Starting /dee2/code/volunteer_pipeline.sh SRR6958180 current disk space = 1550368403456 free memory = 1291313952 SRR6958180 SRAfilesize 75e93e73dda4526933b8cf7f69c1acf3 SRR6958180.sra SRR6958180.sra file validated SRR6958180 is paired end SRR6958180 is conventional basespace SRR6958180 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958180_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.53725 18.0 18.0 18.0 2.0 28.0 2 23.874 25.0 18.0 28.0 18.0 31.0 3 29.0175 29.0 27.0 31.0 27.0 33.0 4 31.8565 33.0 32.0 33.0 32.0 33.0 5 32.62175 33.0 33.0 33.0 32.0 33.0 6 34.30825 37.0 34.0 38.0 26.0 38.0 7 36.63325 38.0 37.0 38.0 34.0 38.0 8 37.2145 38.0 38.0 38.0 36.0 38.0 9 37.472 38.0 38.0 38.0 37.0 38.0 10-14 37.51205 38.0 38.0 38.0 37.4 38.0 15-19 37.445 38.0 38.0 38.0 37.4 38.0 20-24 37.38125 38.0 38.0 38.0 37.2 38.0 25-29 37.15585 38.0 38.0 38.0 36.4 38.0 30-34 37.02545 38.0 37.8 38.0 35.2 38.0 35-39 37.164750000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.5279 38.0 38.0 38.0 38.0 38.0 45-49 37.400400000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2676 38.0 38.0 38.0 36.8 38.0 55-59 37.2599 38.0 38.0 38.0 36.6 38.0 60-64 37.4271 38.0 38.0 38.0 37.0 38.0 65-69 36.76005 38.0 37.4 38.0 34.0 38.0 70-74 37.3135 38.0 38.0 38.0 36.8 38.0 75-79 37.363749999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.233900000000006 38.0 38.0 38.0 36.6 38.0 85-89 36.90560000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.41035 38.0 38.0 38.0 33.4 38.0 95-99 34.3439 38.0 34.4 38.0 22.8 38.0 100-104 35.81105 38.0 37.0 38.0 30.6 38.0 105-109 35.803399999999996 38.0 37.0 38.0 31.0 38.0 110-114 35.9548 38.0 37.0 38.0 32.2 38.0 115-119 36.47405 38.0 37.8 38.0 34.0 38.0 120-124 36.5852 38.0 38.0 38.0 34.0 38.0 125-129 36.49225 38.0 38.0 38.0 34.2 38.0 130-134 36.32625 38.0 37.8 38.0 33.8 38.0 135-139 35.8668 38.0 36.2 38.0 32.4 38.0 140-144 35.45125 38.0 36.0 38.0 31.0 38.0 145-149 32.7893 37.0 31.4 38.0 22.8 38.0 150-151 29.494500000000002 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 9.0 24 5.0 25 4.0 26 14.0 27 25.0 28 18.0 29 34.0 30 39.0 31 61.0 32 93.0 33 132.0 34 207.0 35 366.0 36 1023.0 37 1963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.917994784120545 16.864676905244856 7.765864966676325 42.451463343958274 2 23.375 14.2 32.875 29.549999999999997 3 21.125 18.425 25.074999999999996 35.375 4 26.875 24.8 20.525 27.800000000000004 5 24.75 29.725 23.175 22.35 6 23.225 32.800000000000004 23.525 20.45 7 16.35 23.35 40.525 19.775000000000002 8 20.724999999999998 23.425 31.525 24.325 9 19.650000000000002 21.55 33.6 25.2 10-14 22.73 26.314999999999998 26.395000000000003 24.560000000000002 15-19 22.81 26.07 26.150000000000002 24.97 20-24 22.439999999999998 26.005 26.229999999999997 25.324999999999996 25-29 22.97 26.095000000000002 26.025 24.91 30-34 22.535 25.685000000000002 26.395000000000003 25.385 35-39 22.485 26.314999999999998 26.090000000000003 25.11 40-44 22.15 25.590000000000003 26.555 25.705 45-49 22.945 25.974999999999998 25.650000000000002 25.430000000000003 50-54 22.375 26.055 26.265 25.305 55-59 22.665 25.729999999999997 26.07 25.535000000000004 60-64 22.62 26.165 25.955000000000002 25.259999999999998 65-69 22.8 25.83 26.165 25.205 70-74 22.915 25.905 25.635 25.545 75-79 23.055 25.765 26.150000000000002 25.03 80-84 22.765 25.455 26.365 25.415 85-89 22.56 25.555 25.845000000000002 26.040000000000003 90-94 23.24 25.124999999999996 25.785000000000004 25.85 95-99 23.525 24.895 26.16 25.419999999999998 100-104 23.03 25.569999999999997 26.215 25.185000000000002 105-109 22.955000000000002 25.369999999999997 26.22 25.455 110-114 23.16 25.019999999999996 26.179999999999996 25.64 115-119 23.044999999999998 25.485000000000003 26.095000000000002 25.374999999999996 120-124 23.115 25.814999999999998 25.430000000000003 25.64 125-129 23.825 25.005 26.015 25.155 130-134 23.78 25.665 25.3 25.255 135-139 23.13231323132313 25.22252225222522 25.752575257525752 25.89258925892589 140-144 23.69 25.650000000000002 25.275 25.385 145-149 23.805 25.380000000000003 25.380000000000003 25.435000000000002 150-151 24.127579737335836 25.328330206378986 25.465916197623518 25.07817385866166 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.0 29 5.5 30 10.5 31 9.5 32 13.5 33 27.0 34 35.5 35 38.0 36 46.0 37 64.0 38 90.0 39 121.0 40 145.5 41 175.0 42 206.5 43 209.5 44 210.0 45 212.5 46 210.0 47 206.0 48 191.0 49 172.0 50 156.0 51 147.0 52 139.0 53 129.5 54 121.0 55 104.0 56 78.5 57 71.0 58 67.5 59 62.0 60 70.5 61 65.5 62 53.0 63 46.5 64 44.5 65 45.5 66 38.0 67 29.0 68 26.0 69 23.0 70 17.0 71 14.5 72 11.0 73 8.0 74 7.0 75 4.0 76 4.0 77 5.5 78 4.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.725000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.5028916268544128 1.0 3 0.0 0.0 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958180 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958180_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00975 33.0 33.0 34.0 32.0 34.0 2 33.249 34.0 33.0 34.0 33.0 34.0 3 33.20475 34.0 33.0 34.0 33.0 34.0 4 32.992 34.0 33.0 34.0 32.0 34.0 5 33.04325 34.0 33.0 34.0 32.0 34.0 6 37.33325 38.0 38.0 38.0 37.0 38.0 7 37.314 38.0 38.0 38.0 37.0 38.0 8 37.15625 38.0 38.0 38.0 37.0 38.0 9 37.1565 38.0 38.0 38.0 37.0 38.0 10-14 37.13590000000001 38.0 38.0 38.0 36.4 38.0 15-19 36.7786 38.0 38.0 38.0 35.2 38.0 20-24 36.947649999999996 38.0 38.0 38.0 35.8 38.0 25-29 37.16475 38.0 38.0 38.0 36.6 38.0 30-34 37.32955 38.0 38.0 38.0 37.2 38.0 35-39 37.39975 38.0 38.0 38.0 37.2 38.0 40-44 35.8292 38.0 35.4 38.0 30.4 38.0 45-49 37.05995 38.0 38.0 38.0 36.2 38.0 50-54 36.6441 38.0 38.0 38.0 35.0 38.0 55-59 36.90565 38.0 38.0 38.0 35.8 38.0 60-64 36.88705 38.0 38.0 38.0 35.6 38.0 65-69 36.83235 38.0 38.0 38.0 35.6 38.0 70-74 36.51605 38.0 38.0 38.0 34.4 38.0 75-79 36.29305 38.0 38.0 38.0 33.0 38.0 80-84 36.32385000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.14789999999999 38.0 38.0 38.0 33.0 38.0 90-94 36.547700000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.686099999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.6038 38.0 38.0 38.0 34.6 38.0 105-109 36.59505 38.0 38.0 38.0 34.6 38.0 110-114 36.34 38.0 38.0 38.0 34.0 38.0 115-119 35.8586 38.0 37.6 38.0 31.8 38.0 120-124 35.13505 38.0 35.8 38.0 28.0 38.0 125-129 33.2867 37.2 31.0 38.0 22.2 38.0 130-134 30.5803 34.0 25.4 37.8 18.4 38.0 135-139 34.97515 38.0 35.2 38.0 29.8 38.0 140-144 34.63965 38.0 34.8 38.0 27.4 38.0 145-149 34.53145 38.0 35.8 38.0 28.8 38.0 150-151 29.42775 35.5 27.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 5.0 20 5.0 21 4.0 22 7.0 23 16.0 24 17.0 25 11.0 26 21.0 27 31.0 28 32.0 29 42.0 30 56.0 31 74.0 32 88.0 33 117.0 34 195.0 35 316.0 36 837.0 37 2108.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.825 17.474999999999998 12.025 33.675 2 28.625 24.7 27.925 18.75 3 23.075000000000003 26.150000000000002 27.325 23.45 4 25.85 30.95 20.325 22.875 5 27.175 32.824999999999996 19.75 20.25 6 22.775000000000002 36.525 20.7 20.0 7 22.875 19.425 35.199999999999996 22.5 8 23.075000000000003 23.549999999999997 24.45 28.925 9 23.35 23.175 28.275 25.2 10-14 25.82 26.815 23.01 24.355 15-19 25.47 25.790000000000003 25.135 23.605 20-24 25.040000000000003 26.729999999999997 24.654999999999998 23.575 25-29 25.855 26.145000000000003 24.465 23.535 30-34 25.865 25.885 24.709999999999997 23.54 35-39 25.919999999999998 25.775 24.635 23.669999999999998 40-44 25.965 25.465 24.72 23.849999999999998 45-49 25.305 25.655 25.419999999999998 23.62 50-54 25.929999999999996 25.779999999999998 24.915000000000003 23.375 55-59 25.435000000000002 25.979999999999997 24.91 23.674999999999997 60-64 25.495 25.455 25.1 23.95 65-69 25.674999999999997 26.05 24.855 23.419999999999998 70-74 25.840000000000003 26.045 24.529999999999998 23.585 75-79 26.82 25.335 24.435000000000002 23.41 80-84 25.480000000000004 25.629999999999995 25.130000000000003 23.76 85-89 25.645 25.585 24.875 23.895 90-94 25.965 25.665 25.305 23.064999999999998 95-99 25.52 26.08 24.82 23.580000000000002 100-104 25.535000000000004 25.590000000000003 25.155 23.72 105-109 25.345000000000002 25.915 25.295 23.445 110-114 25.825 26.445 24.855 22.875 115-119 25.480000000000004 26.779999999999998 24.195 23.544999999999998 120-124 25.14 25.795 25.715 23.35 125-129 26.07 26.165 24.740000000000002 23.025000000000002 130-134 26.11 26.0 24.945 22.945 135-139 26.13 25.85 25.330000000000002 22.689999999999998 140-144 25.929999999999996 26.38 25.009999999999998 22.68 145-149 26.235000000000003 26.465 24.965 22.335 150-151 26.2625 26.1 25.662499999999998 21.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 2.5 28 5.0 29 6.0 30 8.0 31 10.5 32 13.0 33 17.5 34 22.5 35 28.5 36 34.5 37 48.0 38 70.5 39 105.0 40 136.0 41 154.0 42 177.0 43 178.5 44 193.5 45 211.0 46 200.0 47 205.0 48 194.5 49 182.0 50 179.5 51 147.0 52 127.0 53 134.5 54 117.5 55 88.0 56 82.5 57 88.0 58 87.0 59 79.0 60 72.5 61 63.0 62 60.5 63 70.0 64 64.5 65 55.0 66 50.0 67 44.0 68 38.5 69 32.0 70 31.5 71 25.0 72 14.0 73 12.5 74 11.0 75 7.0 76 5.0 77 4.5 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03991915108641 98.0 2 0.8590197069226881 1.7000000000000002 3 0.1010611419909045 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.5875000000000004 0.0 0.0 0.0 0.0 138-139 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463039 spots for SRR6958180.sra Written 1463039 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra Read 1463028 spots for SRR6958180.sra Written 1463028 spots for SRR6958180.sra SRR ids: ['SRR6958180.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_igv5ha1z SRR6958180.sra spots: 29260571 blocks: [[1, 1463028], [1463029, 2926056], [2926057, 4389084], [4389085, 5852112], [5852113, 7315140], [7315141, 8778168], [8778169, 10241196], [10241197, 11704224], [11704225, 13167252], [13167253, 14630280], [14630281, 16093308], [16093309, 17556336], [17556337, 19019364], [19019365, 20482392], [20482393, 21945420], [21945421, 23408448], [23408449, 24871476], [24871477, 26334504], [26334505, 27797532], [27797533, 29260571]] SRR6958180 file size 9893747 SRR6958180 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958180 SRR6958180_1.fastq SRR6958180_2.fastq Input file: SRR6958180_1.fastq Paired file: SRR6958180_2.fastq trimmed: SRR6958180-trimmed-pair1.fastq, SRR6958180-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:16:39 2024 >> started Fri Dec 6 15:17:18 2024 >> done (39.436s) 29260571 read pairs processed; of these: 23930 ( 0.08%) short read pairs filtered out after trimming by size control 22459 ( 0.08%) empty read pairs filtered out after trimming by size control 29214182 (99.84%) read pairs available; of these: 9535292 (32.64%) trimmed read pairs available after processing 19678890 (67.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 6 0.00% 22 3 0.00% 23 8 0.00% 24 7 0.00% 25 7 0.00% 26 7 0.00% 27 10 0.00% 28 10 0.00% 29 5 0.00% 30 7 0.00% 31 9 0.00% 32 8 0.00% 33 12 0.00% 34 7 0.00% 35 13 0.00% 36 4 0.00% 37 12 0.00% 38 14 0.00% 39 9 0.00% 40 14 0.00% 41 8 0.00% 42 13 0.00% 43 12 0.00% 44 17 0.00% 45 15 0.00% 46 16 0.00% 47 22 0.00% 48 25 0.00% 49 29 0.00% 50 25 0.00% 51 27 0.00% 52 37 0.00% 53 45 0.00% 54 47 0.00% 55 53 0.00% 56 54 0.00% 57 66 0.00% 58 68 0.00% 59 91 0.00% 60 82 0.00% 61 119 0.00% 62 124 0.00% 63 125 0.00% 64 160 0.00% 65 201 0.00% 66 188 0.00% 67 211 0.00% 68 274 0.00% 69 322 0.00% 70 320 0.00% 71 402 0.00% 72 424 0.00% 73 520 0.00% 74 526 0.00% 75 626 0.00% 76 733 0.00% 77 866 0.00% 78 906 0.00% 79 1118 0.00% 80 1267 0.00% 81 1449 0.00% 82 1719 0.01% 83 1996 0.01% 84 3154 0.01% 85 3925 0.01% 86 4044 0.01% 87 4396 0.02% 88 4666 0.02% 89 4826 0.02% 90 5292 0.02% 91 5587 0.02% 92 6087 0.02% 93 6745 0.02% 94 7400 0.03% 95 7757 0.03% 96 8428 0.03% 97 8942 0.03% 98 9174 0.03% 99 10183 0.03% 100 10954 0.04% 101 11764 0.04% 102 12811 0.04% 103 13714 0.05% 104 14873 0.05% 105 15816 0.05% 106 16829 0.06% 107 17554 0.06% 108 18642 0.06% 109 20059 0.07% 110 20673 0.07% 111 21580 0.07% 112 23989 0.08% 113 24887 0.09% 114 27132 0.09% 115 28437 0.10% 116 30225 0.10% 117 31399 0.11% 118 32649 0.11% 119 33486 0.11% 120 35082 0.12% 121 36502 0.12% 122 38504 0.13% 123 41707 0.14% 124 43408 0.15% 125 45790 0.16% 126 47918 0.16% 127 49879 0.17% 128 51256 0.18% 129 53352 0.18% 130 55940 0.19% 131 57805 0.20% 132 60677 0.21% 133 64223 0.22% 134 67499 0.23% 135 71753 0.25% 136 76144 0.26% 137 78907 0.27% 138 82636 0.28% 139 88426 0.30% 140 93004 0.32% 141 101088 0.35% 142 110513 0.38% 143 120981 0.41% 144 137581 0.47% 145 160373 0.55% 146 193825 0.66% 147 252656 0.86% 148 374811 1.28% 149 746143 2.55% 150 5553300 19.01% 151 19678890 67.36% 29214182 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=23 prefix-density=0.44 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=85.94 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=27 prefix-density=0.35 prefix-fanout=2.6 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=29.65 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACT SRR6958180 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:18:09 Started mapping on | Dec 06 15:18:09 Finished on | Dec 06 15:21:01 Mapping speed, Million of reads per hour | 611.46 Number of input reads | 29214182 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28052975 Uniquely mapped reads % | 96.03% Average mapped length | 297.51 Number of splices: Total | 32717489 Number of splices: Annotated (sjdb) | 30892621 Number of splices: GT/AG | 32294012 Number of splices: GC/AG | 384176 Number of splices: AT/AC | 14026 Number of splices: Non-canonical | 25275 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339471 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 59154 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 836900 836900 836900 N_multimapping 339471 339471 339471 N_noFeature 1192884 27335106 1389455 N_ambiguous 620719 3283 101685 UnstrandedReadsAssigned:26239372 PositiveStrandReadsAssigned:714586 NegativeStrandReadsAssigned:26561835 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958180 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958180-trimmed-pair1.fastq SRR6958180-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,214,182 reads, 26,667,446 reads pseudoaligned [quant] estimated average fragment length: 263.505 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,344 rounds 52973 SRR6958180.ke.tsv 35125 SRR6958180.se.tsv 88098 total ==> SRR6958180.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.057 0 0 PNS24247 1044 781.495 83.7318 6.04839 PNS24249 1928 1665.5 77.0757 2.61246 PNS24246 1044 781.495 83.7318 6.04839 PNS24248 1044 781.495 83.7318 6.04839 PNS24244 1471 1208.5 40.7287 1.90253 PNS24243 293 85.3367 0 0 KQK14069 1603 1340.5 2882.34 121.382 KQK14071 474 227.303 49.581 12.3136 ==> SRR6958180.se.tsv <== BRADI_1g14170v3 3329 BRADI_1g53295v3 697 BRADI_1g59795v3 585 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 570 BRADI_1g74790v3 141 BRADI_1g09890v3 0 BRADI_1g77505v3 420 BRADI_1g48960v3 0 SRR6958180 completed mapping pipeline successfully