Starting /dee2/code/volunteer_pipeline.sh SRR6958181 current disk space = 1550373511168 free memory = 1599837264 SRR6958181 SRAfilesize e504179fb344097e7405c52ff74dcdc5 SRR6958181.sra SRR6958181.sra file validated SRR6958181 is paired end SRR6958181 is conventional basespace SRR6958181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.1775 18.0 18.0 25.0 2.0 31.0 2 29.51875 30.0 27.0 31.0 27.0 33.0 3 31.38625 33.0 31.0 33.0 27.0 33.0 4 32.65675 33.0 33.0 33.0 32.0 34.0 5 32.743 33.0 33.0 34.0 32.0 34.0 6 34.05425 38.0 34.0 38.0 16.0 38.0 7 36.673 38.0 37.0 38.0 34.0 38.0 8 37.14525 38.0 38.0 38.0 36.0 38.0 9 37.44175 38.0 38.0 38.0 37.0 38.0 10-14 37.4363 38.0 38.0 38.0 37.2 38.0 15-19 37.382799999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.22365 38.0 38.0 38.0 36.8 38.0 25-29 37.09365 38.0 38.0 38.0 36.4 38.0 30-34 37.0296 38.0 38.0 38.0 35.6 38.0 35-39 37.088800000000006 38.0 38.0 38.0 36.0 38.0 40-44 37.38035 38.0 38.0 38.0 37.0 38.0 45-49 37.36495 38.0 38.0 38.0 37.0 38.0 50-54 37.19925 38.0 38.0 38.0 36.6 38.0 55-59 37.17295 38.0 38.0 38.0 36.4 38.0 60-64 37.3072 38.0 38.0 38.0 37.0 38.0 65-69 36.67645 38.0 37.4 38.0 34.0 38.0 70-74 37.2114 38.0 38.0 38.0 36.2 38.0 75-79 37.1858 38.0 38.0 38.0 36.4 38.0 80-84 37.0827 38.0 38.0 38.0 36.2 38.0 85-89 36.77125 38.0 38.0 38.0 34.8 38.0 90-94 36.28744999999999 38.0 38.0 38.0 33.2 38.0 95-99 34.38545 38.0 34.4 38.0 22.6 38.0 100-104 35.674400000000006 38.0 37.0 38.0 30.2 38.0 105-109 35.6357 38.0 36.6 38.0 30.2 38.0 110-114 35.76105 38.0 37.0 38.0 31.2 38.0 115-119 36.280550000000005 38.0 37.6 38.0 33.6 38.0 120-124 36.44785 38.0 38.0 38.0 34.0 38.0 125-129 36.30315 38.0 37.6 38.0 33.8 38.0 130-134 36.163 38.0 37.4 38.0 33.2 38.0 135-139 35.6074 38.0 36.0 38.0 31.4 38.0 140-144 35.1807 38.0 35.8 38.0 30.4 38.0 145-149 32.257999999999996 37.0 29.0 38.0 20.4 38.0 150-151 29.497 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 4.0 21 4.0 22 2.0 23 7.0 24 6.0 25 9.0 26 21.0 27 16.0 28 41.0 29 33.0 30 58.0 31 68.0 32 97.0 33 122.0 34 188.0 35 372.0 36 852.0 37 2097.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.24577226606539 10.033821871476889 12.034949267192784 41.68545659526494 2 24.3 13.325000000000001 33.7 28.675 3 22.7 18.325 24.925 34.050000000000004 4 27.125 23.45 22.525000000000002 26.900000000000002 5 24.95 30.725 23.05 21.275 6 21.9 32.925 23.35 21.825 7 17.775 23.45 40.550000000000004 18.224999999999998 8 20.525 23.375 28.9 27.200000000000003 9 19.6 21.2 34.949999999999996 24.25 10-14 22.245 26.545 26.284999999999997 24.925 15-19 22.375 25.545 26.69 25.39 20-24 22.305 25.779999999999998 26.895000000000003 25.019999999999996 25-29 22.505 25.679999999999996 26.08 25.735000000000003 30-34 22.125 25.64 26.405 25.83 35-39 22.38 25.75 26.13 25.740000000000002 40-44 22.515 25.919999999999998 26.165 25.4 45-49 23.195 25.515 26.235000000000003 25.055 50-54 22.915 25.805 25.419999999999998 25.86 55-59 22.585 26.314999999999998 25.685000000000002 25.415 60-64 23.205000000000002 25.825 25.88 25.09 65-69 22.755 26.005 25.5 25.740000000000002 70-74 23.035 25.255 26.529999999999998 25.180000000000003 75-79 22.73 25.69 26.334999999999997 25.245 80-84 23.04 26.200000000000003 25.64 25.119999999999997 85-89 22.965 25.335 26.16 25.540000000000003 90-94 23.315 25.72 25.245 25.72 95-99 22.805 24.765 26.735 25.695 100-104 23.23 26.125 25.505 25.14 105-109 23.66 25.3 25.53 25.509999999999998 110-114 23.27 25.009999999999998 25.679999999999996 26.040000000000003 115-119 22.865 25.955000000000002 25.569999999999997 25.61 120-124 23.46 25.4 25.259999999999998 25.88 125-129 22.945 25.080000000000002 26.395000000000003 25.580000000000002 130-134 23.11 25.775 25.509999999999998 25.605 135-139 23.380000000000003 26.025 25.885 24.709999999999997 140-144 23.225 25.575 25.679999999999996 25.52 145-149 23.335 25.485000000000003 25.435000000000002 25.745 150-151 23.15289411176397 25.603200400050007 25.415676959619955 25.828228528566072 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 0.5 28 3.0 29 6.0 30 7.5 31 11.0 32 18.5 33 20.5 34 24.0 35 41.5 36 64.5 37 83.0 38 100.5 39 114.0 40 132.5 41 163.0 42 175.0 43 187.0 44 204.0 45 207.0 46 219.0 47 216.5 48 192.0 49 197.0 50 181.5 51 138.0 52 128.0 53 132.5 54 115.5 55 95.0 56 78.5 57 66.0 58 68.5 59 68.0 60 67.0 61 60.5 62 51.5 63 46.5 64 53.0 65 55.0 66 42.5 67 32.5 68 28.0 69 25.0 70 18.5 71 12.0 72 11.0 73 11.0 74 6.5 75 6.5 76 6.0 77 2.0 78 1.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.1 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8499999999999996 0.0 0.0 0.0 0.0 132-133 3.2125000000000004 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.7750000000000004 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83925 33.0 33.0 34.0 32.0 34.0 2 33.06375 34.0 33.0 34.0 32.0 34.0 3 33.05425 34.0 33.0 34.0 32.0 34.0 4 32.84425 34.0 33.0 34.0 32.0 34.0 5 32.92275 34.0 33.0 34.0 32.0 34.0 6 37.10575 38.0 38.0 38.0 37.0 38.0 7 37.1325 38.0 38.0 38.0 37.0 38.0 8 37.002 38.0 38.0 38.0 36.0 38.0 9 36.989 38.0 38.0 38.0 36.0 38.0 10-14 36.86805 38.0 38.0 38.0 36.0 38.0 15-19 36.56705 38.0 38.0 38.0 34.4 38.0 20-24 36.7319 38.0 38.0 38.0 35.4 38.0 25-29 36.8754 38.0 38.0 38.0 36.4 38.0 30-34 37.021300000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.084500000000006 38.0 38.0 38.0 37.0 38.0 40-44 35.40304999999999 38.0 35.2 38.0 29.8 38.0 45-49 36.836200000000005 38.0 38.0 38.0 35.6 38.0 50-54 36.345549999999996 38.0 38.0 38.0 33.6 38.0 55-59 36.6572 38.0 38.0 38.0 35.2 38.0 60-64 36.58205 38.0 38.0 38.0 35.2 38.0 65-69 36.550200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.33985 38.0 38.0 38.0 34.0 38.0 75-79 36.0966 38.0 38.0 38.0 32.8 38.0 80-84 36.095099999999995 38.0 38.0 38.0 33.0 38.0 85-89 35.9346 38.0 38.0 38.0 32.8 38.0 90-94 36.31785 38.0 38.0 38.0 34.0 38.0 95-99 36.41335 38.0 38.0 38.0 34.2 38.0 100-104 36.3638 38.0 38.0 38.0 34.0 38.0 105-109 36.384249999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.1659 38.0 38.0 38.0 33.8 38.0 115-119 35.719849999999994 38.0 37.6 38.0 32.0 38.0 120-124 34.834500000000006 38.0 35.8 38.0 26.6 38.0 125-129 33.2361 37.2 32.0 38.0 21.0 38.0 130-134 31.1493 35.2 26.6 38.0 18.2 38.0 135-139 34.786199999999994 38.0 35.4 38.0 28.6 38.0 140-144 34.445899999999995 38.0 35.0 38.0 27.6 38.0 145-149 34.314600000000006 38.0 35.6 38.0 28.0 38.0 150-151 29.461 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 5.0 5 3.0 6 1.0 7 2.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 0.0 14 3.0 15 3.0 16 5.0 17 3.0 18 3.0 19 4.0 20 5.0 21 10.0 22 14.0 23 13.0 24 17.0 25 23.0 26 23.0 27 37.0 28 42.0 29 34.0 30 56.0 31 71.0 32 64.0 33 117.0 34 176.0 35 325.0 36 719.0 37 2205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 16.85 12.85 33.975 2 28.499999999999996 22.825 28.775000000000002 19.900000000000002 3 22.125 25.6 28.575 23.7 4 24.675 31.15 21.325 22.85 5 27.05 33.7 19.75 19.5 6 21.875 35.949999999999996 20.275000000000002 21.9 7 21.349999999999998 18.975 36.9 22.775000000000002 8 22.775000000000002 22.650000000000002 25.575 28.999999999999996 9 22.8 23.474999999999998 27.525 26.200000000000003 10-14 25.96 26.525 23.46 24.055 15-19 25.174999999999997 26.174999999999997 24.93 23.72 20-24 25.705 25.885 24.740000000000002 23.669999999999998 25-29 25.924999999999997 25.624999999999996 24.6 23.849999999999998 30-34 25.235000000000003 26.290000000000003 25.014999999999997 23.46 35-39 25.369999999999997 25.91 24.79 23.93 40-44 25.97 26.06 24.33 23.64 45-49 25.569999999999997 26.26 24.905 23.265 50-54 25.814999999999998 25.979999999999997 24.884999999999998 23.32 55-59 26.064999999999998 25.905 24.37 23.66 60-64 25.505 25.55 25.040000000000003 23.905 65-69 25.81 25.345000000000002 25.365 23.48 70-74 25.95 25.345000000000002 25.180000000000003 23.525 75-79 26.095000000000002 25.230000000000004 25.185000000000002 23.49 80-84 25.72 25.715 24.834999999999997 23.73 85-89 25.83 25.55 25.330000000000002 23.29 90-94 24.959999999999997 26.045 25.5 23.494999999999997 95-99 25.35 26.56 24.725 23.365 100-104 25.755 26.19 25.019999999999996 23.035 105-109 25.165 25.979999999999997 25.259999999999998 23.595 110-114 26.025 25.545 25.264999999999997 23.165 115-119 26.05 25.650000000000002 25.155 23.145 120-124 26.165 26.26 24.39 23.185 125-129 25.61 26.495 25.145 22.75 130-134 26.355 26.064999999999998 24.87 22.71 135-139 26.33 26.340000000000003 24.935 22.395 140-144 26.495 26.875 24.4 22.23 145-149 26.76 26.3 24.485 22.455 150-151 26.85 26.8375 23.875 22.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.5 28 4.0 29 5.0 30 9.5 31 16.0 32 17.0 33 16.5 34 24.0 35 34.0 36 38.0 37 48.0 38 72.5 39 103.0 40 122.5 41 152.5 42 177.5 43 179.5 44 197.0 45 212.5 46 213.5 47 212.5 48 198.5 49 180.0 50 167.0 51 141.0 52 117.5 53 110.5 54 108.5 55 102.5 56 96.0 57 93.0 58 85.5 59 74.5 60 75.5 61 76.0 62 70.5 63 69.5 64 62.5 65 52.5 66 42.5 67 35.5 68 36.0 69 38.5 70 30.0 71 15.5 72 14.0 73 14.0 74 8.5 75 8.5 76 6.0 77 4.0 78 2.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGAAG 10 0.006830828 145.0 9 GGTCGTG 10 0.006830828 145.0 7 >>END_MODULE Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205373 spots for SRR6958181.sra Written 1205373 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra Read 1205367 spots for SRR6958181.sra Written 1205367 spots for SRR6958181.sra SRR ids: ['SRR6958181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipcccj0s SRR6958181.sra spots: 24107346 blocks: [[1, 1205367], [1205368, 2410734], [2410735, 3616101], [3616102, 4821468], [4821469, 6026835], [6026836, 7232202], [7232203, 8437569], [8437570, 9642936], [9642937, 10848303], [10848304, 12053670], [12053671, 13259037], [13259038, 14464404], [14464405, 15669771], [15669772, 16875138], [16875139, 18080505], [18080506, 19285872], [19285873, 20491239], [20491240, 21696606], [21696607, 22901973], [22901974, 24107346]] SRR6958181 file size 8147488 SRR6958181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958181 SRR6958181_1.fastq SRR6958181_2.fastq Input file: SRR6958181_1.fastq Paired file: SRR6958181_2.fastq trimmed: SRR6958181-trimmed-pair1.fastq, SRR6958181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:16:27 2024 >> started Fri Dec 6 15:17:04 2024 >> done (36.889s) 24107346 read pairs processed; of these: 24202 ( 0.10%) short read pairs filtered out after trimming by size control 24311 ( 0.10%) empty read pairs filtered out after trimming by size control 24058833 (99.80%) read pairs available; of these: 7776819 (32.32%) trimmed read pairs available after processing 16282014 (67.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 7 0.00% 23 9 0.00% 24 4 0.00% 25 4 0.00% 26 8 0.00% 27 7 0.00% 28 3 0.00% 29 11 0.00% 30 7 0.00% 31 8 0.00% 32 8 0.00% 33 5 0.00% 34 7 0.00% 35 13 0.00% 36 12 0.00% 37 7 0.00% 38 5 0.00% 39 14 0.00% 40 13 0.00% 41 16 0.00% 42 19 0.00% 43 10 0.00% 44 12 0.00% 45 19 0.00% 46 24 0.00% 47 17 0.00% 48 32 0.00% 49 32 0.00% 50 27 0.00% 51 43 0.00% 52 40 0.00% 53 31 0.00% 54 54 0.00% 55 69 0.00% 56 57 0.00% 57 65 0.00% 58 81 0.00% 59 102 0.00% 60 97 0.00% 61 121 0.00% 62 150 0.00% 63 179 0.00% 64 186 0.00% 65 189 0.00% 66 221 0.00% 67 254 0.00% 68 299 0.00% 69 357 0.00% 70 434 0.00% 71 499 0.00% 72 532 0.00% 73 637 0.00% 74 661 0.00% 75 759 0.00% 76 936 0.00% 77 1025 0.00% 78 1086 0.00% 79 1292 0.01% 80 1448 0.01% 81 1636 0.01% 82 1926 0.01% 83 2223 0.01% 84 3443 0.01% 85 4293 0.02% 86 4355 0.02% 87 4657 0.02% 88 4908 0.02% 89 4945 0.02% 90 5297 0.02% 91 5820 0.02% 92 6261 0.03% 93 6395 0.03% 94 7106 0.03% 95 7621 0.03% 96 7874 0.03% 97 8605 0.04% 98 8845 0.04% 99 9582 0.04% 100 10236 0.04% 101 10939 0.05% 102 11469 0.05% 103 12357 0.05% 104 13277 0.06% 105 13828 0.06% 106 14925 0.06% 107 15161 0.06% 108 16145 0.07% 109 17021 0.07% 110 17758 0.07% 111 18658 0.08% 112 19863 0.08% 113 21096 0.09% 114 22078 0.09% 115 23344 0.10% 116 24477 0.10% 117 25800 0.11% 118 26612 0.11% 119 27465 0.11% 120 28831 0.12% 121 29963 0.12% 122 31369 0.13% 123 33118 0.14% 124 34989 0.15% 125 36688 0.15% 126 38209 0.16% 127 39673 0.16% 128 41216 0.17% 129 42927 0.18% 130 45218 0.19% 131 46398 0.19% 132 49148 0.20% 133 51490 0.21% 134 54069 0.22% 135 57204 0.24% 136 60289 0.25% 137 63898 0.27% 138 66416 0.28% 139 71205 0.30% 140 75748 0.31% 141 81996 0.34% 142 89638 0.37% 143 99367 0.41% 144 112042 0.47% 145 131024 0.54% 146 158852 0.66% 147 209168 0.87% 148 309081 1.28% 149 612114 2.54% 150 4494888 18.68% 151 16282014 67.68% 24058833 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=3.2 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=36.65 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.1 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=94.21 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.6 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958181 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:17:51 Started mapping on | Dec 06 15:17:51 Finished on | Dec 06 15:20:04 Mapping speed, Million of reads per hour | 651.22 Number of input reads | 24058833 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23444850 Uniquely mapped reads % | 97.45% Average mapped length | 297.14 Number of splices: Total | 27822730 Number of splices: Annotated (sjdb) | 26226376 Number of splices: GT/AG | 27437150 Number of splices: GC/AG | 335443 Number of splices: AT/AC | 12716 Number of splices: Non-canonical | 37421 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253502 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 19441 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376590 376590 376590 N_multimapping 253502 253502 253502 N_noFeature 888579 22808007 1077726 N_ambiguous 544115 3136 98779 UnstrandedReadsAssigned:22012156 PositiveStrandReadsAssigned:633707 NegativeStrandReadsAssigned:22268345 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958181-trimmed-pair1.fastq SRR6958181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,058,833 reads, 22,312,324 reads pseudoaligned [quant] estimated average fragment length: 264.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR6958181.ke.tsv 35125 SRR6958181.se.tsv 88098 total ==> SRR6958181.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.979 0.753727 0.0756807 PNS24247 1044 780.499 71.9559 6.22969 PNS24249 1928 1664.5 56.5456 2.29555 PNS24246 1044 780.499 71.9559 6.22969 PNS24248 1044 780.499 71.9559 6.22969 PNS24244 1471 1207.5 45.8328 2.56485 PNS24243 293 84.3034 0 0 KQK14069 1603 1339.5 4339.61 218.917 KQK14071 474 225.576 106.653 31.9486 ==> SRR6958181.se.tsv <== BRADI_1g14170v3 5311 BRADI_1g53295v3 431 BRADI_1g59795v3 677 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 537 BRADI_1g74790v3 139 BRADI_1g09890v3 0 BRADI_1g77505v3 430 BRADI_1g48960v3 0 SRR6958181 completed mapping pipeline successfully