017], [13195018, 14394564], [14394565, 15594111], [15594112, 16793658], [16793659, 17993205], [17993206, 19192752], [19192753, 20392299], [20392300, 21591846], [21591847, 22791393], [22791394, 23990944]] SRR6958177 file size 8108043 SRR6958177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958177 SRR6958177_1.fastq SRR6958177_2.fastq Input file: SRR6958177_1.fastq Paired file: SRR6958177_2.fastq trimmed: SRR6958177-trimmed-pair1.fastq, SRR6958177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:12:16 2024 >> started Fri Dec 6 15:12:43 2024 >> done (27.246s) 23990944 read pairs processed; of these: 42307 ( 0.18%) short read pairs filtered out after trimming by size control 31689 ( 0.13%) empty read pairs filtered out after trimming by size control 23916948 (99.69%) read pairs available; of these: 11652817 (48.72%) trimmed read pairs available after processing 12264131 (51.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 5 0.00% 22 1 0.00% 23 6 0.00% 24 16 0.00% 25 12 0.00% 26 10 0.00% 27 10 0.00% 28 4 0.00% 29 6 0.00% 30 20 0.00% 31 18 0.00% 32 14 0.00% 33 15 0.00% 34 18 0.00% 35 23 0.00% 36 18 0.00% 37 28 0.00% 38 28 0.00% 39 30 0.00% 40 27 0.00% 41 29 0.00% 42 27 0.00% 43 55 0.00% 44 50 0.00% 45 43 0.00% 46 54 0.00% 47 53 0.00% 48 70 0.00% 49 63 0.00% 50 89 0.00% 51 98 0.00% 52 99 0.00% 53 119 0.00% 54 114 0.00% 55 142 0.00% 56 133 0.00% 57 171 0.00% 58 146 0.00% 59 207 0.00% 60 236 0.00% 61 251 0.00% 62 287 0.00% 63 263 0.00% 64 338 0.00% 65 336 0.00% 66 419 0.00% 67 397 0.00% 68 482 0.00% 69 532 0.00% 70 562 0.00% 71 637 0.00% 72 733 0.00% 73 812 0.00% 74 879 0.00% 75 960 0.00% 76 1089 0.00% 77 1148 0.00% 78 1287 0.01% 79 1487 0.01% 80 1647 0.01% 81 1822 0.01% 82 2137 0.01% 83 2456 0.01% 84 4193 0.02% 85 5083 0.02% 86 5167 0.02% 87 5471 0.02% 88 5624 0.02% 89 5871 0.02% 90 6120 0.03% 91 6203 0.03% 92 6414 0.03% 93 6853 0.03% 94 7332 0.03% 95 7860 0.03% 96 8328 0.03% 97 8817 0.04% 98 9126 0.04% 99 9808 0.04% 100 10351 0.04% 101 10875 0.05% 102 11338 0.05% 103 12470 0.05% 104 13071 0.05% 105 13784 0.06% 106 14886 0.06% 107 15518 0.06% 108 16358 0.07% 109 17627 0.07% 110 18321 0.08% 111 19595 0.08% 112 20664 0.09% 113 21909 0.09% 114 23392 0.10% 115 24703 0.10% 116 26187 0.11% 117 27501 0.11% 118 28566 0.12% 119 29969 0.13% 120 31372 0.13% 121 33033 0.14% 122 34809 0.15% 123 37266 0.16% 124 39730 0.17% 125 42106 0.18% 126 44023 0.18% 127 47162 0.20% 128 49722 0.21% 129 53010 0.22% 130 55868 0.23% 131 59333 0.25% 132 63980 0.27% 133 67843 0.28% 134 72379 0.30% 135 78264 0.33% 136 83291 0.35% 137 88622 0.37% 138 95926 0.40% 139 106036 0.44% 140 116350 0.49% 141 129034 0.54% 142 147463 0.62% 143 170407 0.71% 144 201007 0.84% 145 248835 1.04% 146 315268 1.32% 147 435385 1.82% 148 674089 2.82% 149 1337053 5.59% 150 6185512 25.86% 151 12264131 51.28% 23916948 reads passed initial QC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=19 prefix-density=1.09 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=32.85 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=14 prefix-density=0.73 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=383.24 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=14.8 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958177 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:13:39 Started mapping on | Dec 06 15:13:40 Finished on | Dec 06 15:16:20 Mapping speed, Million of reads per hour | 538.13 Number of input reads | 23916948 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22929003 Uniquely mapped reads % | 95.87% Average mapped length | 295.57 Number of splices: Total | 26481563 Number of splices: Annotated (sjdb) | 24955129 Number of splices: GT/AG | 26125077 Number of splices: GC/AG | 305557 Number of splices: AT/AC | 8720 Number of splices: Non-canonical | 42209 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226623 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 8141 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785571 785571 785571 N_multimapping 226623 226623 226623 N_noFeature 565964 22216933 718249 N_ambiguous 643740 2937 84714 UnstrandedReadsAssigned:21719299 PositiveStrandReadsAssigned:709133 NegativeStrandReadsAssigned:22126040 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958177-trimmed-pair1.fastq SRR6958177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,916,948 reads, 22,077,455 reads pseudoaligned [quant] estimated average fragment length: 268.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958177.ke.tsv 35125 SRR6958177.se.tsv 88098 total ==> SRR6958177.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.856 0 0 PNS24247 1044 776.281 56.0563 4.70026 PNS24249 1928 1660.28 62.1327 2.43587 PNS24246 1044 776.281 56.0563 4.70026 PNS24248 1044 776.281 56.0563 4.70026 PNS24244 1471 1203.28 45.6983 2.472 PNS24243 293 79.8602 0 0 KQK14069 1603 1335.28 7008.63 341.646 KQK14071 474 220.181 83.4268 24.6627 ==> SRR6958177.se.tsv <== BRADI_1g14170v3 7634 BRADI_1g53295v3 862 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 393 BRADI_1g74790v3 87 BRADI_1g09890v3 1 BRADI_1g77505v3 219 BRADI_1g48960v3 0 SRR6958177 completed mapping pipeline successfully