Starting /dee2/code/volunteer_pipeline.sh SRR6958179 current disk space = 1550388547584 free memory = 1599779216 SRR6958179 SRAfilesize 640361a3e961c77cdd214d821a2d600c SRR6958179.sra SRR6958179.sra file validated SRR6958179 is paired end SRR6958179 is conventional basespace SRR6958179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.66975 18.0 18.0 18.0 18.0 32.0 2 21.99175 18.0 18.0 27.0 18.0 30.0 3 28.08725 27.0 27.0 30.0 25.0 31.0 4 27.86125 32.0 25.0 32.0 15.0 33.0 5 29.1755 32.0 27.0 33.0 15.0 33.0 6 35.11625 37.0 34.0 38.0 30.0 38.0 7 36.414 38.0 36.0 38.0 34.0 38.0 8 37.117 38.0 38.0 38.0 35.0 38.0 9 37.1775 38.0 38.0 38.0 36.0 38.0 10-14 37.203700000000005 38.0 38.0 38.0 36.4 38.0 15-19 37.27145 38.0 38.0 38.0 36.6 38.0 20-24 36.80395 38.0 38.0 38.0 34.8 38.0 25-29 36.84975000000001 38.0 38.0 38.0 35.2 38.0 30-34 37.15925 38.0 38.0 38.0 36.4 38.0 35-39 37.3575 38.0 38.0 38.0 37.0 38.0 40-44 37.35080000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.24705 38.0 38.0 38.0 36.8 38.0 50-54 37.11745 38.0 38.0 38.0 36.2 38.0 55-59 37.01165 38.0 38.0 38.0 36.0 38.0 60-64 37.13175 38.0 38.0 38.0 36.0 38.0 65-69 37.15455 38.0 38.0 38.0 36.0 38.0 70-74 37.158049999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.10595 38.0 38.0 38.0 36.2 38.0 80-84 37.028949999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.62605 38.0 38.0 38.0 34.4 38.0 90-94 36.2522 38.0 38.0 38.0 33.6 38.0 95-99 35.258649999999996 38.0 36.4 38.0 27.6 38.0 100-104 35.11024999999999 38.0 36.0 38.0 27.4 38.0 105-109 35.1305 38.0 35.6 38.0 27.0 38.0 110-114 35.40055 38.0 36.0 38.0 28.6 38.0 115-119 35.81685 38.0 36.6 38.0 31.2 38.0 120-124 36.058800000000005 38.0 37.0 38.0 33.0 38.0 125-129 36.00945 38.0 36.8 38.0 32.6 38.0 130-134 35.9783 38.0 36.4 38.0 32.8 38.0 135-139 35.6213 38.0 36.0 38.0 31.6 38.0 140-144 34.8103 38.0 35.0 38.0 28.4 38.0 145-149 33.064049999999995 38.0 32.6 38.0 20.4 38.0 150-151 28.83125 34.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 1.0 21 4.0 22 2.0 23 7.0 24 7.0 25 14.0 26 23.0 27 22.0 28 18.0 29 36.0 30 51.0 31 82.0 32 130.0 33 163.0 34 232.0 35 391.0 36 982.0 37 1824.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.156587473002162 18.19654427645788 9.26025917926566 42.3866090712743 2 19.900000000000002 19.875 30.8 29.425 3 20.95 20.474999999999998 22.425 36.15 4 22.625 27.825 22.650000000000002 26.900000000000002 5 24.25 32.25 22.05 21.45 6 22.575 33.575 23.525 20.325 7 15.825 24.75 39.900000000000006 19.525000000000002 8 21.575 24.025 27.650000000000002 26.75 9 19.2 22.175 32.15 26.474999999999998 10-14 22.905 26.889999999999997 25.15 25.055 15-19 22.759999999999998 25.53 26.015 25.695 20-24 22.509999999999998 25.47 26.490000000000002 25.53 25-29 23.225 26.22 25.91 24.645 30-34 22.67 25.34 26.375 25.615 35-39 22.830000000000002 25.874999999999996 26.174999999999997 25.119999999999997 40-44 22.220000000000002 26.365 25.97 25.445 45-49 22.445 25.5 26.135 25.919999999999998 50-54 22.314999999999998 25.77 25.835 26.08 55-59 23.005 25.240000000000002 26.115 25.64 60-64 22.82 25.56 26.235000000000003 25.385 65-69 22.735 25.069999999999997 26.21 25.985000000000003 70-74 23.03 25.91 25.75 25.31 75-79 22.830000000000002 25.44 26.22 25.509999999999998 80-84 22.825 25.835 25.865 25.474999999999998 85-89 22.61 25.825 25.81 25.755 90-94 23.369999999999997 24.915000000000003 25.83 25.885 95-99 23.189999999999998 24.79 26.215 25.805 100-104 23.355 25.174999999999997 26.045 25.424999999999997 105-109 23.53 25.115 25.545 25.81 110-114 23.43 25.419999999999998 25.575 25.575 115-119 23.275000000000002 25.21 25.735000000000003 25.779999999999998 120-124 22.725 25.775 25.619999999999997 25.88 125-129 23.31 25.779999999999998 25.174999999999997 25.735000000000003 130-134 23.18 25.44 25.705 25.674999999999997 135-139 23.305 25.405 25.585 25.705 140-144 23.77 24.98 25.785000000000004 25.465 145-149 23.49 25.540000000000003 25.28 25.69 150-151 23.674999999999997 24.625 25.4625 26.237500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 3.0 28 3.5 29 2.5 30 6.5 31 8.5 32 10.5 33 15.5 34 20.5 35 30.0 36 52.5 37 68.5 38 85.0 39 119.0 40 130.0 41 143.0 42 172.0 43 198.0 44 219.0 45 229.5 46 230.5 47 214.5 48 202.0 49 188.5 50 166.5 51 152.0 52 140.0 53 137.0 54 116.0 55 96.5 56 96.0 57 83.5 58 83.0 59 77.5 60 69.0 61 64.0 62 63.0 63 57.0 64 48.5 65 46.0 66 30.0 67 24.5 68 22.5 69 16.0 70 12.5 71 9.5 72 9.5 73 9.5 74 6.5 75 3.0 76 2.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTGGT 10 0.0054020355 156.67567 1 TTCTGTA 10 0.006841402 144.925 7 TGCCTTC 10 0.006841402 144.925 9 TAATTTT 10 0.006841402 144.925 7 GAATATA 10 0.006841402 144.925 145 CCCTCTT 10 0.006841402 144.925 2 >>END_MODULE SRR6958179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7305 33.0 33.0 34.0 32.0 34.0 2 32.8905 33.0 33.0 34.0 32.0 34.0 3 32.93525 34.0 33.0 34.0 32.0 34.0 4 32.848 34.0 33.0 34.0 32.0 34.0 5 32.9315 34.0 33.0 34.0 32.0 34.0 6 36.97575 38.0 38.0 38.0 36.0 38.0 7 36.99375 38.0 38.0 38.0 36.0 38.0 8 36.87075 38.0 38.0 38.0 36.0 38.0 9 36.7205 38.0 38.0 38.0 35.0 38.0 10-14 36.54350000000001 38.0 38.0 38.0 34.0 38.0 15-19 36.45264999999999 38.0 38.0 38.0 34.0 38.0 20-24 36.625600000000006 38.0 38.0 38.0 34.8 38.0 25-29 36.709399999999995 38.0 38.0 38.0 35.0 38.0 30-34 37.0099 38.0 38.0 38.0 36.4 38.0 35-39 37.048449999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.9625 38.0 38.0 38.0 36.2 38.0 45-49 36.805800000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.525400000000005 38.0 38.0 38.0 34.2 38.0 55-59 36.48355 38.0 38.0 38.0 34.4 38.0 60-64 36.7649 38.0 38.0 38.0 35.4 38.0 65-69 36.459900000000005 38.0 38.0 38.0 34.2 38.0 70-74 36.289049999999996 38.0 38.0 38.0 33.6 38.0 75-79 36.10465000000001 38.0 37.8 38.0 33.0 38.0 80-84 35.826649999999994 38.0 37.4 38.0 31.4 38.0 85-89 35.590650000000004 38.0 37.0 38.0 29.4 38.0 90-94 36.00915 38.0 37.8 38.0 32.6 38.0 95-99 36.1993 38.0 38.0 38.0 33.8 38.0 100-104 36.202650000000006 38.0 38.0 38.0 33.6 38.0 105-109 36.1552 38.0 38.0 38.0 33.8 38.0 110-114 35.9282 38.0 37.4 38.0 32.8 38.0 115-119 35.532900000000005 38.0 36.8 38.0 30.6 38.0 120-124 33.9984 38.0 34.2 38.0 23.2 38.0 125-129 33.6894 38.0 33.2 38.0 21.0 38.0 130-134 27.61455 30.0 18.6 36.4 13.6 38.0 135-139 33.570499999999996 38.0 33.0 38.0 22.6 38.0 140-144 33.86035 38.0 33.4 38.0 23.0 38.0 145-149 33.14645 38.0 33.2 38.0 16.8 38.0 150-151 28.03075 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 1.0 6 2.0 7 0.0 8 0.0 9 1.0 10 4.0 11 1.0 12 0.0 13 3.0 14 2.0 15 3.0 16 1.0 17 4.0 18 1.0 19 5.0 20 11.0 21 10.0 22 21.0 23 12.0 24 18.0 25 20.0 26 31.0 27 46.0 28 35.0 29 41.0 30 60.0 31 77.0 32 122.0 33 144.0 34 238.0 35 403.0 36 860.0 37 1809.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 19.575 12.85 30.3 2 31.075000000000003 24.15 26.450000000000003 18.325 3 22.75 27.075 27.425 22.75 4 24.425 33.074999999999996 21.025 21.475 5 27.400000000000002 33.175 19.1 20.325 6 24.55 35.55 19.375 20.525 7 21.4 21.55 35.075 21.975 8 23.325000000000003 24.15 23.525 28.999999999999996 9 23.875 23.849999999999998 25.650000000000002 26.625 10-14 26.75 26.445 23.225 23.580000000000002 15-19 26.340000000000003 25.83 24.36 23.47 20-24 25.245 26.169999999999998 24.525 24.060000000000002 25-29 26.05 26.075 24.41 23.465 30-34 25.525 26.96 24.18 23.335 35-39 25.155 26.57 24.63 23.645 40-44 25.6 25.56 24.51 24.33 45-49 25.569999999999997 25.71 24.73 23.990000000000002 50-54 25.83 26.21 24.529999999999998 23.43 55-59 25.71 25.935000000000002 24.845 23.51 60-64 25.995 26.16 25.014999999999997 22.830000000000002 65-69 26.075 26.035000000000004 24.709999999999997 23.18 70-74 26.27 25.8 24.465 23.465 75-79 25.22 26.290000000000003 25.045 23.445 80-84 25.629999999999995 25.919999999999998 24.775 23.674999999999997 85-89 26.07 25.919999999999998 25.275 22.735 90-94 25.905 25.869999999999997 24.98 23.244999999999997 95-99 25.4 26.474999999999998 24.995 23.13 100-104 25.495 25.86 25.335 23.31 105-109 26.02 25.94 25.345000000000002 22.695 110-114 25.779999999999998 26.76 24.34 23.119999999999997 115-119 26.490000000000002 26.21 24.675 22.625 120-124 26.525 26.07 25.155 22.25 125-129 26.375 26.14 24.36 23.125 130-134 27.339999999999996 25.825 24.490000000000002 22.345000000000002 135-139 26.56 26.419999999999998 25.174999999999997 21.845 140-144 26.945000000000004 26.26 24.654999999999998 22.14 145-149 27.025 25.965 24.995 22.015 150-151 26.875 26.8125 25.174999999999997 21.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 0.5 26 0.5 27 1.0 28 2.0 29 3.0 30 5.0 31 6.5 32 11.5 33 16.0 34 22.5 35 31.5 36 43.0 37 59.0 38 85.0 39 104.5 40 112.5 41 131.0 42 152.5 43 180.0 44 194.5 45 207.0 46 201.5 47 194.5 48 197.5 49 184.5 50 177.0 51 168.0 52 151.5 53 129.5 54 114.5 55 116.5 56 112.5 57 98.0 58 96.5 59 91.0 60 79.0 61 65.5 62 66.0 63 70.5 64 57.0 65 43.0 66 41.5 67 36.5 68 25.0 69 28.0 70 26.0 71 19.0 72 13.0 73 6.5 74 6.0 75 5.0 76 3.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7824331145885917 1.55 3 0.05047955577990913 0.15 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.175000000000001 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191760 spots for SRR6958179.sra Written 1191760 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra Read 1191745 spots for SRR6958179.sra Written 1191745 spots for SRR6958179.sra SRR ids: ['SRR6958179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rb0d3t9r SRR6958179.sra spots: 23834915 blocks: [[1, 1191745], [1191746, 2383490], [2383491, 3575235], [3575236, 4766980], [4766981, 5958725], [5958726, 7150470], [7150471, 8342215], [8342216, 9533960], [9533961, 10725705], [10725706, 11917450], [11917451, 13109195], [13109196, 14300940], [14300941, 15492685], [15492686, 16684430], [16684431, 17876175], [17876176, 19067920], [19067921, 20259665], [20259666, 21451410], [21451411, 22643155], [22643156, 23834915]] SRR6958179 file size 8055170 SRR6958179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958179 SRR6958179_1.fastq SRR6958179_2.fastq Input file: SRR6958179_1.fastq Paired file: SRR6958179_2.fastq trimmed: SRR6958179-trimmed-pair1.fastq, SRR6958179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:14:01 2024 >> started Fri Dec 6 15:14:26 2024 >> done (24.520s) 23834915 read pairs processed; of these: 26836 ( 0.11%) short read pairs filtered out after trimming by size control 22005 ( 0.09%) empty read pairs filtered out after trimming by size control 23786074 (99.80%) read pairs available; of these: 9395584 (39.50%) trimmed read pairs available after processing 14390490 (60.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 5 0.00% 25 6 0.00% 26 10 0.00% 27 6 0.00% 28 12 0.00% 29 10 0.00% 30 6 0.00% 31 12 0.00% 32 11 0.00% 33 13 0.00% 34 7 0.00% 35 5 0.00% 36 11 0.00% 37 13 0.00% 38 17 0.00% 39 17 0.00% 40 20 0.00% 41 22 0.00% 42 14 0.00% 43 18 0.00% 44 32 0.00% 45 23 0.00% 46 36 0.00% 47 29 0.00% 48 42 0.00% 49 50 0.00% 50 72 0.00% 51 51 0.00% 52 70 0.00% 53 87 0.00% 54 85 0.00% 55 123 0.00% 56 116 0.00% 57 138 0.00% 58 162 0.00% 59 193 0.00% 60 241 0.00% 61 271 0.00% 62 325 0.00% 63 414 0.00% 64 447 0.00% 65 453 0.00% 66 531 0.00% 67 592 0.00% 68 698 0.00% 69 809 0.00% 70 892 0.00% 71 1050 0.00% 72 1300 0.01% 73 1491 0.01% 74 1715 0.01% 75 1857 0.01% 76 2032 0.01% 77 2255 0.01% 78 2493 0.01% 79 2935 0.01% 80 3336 0.01% 81 3764 0.02% 82 4431 0.02% 83 5091 0.02% 84 6525 0.03% 85 7372 0.03% 86 7920 0.03% 87 8030 0.03% 88 8624 0.04% 89 9071 0.04% 90 9741 0.04% 91 10671 0.04% 92 11500 0.05% 93 12755 0.05% 94 13840 0.06% 95 14711 0.06% 96 15575 0.07% 97 16258 0.07% 98 16687 0.07% 99 17706 0.07% 100 18765 0.08% 101 19896 0.08% 102 21270 0.09% 103 22799 0.10% 104 24589 0.10% 105 25617 0.11% 106 26801 0.11% 107 27665 0.12% 108 28136 0.12% 109 28983 0.12% 110 30121 0.13% 111 31525 0.13% 112 33603 0.14% 113 35426 0.15% 114 37443 0.16% 115 39380 0.17% 116 41175 0.17% 117 42044 0.18% 118 43093 0.18% 119 43307 0.18% 120 45013 0.19% 121 46324 0.19% 122 48110 0.20% 123 51163 0.22% 124 54008 0.23% 125 56422 0.24% 126 57945 0.24% 127 59697 0.25% 128 61080 0.26% 129 62405 0.26% 130 64234 0.27% 131 66623 0.28% 132 69498 0.29% 133 73734 0.31% 134 76733 0.32% 135 81364 0.34% 136 84747 0.36% 137 88053 0.37% 138 91912 0.39% 139 96500 0.41% 140 101268 0.43% 141 109255 0.46% 142 120473 0.51% 143 131727 0.55% 144 149672 0.63% 145 175393 0.74% 146 212755 0.89% 147 280670 1.18% 148 414197 1.74% 149 776940 3.27% 150 4738052 19.92% 151 14390490 60.50% 23786074 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=18 prefix-density=0.70 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=29.91 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=7.8 sequence=TTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=47.94 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958179 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:15:10 Started mapping on | Dec 06 15:15:10 Finished on | Dec 06 15:16:59 Mapping speed, Million of reads per hour | 785.60 Number of input reads | 23786074 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22667944 Uniquely mapped reads % | 95.30% Average mapped length | 294.69 Number of splices: Total | 26288060 Number of splices: Annotated (sjdb) | 24707556 Number of splices: GT/AG | 25937599 Number of splices: GC/AG | 311636 Number of splices: AT/AC | 10079 Number of splices: Non-canonical | 28746 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379561 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 66989 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 1.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751224 751224 751224 N_multimapping 379561 379561 379561 N_noFeature 868710 22035444 1057264 N_ambiguous 536811 3105 94666 UnstrandedReadsAssigned:21262423 PositiveStrandReadsAssigned:629395 NegativeStrandReadsAssigned:21516014 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958179-trimmed-pair1.fastq SRR6958179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,786,074 reads, 21,620,482 reads pseudoaligned [quant] estimated average fragment length: 256.32 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR6958179.ke.tsv 35125 SRR6958179.se.tsv 88098 total ==> SRR6958179.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.136 0 0 PNS24247 1044 788.68 75.3667 6.61089 PNS24249 1928 1672.68 66.3714 2.74504 PNS24246 1044 788.68 75.3667 6.61089 PNS24248 1044 788.68 75.3667 6.61089 PNS24244 1471 1215.68 24.5285 1.39583 PNS24243 293 92.9878 0 0 KQK14069 1603 1347.68 7217.72 370.505 KQK14071 474 234.877 91.2417 26.8741 ==> SRR6958179.se.tsv <== BRADI_1g14170v3 7946 BRADI_1g53295v3 227 BRADI_1g59795v3 234 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 212 BRADI_1g74790v3 125 BRADI_1g09890v3 0 BRADI_1g77505v3 265 BRADI_1g48960v3 0 SRR6958179 completed mapping pipeline successfully