Starting /dee2/code/volunteer_pipeline.sh SRR6958182 current disk space = 1550412328960 free memory = 1603554684 SRR6958182 SRAfilesize ff676c924ccded37c784277972e6d235 SRR6958182.sra SRR6958182.sra file validated SRR6958182 is paired end SRR6958182 is conventional basespace SRR6958182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.2575 18.0 18.0 18.0 18.0 31.0 2 28.8075 29.0 27.0 31.0 27.0 33.0 3 30.862 31.0 29.0 33.0 27.0 33.0 4 30.3145 31.0 29.0 33.0 28.0 33.0 5 32.006 33.0 31.0 33.0 31.0 33.0 6 36.90225 38.0 37.0 38.0 35.0 38.0 7 37.495 38.0 38.0 38.0 37.0 38.0 8 37.61375 38.0 38.0 38.0 38.0 38.0 9 37.62175 38.0 38.0 38.0 38.0 38.0 10-14 37.462149999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.510450000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.5283 38.0 38.0 38.0 37.8 38.0 25-29 37.2752 38.0 38.0 38.0 37.0 38.0 30-34 37.42885 38.0 38.0 38.0 37.2 38.0 35-39 37.122550000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.565250000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.413149999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.304649999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.1943 38.0 38.0 38.0 36.4 38.0 60-64 37.3512 38.0 38.0 38.0 37.0 38.0 65-69 37.391949999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.26565 38.0 38.0 38.0 36.6 38.0 75-79 37.219049999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.16080000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.69185 38.0 38.0 38.0 34.8 38.0 90-94 36.0576 38.0 37.4 38.0 32.4 38.0 95-99 34.7401 38.0 34.8 38.0 26.0 38.0 100-104 35.8464 38.0 37.0 38.0 31.2 38.0 105-109 35.740899999999996 38.0 37.0 38.0 30.6 38.0 110-114 35.396550000000005 38.0 36.0 38.0 29.2 38.0 115-119 35.60695 38.0 36.2 38.0 31.0 38.0 120-124 35.598600000000005 38.0 36.4 38.0 30.4 38.0 125-129 35.2947 38.0 36.0 38.0 29.2 38.0 130-134 35.0094 38.0 35.8 38.0 28.0 38.0 135-139 34.24425 38.0 34.2 38.0 25.0 38.0 140-144 32.89325 38.0 32.2 38.0 18.4 38.0 145-149 32.229 38.0 32.6 38.0 11.0 38.0 150-151 26.301000000000002 33.0 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 2.0 22 8.0 23 9.0 24 11.0 25 14.0 26 19.0 27 29.0 28 27.0 29 41.0 30 60.0 31 72.0 32 105.0 33 145.0 34 235.0 35 409.0 36 1002.0 37 1804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.68879668049792 10.12448132780083 15.076071922544951 40.11065006915629 2 24.7 12.8 34.300000000000004 28.199999999999996 3 22.0 15.950000000000001 24.7 37.35 4 26.224999999999998 23.175 22.900000000000002 27.700000000000003 5 25.775 27.450000000000003 23.849999999999998 22.925 6 23.45 30.95 23.9 21.7 7 17.474999999999998 23.474999999999998 40.175 18.875 8 19.650000000000002 23.150000000000002 29.775000000000002 27.425 9 18.925 21.2 34.449999999999996 25.424999999999997 10-14 22.665 26.529999999999998 26.135 24.67 15-19 22.745 25.485000000000003 26.76 25.009999999999998 20-24 22.634999999999998 25.155 26.474999999999998 25.735000000000003 25-29 23.145 25.124999999999996 26.384999999999998 25.345000000000002 30-34 22.945 25.555 26.145000000000003 25.355 35-39 22.89 25.45 25.95 25.71 40-44 23.135 25.605 26.1 25.16 45-49 22.765 25.05 26.674999999999997 25.509999999999998 50-54 22.86 25.669999999999998 25.885 25.585 55-59 23.18 25.474999999999998 26.13 25.215 60-64 22.675 25.185000000000002 26.224999999999998 25.915 65-69 23.315 25.169999999999998 25.624999999999996 25.89 70-74 23.23 25.245 25.979999999999997 25.545 75-79 23.061153057652884 25.02125106255313 26.02630131506575 25.891294564728234 80-84 23.200000000000003 25.679999999999996 26.015 25.105 85-89 22.939999999999998 25.069999999999997 25.935000000000002 26.055 90-94 23.32 24.93 26.174999999999997 25.575 95-99 23.400000000000002 24.79 26.19 25.619999999999997 100-104 23.565 25.124999999999996 25.740000000000002 25.569999999999997 105-109 23.645 25.25 25.835 25.27 110-114 23.585 24.84 26.185000000000002 25.39 115-119 23.275000000000002 24.795 26.119999999999997 25.81 120-124 23.51 25.15 25.430000000000003 25.91 125-129 23.255 25.345000000000002 25.474999999999998 25.924999999999997 130-134 23.87 25.11 26.035000000000004 24.985 135-139 24.169999999999998 25.165 25.205 25.46 140-144 23.685000000000002 25.14 25.45 25.724999999999998 145-149 23.685000000000002 24.92 25.509999999999998 25.885 150-151 24.0 24.425 26.4625 25.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 1.0 27 3.5 28 5.5 29 4.5 30 4.5 31 8.0 32 12.5 33 20.0 34 27.0 35 34.5 36 52.5 37 66.0 38 80.5 39 100.5 40 130.0 41 158.5 42 182.5 43 195.5 44 200.0 45 215.5 46 215.0 47 201.5 48 204.0 49 200.0 50 166.0 51 141.0 52 132.0 53 117.5 54 105.0 55 103.0 56 97.5 57 87.0 58 77.0 59 79.0 60 85.0 61 70.0 62 64.5 63 60.5 64 47.0 65 44.5 66 34.5 67 28.5 68 33.5 69 28.0 70 16.0 71 14.0 72 14.0 73 9.5 74 7.5 75 5.5 76 2.5 77 1.5 78 0.5 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.65 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.112500000000001 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATAC 10 0.006841402 144.925 3 >>END_MODULE SRR6958182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0315 33.0 33.0 34.0 32.0 34.0 2 33.17425 34.0 33.0 34.0 33.0 34.0 3 33.148 34.0 33.0 34.0 33.0 34.0 4 33.0925 34.0 33.0 34.0 33.0 34.0 5 33.03425 34.0 33.0 34.0 32.0 34.0 6 37.247 38.0 38.0 38.0 37.0 38.0 7 37.2955 38.0 38.0 38.0 37.0 38.0 8 37.00275 38.0 38.0 38.0 37.0 38.0 9 37.109 38.0 38.0 38.0 37.0 38.0 10-14 36.946850000000005 38.0 38.0 38.0 36.0 38.0 15-19 37.01175 38.0 38.0 38.0 36.2 38.0 20-24 37.0499 38.0 38.0 38.0 36.8 38.0 25-29 37.188300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.25715 38.0 38.0 38.0 37.0 38.0 35-39 37.33004999999999 38.0 38.0 38.0 37.2 38.0 40-44 35.43725 38.0 35.4 38.0 28.2 38.0 45-49 35.5557 38.0 35.8 38.0 29.0 38.0 50-54 35.446299999999994 38.0 35.8 38.0 28.2 38.0 55-59 35.6131 38.0 35.8 38.0 29.4 38.0 60-64 36.636 38.0 37.8 38.0 34.6 38.0 65-69 36.11195 38.0 37.4 38.0 32.2 38.0 70-74 36.1651 38.0 37.8 38.0 32.8 38.0 75-79 36.33235 38.0 38.0 38.0 33.8 38.0 80-84 36.25325 38.0 38.0 38.0 33.8 38.0 85-89 36.04295 38.0 38.0 38.0 33.0 38.0 90-94 35.947050000000004 38.0 37.2 38.0 32.2 38.0 95-99 36.142 38.0 37.8 38.0 33.4 38.0 100-104 33.9911 37.4 31.0 38.0 25.6 38.0 105-109 35.838 38.0 37.0 38.0 32.2 38.0 110-114 35.58845 38.0 37.2 38.0 31.0 38.0 115-119 35.0331 38.0 36.4 38.0 28.6 38.0 120-124 30.94285 35.0 26.6 38.0 16.6 38.0 125-129 29.755499999999994 35.0 22.2 38.0 12.8 38.0 130-134 29.7534 34.8 24.0 38.0 12.4 38.0 135-139 32.567949999999996 37.8 32.4 38.0 14.4 38.0 140-144 31.196500000000004 37.2 30.0 38.0 12.4 38.0 145-149 30.155099999999997 36.8 27.8 38.0 3.8 38.0 150-151 23.876375 29.5 16.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 4.0 7 1.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 9.0 18 6.0 19 7.0 20 13.0 21 9.0 22 11.0 23 13.0 24 32.0 25 43.0 26 51.0 27 42.0 28 50.0 29 73.0 30 77.0 31 94.0 32 149.0 33 198.0 34 347.0 35 523.0 36 1178.0 37 1052.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 18.75 11.4 32.574999999999996 2 30.875000000000004 23.075000000000003 27.35 18.7 3 22.075 26.424999999999997 27.950000000000003 23.549999999999997 4 25.15 31.424999999999997 21.025 22.400000000000002 5 26.875 33.7 19.175 20.25 6 24.125 34.825 20.925 20.125 7 22.650000000000002 19.25 35.425000000000004 22.675 8 24.875 23.05 23.65 28.425 9 23.525 23.775 27.6 25.1 10-14 25.7 26.43 23.375 24.495 15-19 25.424999999999997 26.064999999999998 24.665 23.845 20-24 25.27 25.840000000000003 24.375 24.515 25-29 26.515 25.645 24.035 23.805 30-34 25.259999999999998 26.11 24.21 24.42 35-39 25.505 25.735000000000003 24.11 24.65 40-44 25.505 25.025 24.959999999999997 24.51 45-49 26.150000000000002 25.080000000000002 24.6 24.169999999999998 50-54 25.91 25.669999999999998 24.86 23.56 55-59 25.41 25.85 24.490000000000002 24.25 60-64 25.465 25.869999999999997 24.945 23.72 65-69 26.179999999999996 25.319999999999997 24.85 23.65 70-74 25.97 25.385 24.709999999999997 23.935000000000002 75-79 25.75 25.095 24.7 24.455 80-84 25.509999999999998 26.215 24.285 23.990000000000002 85-89 25.629999999999995 25.580000000000002 24.38 24.41 90-94 26.085 25.740000000000002 24.75 23.425 95-99 25.585 25.945 24.965 23.505000000000003 100-104 25.91 25.580000000000002 24.65 23.86 105-109 26.040000000000003 25.895000000000003 24.34 23.724999999999998 110-114 25.89 26.305 24.865000000000002 22.939999999999998 115-119 26.365 25.955000000000002 24.6 23.080000000000002 120-124 26.055 25.724999999999998 24.98 23.24 125-129 26.08130406520326 26.33131656582829 24.261213060653034 23.326166308315415 130-134 26.384999999999998 26.369999999999997 24.22 23.025000000000002 135-139 26.105 26.21 24.875 22.81 140-144 26.474999999999998 26.455000000000002 24.315 22.755 145-149 26.265 26.825 24.065 22.845 150-151 26.900000000000002 25.6 24.75 22.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 0.5 26 2.0 27 3.5 28 4.0 29 5.0 30 4.5 31 5.0 32 7.0 33 11.5 34 19.0 35 24.0 36 34.5 37 53.0 38 70.5 39 97.0 40 114.5 41 126.0 42 146.5 43 182.5 44 204.0 45 195.5 46 204.5 47 203.0 48 193.0 49 195.5 50 180.0 51 148.0 52 126.5 53 132.0 54 124.0 55 108.0 56 101.5 57 88.0 58 78.5 59 85.5 60 90.5 61 87.5 62 85.5 63 75.5 64 75.0 65 61.0 66 38.0 67 34.0 68 38.0 69 37.5 70 25.5 71 18.5 72 17.5 73 12.5 74 8.0 75 5.0 76 3.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85931558935361 97.5 2 0.988593155893536 1.95 3 0.10139416983523447 0.3 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.9749999999999999 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.8375 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAACTC 10 0.006830828 145.0 4 CTCAACT 10 0.006830828 145.0 2 AAAAAAA 20 0.00593511 29.0 15-19 >>END_MODULE Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838783 spots for SRR6958182.sra Written 838783 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra Read 838766 spots for SRR6958182.sra Written 838766 spots for SRR6958182.sra SRR ids: ['SRR6958182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fd22yk9t SRR6958182.sra spots: 16775337 blocks: [[1, 838766], [838767, 1677532], [1677533, 2516298], [2516299, 3355064], [3355065, 4193830], [4193831, 5032596], [5032597, 5871362], [5871363, 6710128], [6710129, 7548894], [7548895, 8387660], [8387661, 9226426], [9226427, 10065192], [10065193, 10903958], [10903959, 11742724], [11742725, 12581490], [12581491, 13420256], [13420257, 14259022], [14259023, 15097788], [15097789, 15936554], [15936555, 16775337]] SRR6958182 file size 5662910 SRR6958182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958182 SRR6958182_1.fastq SRR6958182_2.fastq Input file: SRR6958182_1.fastq Paired file: SRR6958182_2.fastq trimmed: SRR6958182-trimmed-pair1.fastq, SRR6958182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:15:57 2024 >> started Fri Dec 6 15:16:23 2024 >> done (26.165s) 16775337 read pairs processed; of these: 10275 ( 0.06%) short read pairs filtered out after trimming by size control 9764 ( 0.06%) empty read pairs filtered out after trimming by size control 16755298 (99.88%) read pairs available; of these: 7547595 (45.05%) trimmed read pairs available after processing 9207703 (54.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 7 0.00% 31 2 0.00% 32 9 0.00% 33 2 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 8 0.00% 38 13 0.00% 39 13 0.00% 40 9 0.00% 41 14 0.00% 42 11 0.00% 43 9 0.00% 44 11 0.00% 45 16 0.00% 46 15 0.00% 47 26 0.00% 48 20 0.00% 49 28 0.00% 50 27 0.00% 51 29 0.00% 52 30 0.00% 53 45 0.00% 54 44 0.00% 55 41 0.00% 56 60 0.00% 57 70 0.00% 58 77 0.00% 59 97 0.00% 60 95 0.00% 61 106 0.00% 62 130 0.00% 63 159 0.00% 64 144 0.00% 65 197 0.00% 66 224 0.00% 67 226 0.00% 68 268 0.00% 69 310 0.00% 70 392 0.00% 71 412 0.00% 72 527 0.00% 73 571 0.00% 74 688 0.00% 75 743 0.00% 76 837 0.00% 77 979 0.01% 78 1027 0.01% 79 1161 0.01% 80 1313 0.01% 81 1522 0.01% 82 1699 0.01% 83 2051 0.01% 84 2583 0.02% 85 3017 0.02% 86 3240 0.02% 87 3619 0.02% 88 3732 0.02% 89 3938 0.02% 90 4280 0.03% 91 4511 0.03% 92 4839 0.03% 93 5315 0.03% 94 5860 0.03% 95 6139 0.04% 96 6739 0.04% 97 6988 0.04% 98 7303 0.04% 99 7756 0.05% 100 8432 0.05% 101 8674 0.05% 102 9503 0.06% 103 10345 0.06% 104 10753 0.06% 105 11432 0.07% 106 12028 0.07% 107 12712 0.08% 108 13188 0.08% 109 14025 0.08% 110 14493 0.09% 111 15109 0.09% 112 16181 0.10% 113 17099 0.10% 114 17879 0.11% 115 19015 0.11% 116 19785 0.12% 117 20881 0.12% 118 21519 0.13% 119 22139 0.13% 120 23697 0.14% 121 24331 0.15% 122 25316 0.15% 123 27217 0.16% 124 28787 0.17% 125 29912 0.18% 126 31429 0.19% 127 32988 0.20% 128 34106 0.20% 129 36153 0.22% 130 37769 0.23% 131 39820 0.24% 132 41954 0.25% 133 44640 0.27% 134 47230 0.28% 135 49722 0.30% 136 52766 0.31% 137 56106 0.33% 138 59820 0.36% 139 64245 0.38% 140 68682 0.41% 141 74336 0.44% 142 83777 0.50% 143 93849 0.56% 144 108149 0.65% 145 129346 0.77% 146 161296 0.96% 147 222169 1.33% 148 341806 2.04% 149 702501 4.19% 150 4382059 26.15% 151 9207703 54.95% 16755298 reads passed initial QC criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=17 prefix-density=1.12 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=33.08 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=18 prefix-density=0.78 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=61.72 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958182 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:17:25 Started mapping on | Dec 06 15:17:27 Finished on | Dec 06 15:19:08 Mapping speed, Million of reads per hour | 597.22 Number of input reads | 16755298 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16122550 Uniquely mapped reads % | 96.22% Average mapped length | 296.11 Number of splices: Total | 18974913 Number of splices: Annotated (sjdb) | 17879189 Number of splices: GT/AG | 18725117 Number of splices: GC/AG | 222656 Number of splices: AT/AC | 6809 Number of splices: Non-canonical | 20331 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161972 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 23574 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477764 477764 477764 N_multimapping 161972 161972 161972 N_noFeature 526953 15668855 654329 N_ambiguous 392128 2279 67317 UnstrandedReadsAssigned:15203469 PositiveStrandReadsAssigned:451416 NegativeStrandReadsAssigned:15400904 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958182-trimmed-pair1.fastq SRR6958182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,755,298 reads, 15,422,148 reads pseudoaligned [quant] estimated average fragment length: 270.143 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958182.ke.tsv 35125 SRR6958182.se.tsv 88098 total ==> SRR6958182.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.379 0 0 PNS24247 1044 774.857 55.0913 6.83063 PNS24249 1928 1658.86 22.1388 1.28216 PNS24246 1044 774.857 55.0913 6.83063 PNS24248 1044 774.857 55.0913 6.83063 PNS24244 1471 1201.86 16.5873 1.32593 PNS24243 293 86.407 0 0 KQK14069 1603 1333.86 4335.55 312.272 KQK14071 474 225.296 43.0895 18.3745 ==> SRR6958182.se.tsv <== BRADI_1g14170v3 4762 BRADI_1g53295v3 166 BRADI_1g59795v3 137 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 184 BRADI_1g74790v3 49 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 1 SRR6958182 completed mapping pipeline successfully