Starting /dee2/code/volunteer_pipeline.sh SRR6958178 current disk space = 1550383468544 free memory = 1599678968 SRR6958178 SRAfilesize c3d459ae6b88d4c92f954e77418e42c3 SRR6958178.sra SRR6958178.sra file validated SRR6958178 is paired end SRR6958178 is conventional basespace SRR6958178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.0485 18.0 18.0 25.0 18.0 32.0 2 27.47025 29.0 25.0 31.0 18.0 33.0 3 29.87575 31.0 28.0 33.0 27.0 33.0 4 32.079 33.0 32.0 33.0 32.0 33.0 5 31.503 33.0 32.0 33.0 30.0 33.0 6 36.24525 38.0 36.0 38.0 33.0 38.0 7 37.151 38.0 38.0 38.0 36.0 38.0 8 37.2295 38.0 38.0 38.0 36.0 38.0 9 37.3665 38.0 38.0 38.0 37.0 38.0 10-14 37.26965 38.0 38.0 38.0 36.6 38.0 15-19 37.31515 38.0 38.0 38.0 36.6 38.0 20-24 36.67055 38.0 37.8 38.0 34.0 38.0 25-29 36.856700000000004 38.0 38.0 38.0 35.0 38.0 30-34 37.16265 38.0 38.0 38.0 36.4 38.0 35-39 37.3288 38.0 38.0 38.0 37.0 38.0 40-44 37.308899999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.260000000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.05805 38.0 38.0 38.0 36.0 38.0 55-59 36.962450000000004 38.0 38.0 38.0 35.4 38.0 60-64 37.1342 38.0 38.0 38.0 36.0 38.0 65-69 37.16325 38.0 38.0 38.0 36.0 38.0 70-74 37.173950000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.1514 38.0 38.0 38.0 36.2 38.0 80-84 37.0292 38.0 38.0 38.0 36.0 38.0 85-89 36.55385 38.0 38.0 38.0 34.2 38.0 90-94 36.09734999999999 38.0 37.4 38.0 33.0 38.0 95-99 35.124399999999994 38.0 36.0 38.0 27.0 38.0 100-104 34.93485 38.0 35.6 38.0 25.6 38.0 105-109 34.899800000000006 38.0 35.4 38.0 25.8 38.0 110-114 35.34495 38.0 36.0 38.0 28.6 38.0 115-119 35.71385 38.0 36.6 38.0 31.2 38.0 120-124 35.9674 38.0 37.0 38.0 32.6 38.0 125-129 35.9842 38.0 36.8 38.0 32.8 38.0 130-134 35.75675 38.0 36.2 38.0 32.4 38.0 135-139 35.4308 38.0 36.0 38.0 31.4 38.0 140-144 34.57785 38.0 34.6 38.0 27.0 38.0 145-149 32.61775 38.0 32.2 38.0 19.2 38.0 150-151 28.551375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 3.0 19 1.0 20 2.0 21 2.0 22 5.0 23 5.0 24 6.0 25 9.0 26 17.0 27 25.0 28 33.0 29 56.0 30 63.0 31 75.0 32 127.0 33 145.0 34 224.0 35 379.0 36 854.0 37 1961.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.49695964621338 12.161415146489773 8.9828634604754 39.35876174682144 2 24.099999999999998 13.375 32.25 30.275000000000002 3 22.1 17.05 23.825 37.025000000000006 4 28.075 23.549999999999997 20.9 27.474999999999998 5 25.4 28.625 23.5 22.475 6 21.825 32.475 23.625 22.075 7 17.075000000000003 24.25 39.75 18.925 8 21.175 23.05 29.325000000000003 26.450000000000003 9 20.525 21.349999999999998 32.975 25.15 10-14 22.71 26.125 25.71 25.455 15-19 22.732273227322732 25.197519751975193 26.432643264326433 25.637563756375638 20-24 22.73 25.505 26.86 24.905 25-29 22.64 25.455 26.395000000000003 25.509999999999998 30-34 23.275000000000002 25.3 25.66 25.765 35-39 23.06 25.874999999999996 25.555 25.509999999999998 40-44 23.05 24.855 26.545 25.55 45-49 22.875 25.195 26.155 25.775 50-54 23.27 25.545 26.1 25.085 55-59 23.665 24.709999999999997 25.56 26.064999999999998 60-64 22.96 24.825 26.540000000000003 25.674999999999997 65-69 23.150000000000002 25.155 25.555 26.14 70-74 23.119999999999997 25.64 25.715 25.525 75-79 23.535 25.3 25.845000000000002 25.319999999999997 80-84 23.369999999999997 24.995 25.555 26.08 85-89 23.46 25.28 25.085 26.174999999999997 90-94 23.400000000000002 25.405 25.595000000000002 25.6 95-99 23.91 24.83 25.569999999999997 25.69 100-104 23.935000000000002 25.665 25.240000000000002 25.16 105-109 23.48 25.64 25.195 25.685000000000002 110-114 23.625 25.259999999999998 25.45 25.665 115-119 23.34 25.55 25.014999999999997 26.095000000000002 120-124 23.46 25.074999999999996 25.555 25.91 125-129 23.765 25.580000000000002 25.305 25.35 130-134 24.16 25.525 24.779999999999998 25.535000000000004 135-139 23.575 25.419999999999998 25.455 25.55 140-144 24.34 25.505 24.884999999999998 25.27 145-149 23.43 25.655 25.305 25.61 150-151 24.85 24.9 24.8125 25.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 4.0 29 4.5 30 6.0 31 12.5 32 18.5 33 17.0 34 19.5 35 33.0 36 49.5 37 66.0 38 79.0 39 97.0 40 122.0 41 154.0 42 169.0 43 183.0 44 207.0 45 208.0 46 197.0 47 199.5 48 190.0 49 175.0 50 176.0 51 161.0 52 145.0 53 129.0 54 117.5 55 116.0 56 104.0 57 93.5 58 88.5 59 74.5 60 65.5 61 68.5 62 68.0 63 62.5 64 51.5 65 44.0 66 46.0 67 38.0 68 28.5 69 25.0 70 19.0 71 14.5 72 12.0 73 12.0 74 11.0 75 5.5 76 3.0 77 3.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1375 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.137499999999999 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 6.737500000000001 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 7.7625 0.0 0.0 0.0 0.0 138-139 8.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTGAT 10 0.0056249425 154.6 1 ACCTCTG 10 0.0068396386 144.9375 9 >>END_MODULE SRR6958178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7895 33.0 33.0 34.0 32.0 34.0 2 32.84475 33.0 33.0 34.0 32.0 34.0 3 32.91175 33.0 33.0 34.0 32.0 34.0 4 32.86575 34.0 33.0 34.0 32.0 34.0 5 32.96 34.0 33.0 34.0 32.0 34.0 6 36.96175 38.0 38.0 38.0 36.0 38.0 7 36.9795 38.0 38.0 38.0 36.0 38.0 8 36.938 38.0 38.0 38.0 35.0 38.0 9 36.82075 38.0 38.0 38.0 35.0 38.0 10-14 36.57185 38.0 38.0 38.0 34.4 38.0 15-19 36.4642 38.0 38.0 38.0 34.2 38.0 20-24 36.65480000000001 38.0 38.0 38.0 34.8 38.0 25-29 36.77335000000001 38.0 38.0 38.0 35.2 38.0 30-34 37.018600000000006 38.0 38.0 38.0 36.0 38.0 35-39 37.06305 38.0 38.0 38.0 36.0 38.0 40-44 36.968599999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.82405 38.0 38.0 38.0 35.6 38.0 50-54 36.469550000000005 38.0 38.0 38.0 34.0 38.0 55-59 36.4513 38.0 38.0 38.0 33.8 38.0 60-64 36.670899999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.25455 38.0 38.0 38.0 33.6 38.0 70-74 36.1577 38.0 38.0 38.0 33.0 38.0 75-79 35.9051 38.0 37.8 38.0 31.6 38.0 80-84 35.62125 38.0 37.4 38.0 30.0 38.0 85-89 35.4559 38.0 37.0 38.0 29.0 38.0 90-94 35.963899999999995 38.0 37.6 38.0 32.4 38.0 95-99 36.15325 38.0 38.0 38.0 33.4 38.0 100-104 36.1334 38.0 37.8 38.0 33.4 38.0 105-109 35.938550000000006 38.0 37.6 38.0 32.6 38.0 110-114 35.67659999999999 38.0 37.0 38.0 31.2 38.0 115-119 35.33225 38.0 36.4 38.0 29.8 38.0 120-124 33.7708 37.8 34.0 38.0 21.2 38.0 125-129 33.2816 38.0 32.8 38.0 19.0 38.0 130-134 27.660249999999998 30.2 18.4 36.4 13.6 38.0 135-139 33.2157 37.8 32.4 38.0 20.0 38.0 140-144 33.523 38.0 33.0 38.0 21.4 38.0 145-149 32.527100000000004 38.0 33.0 38.0 12.0 38.0 150-151 27.253999999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 10.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 4.0 13 0.0 14 5.0 15 3.0 16 1.0 17 3.0 18 5.0 19 4.0 20 8.0 21 7.0 22 13.0 23 21.0 24 24.0 25 28.0 26 26.0 27 39.0 28 45.0 29 64.0 30 74.0 31 106.0 32 129.0 33 145.0 34 254.0 35 402.0 36 832.0 37 1742.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 17.974999999999998 12.425 32.725 2 29.175 23.400000000000002 27.500000000000004 19.925 3 22.0 25.95 29.15 22.900000000000002 4 27.1 29.625 20.65 22.625 5 27.175 32.125 19.425 21.275 6 22.6 35.85 20.9 20.65 7 23.625 18.95 34.9 22.525000000000002 8 24.05 23.225 24.55 28.175 9 23.5 22.425 27.950000000000003 26.125 10-14 25.345000000000002 26.534999999999997 23.815 24.305 15-19 25.305 25.94 24.89 23.865 20-24 26.075 25.44 24.474999999999998 24.01 25-29 25.44 25.045 25.055 24.46 30-34 25.545 25.580000000000002 24.85 24.025 35-39 25.855 25.955000000000002 24.16 24.03 40-44 26.395000000000003 25.0 24.474999999999998 24.13 45-49 26.1 24.959999999999997 25.019999999999996 23.919999999999998 50-54 26.229999999999997 26.02 24.055 23.695 55-59 25.905 25.52 24.435000000000002 24.14 60-64 25.845000000000002 25.355 24.86 23.94 65-69 26.31 25.39 24.585 23.715 70-74 25.94 25.525 24.995 23.54 75-79 25.7 25.69 24.845 23.765 80-84 26.105 25.22 24.77 23.905 85-89 25.929999999999996 25.91 24.474999999999998 23.685000000000002 90-94 25.735000000000003 25.36 24.775 24.13 95-99 25.885 25.629999999999995 24.64 23.845 100-104 26.31 26.005 24.16 23.525 105-109 26.284999999999997 25.595000000000002 24.610000000000003 23.51 110-114 26.25 26.41 24.310000000000002 23.03 115-119 26.5 26.105 23.925 23.47 120-124 26.83 26.5 24.16 22.509999999999998 125-129 26.91 26.33 24.525 22.235 130-134 27.22 26.384999999999998 24.4 21.995 135-139 27.22 26.290000000000003 23.87 22.62 140-144 27.715 25.869999999999997 24.165 22.25 145-149 27.66 25.82 24.38 22.14 150-151 28.549999999999997 25.9875 23.9875 21.475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 1.0 27 1.0 28 3.5 29 5.5 30 9.5 31 11.5 32 12.0 33 17.0 34 22.0 35 31.5 36 36.5 37 46.5 38 69.5 39 91.0 40 118.5 41 138.0 42 159.5 43 170.0 44 174.0 45 184.0 46 199.0 47 217.5 48 194.5 49 170.0 50 166.0 51 155.5 52 133.5 53 110.0 54 115.0 55 128.0 56 114.0 57 93.5 58 89.0 59 92.5 60 88.0 61 84.5 62 89.0 63 73.0 64 59.5 65 58.5 66 49.5 67 45.5 68 39.0 69 29.0 70 25.0 71 23.0 72 17.5 73 10.0 74 6.5 75 6.0 76 4.5 77 2.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06447534766119 97.95 2 0.7838179519595448 1.55 3 0.1011378002528445 0.3 4 0.05056890012642225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.05 0.0 0.0 0.0 0.0 128-129 5.3 0.0 0.0 0.0 0.0 130-131 5.5625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.512499999999999 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138-139 7.675000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra Read 1228193 spots for SRR6958178.sra Written 1228193 spots for SRR6958178.sra SRR ids: ['SRR6958178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y76uwosp SRR6958178.sra spots: 24563860 blocks: [[1, 1228193], [1228194, 2456386], [2456387, 3684579], [3684580, 4912772], [4912773, 6140965], [6140966, 7369158], [7369159, 8597351], [8597352, 9825544], [9825545, 11053737], [11053738, 12281930], [12281931, 13510123], [13510124, 14738316], [14738317, 15966509], [15966510, 17194702], [17194703, 18422895], [18422896, 19651088], [19651089, 20879281], [20879282, 22107474], [22107475, 23335667], [23335668, 24563860]] SRR6958178 file size 8302185 SRR6958178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958178 SRR6958178_1.fastq SRR6958178_2.fastq Input file: SRR6958178_1.fastq Paired file: SRR6958178_2.fastq trimmed: SRR6958178-trimmed-pair1.fastq, SRR6958178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:14:22 2024 >> started Fri Dec 6 15:14:49 2024 >> done (26.606s) 24563860 read pairs processed; of these: 18297 ( 0.07%) short read pairs filtered out after trimming by size control 15599 ( 0.06%) empty read pairs filtered out after trimming by size control 24529964 (99.86%) read pairs available; of these: 10101035 (41.18%) trimmed read pairs available after processing 14428929 (58.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 2 0.00% 21 4 0.00% 22 5 0.00% 23 8 0.00% 24 7 0.00% 25 8 0.00% 26 4 0.00% 27 9 0.00% 28 9 0.00% 29 8 0.00% 30 8 0.00% 31 12 0.00% 32 13 0.00% 33 8 0.00% 34 7 0.00% 35 13 0.00% 36 12 0.00% 37 18 0.00% 38 34 0.00% 39 20 0.00% 40 26 0.00% 41 33 0.00% 42 31 0.00% 43 36 0.00% 44 36 0.00% 45 41 0.00% 46 48 0.00% 47 60 0.00% 48 70 0.00% 49 78 0.00% 50 97 0.00% 51 107 0.00% 52 136 0.00% 53 141 0.00% 54 159 0.00% 55 178 0.00% 56 189 0.00% 57 232 0.00% 58 310 0.00% 59 309 0.00% 60 414 0.00% 61 433 0.00% 62 491 0.00% 63 576 0.00% 64 709 0.00% 65 777 0.00% 66 848 0.00% 67 968 0.00% 68 1081 0.00% 69 1313 0.01% 70 1412 0.01% 71 1682 0.01% 72 1959 0.01% 73 2387 0.01% 74 2556 0.01% 75 2945 0.01% 76 3206 0.01% 77 3667 0.01% 78 4236 0.02% 79 4767 0.02% 80 5364 0.02% 81 6030 0.02% 82 6702 0.03% 83 7675 0.03% 84 9227 0.04% 85 10446 0.04% 86 11161 0.05% 87 11875 0.05% 88 12969 0.05% 89 13675 0.06% 90 14761 0.06% 91 15888 0.06% 92 17476 0.07% 93 18537 0.08% 94 20424 0.08% 95 21184 0.09% 96 22375 0.09% 97 23854 0.10% 98 24799 0.10% 99 26254 0.11% 100 27540 0.11% 101 29170 0.12% 102 30935 0.13% 103 32982 0.13% 104 34088 0.14% 105 35236 0.14% 106 36934 0.15% 107 38172 0.16% 108 39604 0.16% 109 41367 0.17% 110 42375 0.17% 111 44177 0.18% 112 46214 0.19% 113 47648 0.19% 114 49785 0.20% 115 51407 0.21% 116 53486 0.22% 117 54772 0.22% 118 55527 0.23% 119 57169 0.23% 120 58169 0.24% 121 59637 0.24% 122 61782 0.25% 123 63476 0.26% 124 66476 0.27% 125 68225 0.28% 126 69887 0.28% 127 71855 0.29% 128 72837 0.30% 129 74977 0.31% 130 76625 0.31% 131 78844 0.32% 132 81494 0.33% 133 84517 0.34% 134 87398 0.36% 135 91045 0.37% 136 94011 0.38% 137 97635 0.40% 138 100871 0.41% 139 106570 0.43% 140 111731 0.46% 141 118223 0.48% 142 128890 0.53% 143 140314 0.57% 144 156144 0.64% 145 179106 0.73% 146 214915 0.88% 147 282176 1.15% 148 412575 1.68% 149 777454 3.17% 150 4824946 19.67% 151 14428929 58.82% 24529964 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=29.62 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=53.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958178 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:15:32 Started mapping on | Dec 06 15:15:32 Finished on | Dec 06 15:18:21 Mapping speed, Million of reads per hour | 522.53 Number of input reads | 24529964 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 23826737 Uniquely mapped reads % | 97.13% Average mapped length | 293.11 Number of splices: Total | 27692598 Number of splices: Annotated (sjdb) | 26105402 Number of splices: GT/AG | 27318752 Number of splices: GC/AG | 329641 Number of splices: AT/AC | 10517 Number of splices: Non-canonical | 33688 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223261 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 18073 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490841 490841 490841 N_multimapping 223261 223261 223261 N_noFeature 755315 23157156 940552 N_ambiguous 573604 2777 91988 UnstrandedReadsAssigned:22497818 PositiveStrandReadsAssigned:666804 NegativeStrandReadsAssigned:22794197 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958178-trimmed-pair1.fastq SRR6958178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,529,964 reads, 22,831,606 reads pseudoaligned [quant] estimated average fragment length: 248.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,298 rounds 52973 SRR6958178.ke.tsv 35125 SRR6958178.se.tsv 88098 total ==> SRR6958178.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.024 0 0 PNS24247 1044 796.62 62.9473 5.16078 PNS24249 1928 1680.62 50.9055 1.97826 PNS24246 1044 796.62 62.9473 5.16078 PNS24248 1044 796.62 62.9473 5.16078 PNS24244 1471 1223.62 23.2525 1.24111 PNS24243 293 96.9729 0 0 KQK14069 1603 1355.62 3942.19 189.928 KQK14071 474 240.701 64.6806 17.5504 ==> SRR6958178.se.tsv <== BRADI_1g14170v3 4418 BRADI_1g53295v3 371 BRADI_1g59795v3 279 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 304 BRADI_1g74790v3 95 BRADI_1g09890v3 0 BRADI_1g77505v3 332 BRADI_1g48960v3 2 SRR6958178 completed mapping pipeline successfully