Starting /dee2/code/volunteer_pipeline.sh SRR6958183 current disk space = 1550394470400 free memory = 1603452224 SRR6958183 SRAfilesize f64e0a85e22b5da8ab29e2fcd2cf323d SRR6958183.sra SRR6958183.sra file validated SRR6958183 is paired end SRR6958183 is conventional basespace SRR6958183 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.91725 33.0 32.0 33.0 27.0 34.0 2 31.8005 33.0 31.0 33.0 28.0 34.0 3 31.88475 33.0 31.0 33.0 28.0 34.0 4 31.675 33.0 31.0 33.0 29.0 34.0 5 32.02675 33.0 32.0 33.0 31.0 34.0 6 36.0675 38.0 36.0 38.0 33.0 38.0 7 36.66725 38.0 37.0 38.0 34.0 38.0 8 36.992 38.0 38.0 38.0 35.0 38.0 9 37.117 38.0 38.0 38.0 36.0 38.0 10-14 37.17725 38.0 38.0 38.0 36.2 38.0 15-19 37.2008 38.0 38.0 38.0 36.4 38.0 20-24 37.313300000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.202999999999996 38.0 38.0 38.0 36.4 38.0 30-34 36.982749999999996 38.0 38.0 38.0 35.6 38.0 35-39 36.90625 38.0 38.0 38.0 35.6 38.0 40-44 36.81845 38.0 38.0 38.0 35.0 38.0 45-49 36.9257 38.0 38.0 38.0 35.0 38.0 50-54 36.9298 38.0 38.0 38.0 35.4 38.0 55-59 36.709649999999996 38.0 38.0 38.0 34.4 38.0 60-64 36.790350000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.7162 38.0 38.0 38.0 34.2 38.0 70-74 36.7943 38.0 38.0 38.0 34.6 38.0 75-79 36.69995 38.0 38.0 38.0 34.6 38.0 80-84 36.275949999999995 38.0 37.2 38.0 33.4 38.0 85-89 36.22879999999999 38.0 37.0 38.0 33.2 38.0 90-94 36.3187 38.0 37.2 38.0 33.6 38.0 95-99 36.3286 38.0 37.6 38.0 33.4 38.0 100-104 36.036950000000004 38.0 37.0 38.0 32.2 38.0 105-109 35.6348 38.0 36.0 38.0 30.2 38.0 110-114 35.632000000000005 38.0 36.0 38.0 30.4 38.0 115-119 35.557249999999996 38.0 36.0 38.0 30.6 38.0 120-124 35.4171 38.0 35.6 38.0 29.4 38.0 125-129 34.9885 38.0 35.0 38.0 28.0 38.0 130-134 34.88195 38.0 35.0 38.0 27.8 38.0 135-139 34.43035 38.0 34.8 38.0 25.4 38.0 140-144 34.10385 38.0 34.6 38.0 23.8 38.0 145-149 33.0822 38.0 33.8 38.0 17.6 38.0 150-151 28.420625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 1.0 20 3.0 21 3.0 22 3.0 23 8.0 24 6.0 25 14.0 26 22.0 27 28.0 28 43.0 29 43.0 30 71.0 31 89.0 32 124.0 33 178.0 34 228.0 35 362.0 36 819.0 37 1953.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65873836608066 9.53981385729059 9.565667011375387 41.23578076525336 2 22.828535669586984 12.565707133917398 35.14392991239049 29.46182728410513 3 21.775 14.899999999999999 24.975 38.35 4 24.6 21.9 24.15 29.349999999999998 5 26.922113698973206 25.444527923866765 24.04207362885049 23.59128474830954 6 23.974999999999998 31.724999999999998 22.975 21.325 7 17.925 25.0 36.975 20.1 8 20.1 23.724999999999998 30.25 25.924999999999997 9 18.95 22.7 33.15 25.2 10-14 22.55 26.33 26.1 25.019999999999996 15-19 22.795 25.28 26.085 25.840000000000003 20-24 22.465 25.169999999999998 26.56 25.805 25-29 23.18 24.82 26.435 25.564999999999998 30-34 22.985 25.44 25.72 25.855 35-39 22.925 24.9 26.179999999999996 25.995 40-44 23.799999999999997 25.095 25.83 25.275 45-49 23.16 25.025 25.685000000000002 26.13 50-54 22.985 25.069999999999997 25.569999999999997 26.375 55-59 23.3 25.314999999999998 25.365 26.02 60-64 23.205000000000002 24.46 25.835 26.5 65-69 23.325000000000003 24.67 26.334999999999997 25.669999999999998 70-74 23.18 24.435000000000002 25.715 26.669999999999998 75-79 23.855 24.165 26.224999999999998 25.755 80-84 23.794999999999998 25.285000000000004 25.385 25.535000000000004 85-89 23.9 25.345000000000002 25.045 25.71 90-94 23.830000000000002 24.47 25.53 26.169999999999998 95-99 23.82 25.014999999999997 25.619999999999997 25.545 100-104 23.755000000000003 25.080000000000002 25.385 25.779999999999998 105-109 24.235 24.755 25.25 25.759999999999998 110-114 23.615 25.31 25.435000000000002 25.64 115-119 24.305 24.97 25.245 25.480000000000004 120-124 23.651182559127957 24.581229061453072 25.43127156357818 26.336316815840792 125-129 23.7 24.43 26.095000000000002 25.775 130-134 24.09 24.095 25.94 25.874999999999996 135-139 24.575 24.355 25.480000000000004 25.590000000000003 140-144 23.865 24.585 25.424999999999997 26.125 145-149 23.92239223922392 24.987498749874987 25.352535253525353 25.73757375737574 150-151 23.95194593918158 25.215867851332753 25.31598047803779 25.516205731447876 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.5 29 3.5 30 4.0 31 7.0 32 10.0 33 12.0 34 24.0 35 36.5 36 45.5 37 58.0 38 84.0 39 105.5 40 122.0 41 138.5 42 169.5 43 203.0 44 198.5 45 198.5 46 207.5 47 202.0 48 195.0 49 186.5 50 176.5 51 156.0 52 127.5 53 116.5 54 116.0 55 107.0 56 94.0 57 88.5 58 90.0 59 86.5 60 72.0 61 60.5 62 59.5 63 57.0 64 53.0 65 49.0 66 40.0 67 34.5 68 32.5 69 31.0 70 27.5 71 22.0 72 21.5 73 18.5 74 14.5 75 11.5 76 6.5 77 6.5 78 4.0 79 2.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.125 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04016165698408 98.02499999999999 2 0.8840616317251832 1.7500000000000002 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.05 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAGTC 10 0.006836113 144.9625 9 >>END_MODULE SRR6958183 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82225 33.0 33.0 34.0 32.0 34.0 2 32.8345 33.0 33.0 34.0 32.0 34.0 3 32.82525 33.0 33.0 34.0 32.0 34.0 4 32.78275 34.0 33.0 34.0 32.0 34.0 5 32.77175 34.0 33.0 34.0 32.0 34.0 6 36.92175 38.0 38.0 38.0 35.0 38.0 7 36.91225 38.0 38.0 38.0 35.0 38.0 8 36.92275 38.0 38.0 38.0 36.0 38.0 9 36.85275 38.0 38.0 38.0 35.0 38.0 10-14 36.743900000000004 38.0 38.0 38.0 34.6 38.0 15-19 36.63925 38.0 38.0 38.0 34.4 38.0 20-24 36.63755 38.0 38.0 38.0 34.6 38.0 25-29 36.800149999999995 38.0 38.0 38.0 35.2 38.0 30-34 36.86405 38.0 38.0 38.0 35.8 38.0 35-39 36.737899999999996 38.0 38.0 38.0 35.4 38.0 40-44 36.6306 38.0 38.0 38.0 34.8 38.0 45-49 36.58715 38.0 38.0 38.0 34.8 38.0 50-54 36.5649 38.0 38.0 38.0 34.6 38.0 55-59 36.6434 38.0 38.0 38.0 34.8 38.0 60-64 36.61495 38.0 38.0 38.0 34.8 38.0 65-69 36.43015 38.0 38.0 38.0 34.0 38.0 70-74 36.38375 38.0 38.0 38.0 34.0 38.0 75-79 36.344 38.0 38.0 38.0 33.8 38.0 80-84 36.10845 38.0 37.8 38.0 33.0 38.0 85-89 35.9199 38.0 37.6 38.0 32.2 38.0 90-94 35.8731 38.0 37.0 38.0 31.8 38.0 95-99 35.7866 38.0 37.0 38.0 31.6 38.0 100-104 35.7362 38.0 37.0 38.0 31.2 38.0 105-109 35.448750000000004 38.0 36.4 38.0 30.2 38.0 110-114 35.135250000000006 38.0 36.0 38.0 28.6 38.0 115-119 35.187949999999994 38.0 36.0 38.0 28.6 38.0 120-124 35.09760000000001 38.0 35.6 38.0 28.4 38.0 125-129 34.94055 38.0 35.0 38.0 27.8 38.0 130-134 34.499199999999995 38.0 35.0 38.0 25.4 38.0 135-139 34.1083 38.0 34.4 38.0 23.6 38.0 140-144 33.917899999999996 38.0 34.2 38.0 23.0 38.0 145-149 33.1948 38.0 33.8 38.0 18.2 38.0 150-151 28.765 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 3.0 5 3.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 4.0 14 2.0 15 2.0 16 4.0 17 2.0 18 0.0 19 3.0 20 6.0 21 8.0 22 5.0 23 11.0 24 15.0 25 20.0 26 21.0 27 30.0 28 38.0 29 50.0 30 72.0 31 89.0 32 117.0 33 153.0 34 197.0 35 318.0 36 663.0 37 2146.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.3 18.725 12.225 33.75 2 30.375000000000004 23.7 26.625 19.3 3 22.775000000000002 24.725 27.775 24.725 4 26.063031515757878 30.06503251625813 19.759879939969984 24.112056028014006 5 27.1 31.424999999999997 20.9 20.575 6 23.549999999999997 35.699999999999996 20.5 20.25 7 24.2 19.5 33.85 22.45 8 23.974999999999998 23.5 24.75 27.775 9 24.25 22.375 27.825 25.55 10-14 25.61 26.16 23.36 24.87 15-19 25.825 25.41 24.275 24.490000000000002 20-24 25.924999999999997 25.945 23.830000000000002 24.3 25-29 26.235000000000003 25.31 23.925 24.529999999999998 30-34 25.8 25.97 24.03 24.2 35-39 26.68 26.325 23.365 23.630000000000003 40-44 26.185000000000002 25.474999999999998 23.815 24.525 45-49 25.95 25.285000000000004 23.82 24.945 50-54 26.119999999999997 25.77 24.135 23.974999999999998 55-59 26.26 25.314999999999998 23.73 24.695 60-64 25.66 25.095 24.404999999999998 24.84 65-69 26.265 24.625 24.93 24.18 70-74 26.05 25.45 23.615 24.884999999999998 75-79 26.05 25.014999999999997 24.25 24.685000000000002 80-84 26.135 25.66 23.815 24.39 85-89 26.055 25.665 23.830000000000002 24.45 90-94 25.900000000000002 25.385 24.335 24.38 95-99 26.495 25.19 24.13 24.185000000000002 100-104 26.27 25.96 24.165 23.605 105-109 25.624999999999996 25.83 24.665 23.880000000000003 110-114 26.119999999999997 26.1 23.735 24.044999999999998 115-119 26.754364027409594 25.208823088080827 24.363527234532086 23.67328564997749 120-124 26.187618761876188 25.922592259225922 23.957395739573958 23.932393239323932 125-129 25.646282314115705 26.216310815540776 24.17620881044052 23.961198059902994 130-134 26.672667266726673 25.322532253225322 24.427442744274426 23.577357735773578 135-139 26.36527305461092 25.170034006801362 25.01000200040008 23.454690938187635 140-144 26.55765576557656 26.127612761276126 24.172417241724172 23.142314231423143 145-149 26.888066419925977 25.88776632989897 24.642392717815344 22.58177453235971 150-151 26.176176176176174 26.213713713713716 24.574574574574577 23.035535535535537 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.0 28 1.0 29 2.5 30 4.0 31 5.0 32 7.5 33 11.0 34 17.5 35 27.5 36 35.0 37 53.0 38 72.5 39 86.0 40 116.0 41 136.5 42 149.0 43 173.0 44 176.0 45 173.0 46 190.5 47 193.0 48 184.0 49 178.0 50 160.5 51 153.0 52 146.0 53 127.5 54 121.5 55 120.5 56 108.0 57 105.5 58 94.5 59 98.0 60 91.0 61 66.5 62 74.0 63 71.0 64 61.5 65 54.5 66 53.0 67 54.0 68 51.5 69 47.0 70 35.0 71 26.0 72 22.0 73 17.0 74 14.0 75 12.5 76 8.0 77 5.0 78 5.5 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.034999999999999996 120-124 0.01 125-129 0.005 130-134 0.01 135-139 0.02 140-144 0.01 145-149 0.03 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01140684410646 97.65 2 0.7351077313054499 1.4500000000000002 3 0.1520912547528517 0.44999999999999996 4 0.07604562737642585 0.3 5 0.0 0.0 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.05 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.4375 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGCGG 10 0.006830828 145.0 7 >>END_MODULE Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256792 spots for SRR6958183.sra Written 1256792 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra Read 1256790 spots for SRR6958183.sra Written 1256790 spots for SRR6958183.sra SRR ids: ['SRR6958183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s6_sgk7f SRR6958183.sra spots: 25135802 blocks: [[1, 1256790], [1256791, 2513580], [2513581, 3770370], [3770371, 5027160], [5027161, 6283950], [6283951, 7540740], [7540741, 8797530], [8797531, 10054320], [10054321, 11311110], [11311111, 12567900], [12567901, 13824690], [13824691, 15081480], [15081481, 16338270], [16338271, 17595060], [17595061, 18851850], [18851851, 20108640], [20108641, 21365430], [21365431, 22622220], [22622221, 23879010], [23879011, 25135802]] SRR6958183 file size 8495998 SRR6958183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958183 SRR6958183_1.fastq SRR6958183_2.fastq Input file: SRR6958183_1.fastq Paired file: SRR6958183_2.fastq trimmed: SRR6958183-trimmed-pair1.fastq, SRR6958183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:25:35 2024 >> started Fri Dec 6 15:26:00 2024 >> done (25.315s) 25135802 read pairs processed; of these: 18003 ( 0.07%) short read pairs filtered out after trimming by size control 15176 ( 0.06%) empty read pairs filtered out after trimming by size control 25102623 (99.87%) read pairs available; of these: 8913395 (35.51%) trimmed read pairs available after processing 16189228 (64.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 8 0.00% 21 5 0.00% 22 10 0.00% 23 6 0.00% 24 6 0.00% 25 12 0.00% 26 10 0.00% 27 3 0.00% 28 12 0.00% 29 10 0.00% 30 8 0.00% 31 10 0.00% 32 9 0.00% 33 7 0.00% 34 15 0.00% 35 14 0.00% 36 16 0.00% 37 18 0.00% 38 21 0.00% 39 23 0.00% 40 20 0.00% 41 18 0.00% 42 21 0.00% 43 20 0.00% 44 34 0.00% 45 17 0.00% 46 34 0.00% 47 34 0.00% 48 32 0.00% 49 29 0.00% 50 34 0.00% 51 50 0.00% 52 56 0.00% 53 46 0.00% 54 66 0.00% 55 65 0.00% 56 83 0.00% 57 87 0.00% 58 81 0.00% 59 100 0.00% 60 122 0.00% 61 135 0.00% 62 161 0.00% 63 149 0.00% 64 188 0.00% 65 197 0.00% 66 231 0.00% 67 241 0.00% 68 255 0.00% 69 326 0.00% 70 341 0.00% 71 368 0.00% 72 430 0.00% 73 517 0.00% 74 553 0.00% 75 615 0.00% 76 709 0.00% 77 769 0.00% 78 888 0.00% 79 1040 0.00% 80 1096 0.00% 81 1231 0.00% 82 1357 0.01% 83 1632 0.01% 84 2574 0.01% 85 3197 0.01% 86 3361 0.01% 87 3436 0.01% 88 3490 0.01% 89 3684 0.01% 90 4041 0.02% 91 4255 0.02% 92 4638 0.02% 93 5024 0.02% 94 5280 0.02% 95 5854 0.02% 96 6243 0.02% 97 6679 0.03% 98 7191 0.03% 99 7653 0.03% 100 8047 0.03% 101 8772 0.03% 102 9469 0.04% 103 10212 0.04% 104 10829 0.04% 105 11394 0.05% 106 12265 0.05% 107 13045 0.05% 108 13591 0.05% 109 14724 0.06% 110 15248 0.06% 111 16044 0.06% 112 17134 0.07% 113 17779 0.07% 114 19460 0.08% 115 20821 0.08% 116 21888 0.09% 117 22764 0.09% 118 24328 0.10% 119 25545 0.10% 120 26598 0.11% 121 28072 0.11% 122 29202 0.12% 123 30994 0.12% 124 32211 0.13% 125 34409 0.14% 126 36270 0.14% 127 37946 0.15% 128 40094 0.16% 129 42266 0.17% 130 44280 0.18% 131 46974 0.19% 132 49335 0.20% 133 53045 0.21% 134 55720 0.22% 135 59494 0.24% 136 63344 0.25% 137 67636 0.27% 138 71799 0.29% 139 78075 0.31% 140 84687 0.34% 141 91985 0.37% 142 103126 0.41% 143 116249 0.46% 144 134592 0.54% 145 163119 0.65% 146 202619 0.81% 147 275137 1.10% 148 427741 1.70% 149 877374 3.50% 150 5104328 20.33% 151 16189228 64.49% 25102623 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=3.4 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=37.44 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=58.64 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=11.1 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958183 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:26:49 Started mapping on | Dec 06 15:26:51 Finished on | Dec 06 15:28:28 Mapping speed, Million of reads per hour | 931.64 Number of input reads | 25102623 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24243245 Uniquely mapped reads % | 96.58% Average mapped length | 297.71 Number of splices: Total | 28222317 Number of splices: Annotated (sjdb) | 26630088 Number of splices: GT/AG | 27862944 Number of splices: GC/AG | 328603 Number of splices: AT/AC | 10967 Number of splices: Non-canonical | 19803 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327987 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 56163 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 1.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542148 542148 542148 N_multimapping 327987 327987 327987 N_noFeature 857770 23572211 1032568 N_ambiguous 591469 3059 96333 UnstrandedReadsAssigned:22794006 PositiveStrandReadsAssigned:667975 NegativeStrandReadsAssigned:23114344 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958183-trimmed-pair1.fastq SRR6958183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,102,623 reads, 23,198,418 reads pseudoaligned [quant] estimated average fragment length: 266.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR6958183.ke.tsv 35125 SRR6958183.se.tsv 88098 total ==> SRR6958183.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.654 0 0 PNS24247 1044 778.108 98.6709 7.5969 PNS24249 1928 1662.11 42.9589 1.54839 PNS24246 1044 778.108 98.6709 7.5969 PNS24248 1044 778.108 98.6709 7.5969 PNS24244 1471 1205.11 55.0285 2.73558 PNS24243 293 80.4053 0 0 KQK14069 1603 1337.11 8440.41 378.168 KQK14071 474 221.772 100.195 27.0663 ==> SRR6958183.se.tsv <== BRADI_1g14170v3 9242 BRADI_1g53295v3 313 BRADI_1g59795v3 322 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 376 BRADI_1g74790v3 129 BRADI_1g09890v3 1 BRADI_1g77505v3 412 BRADI_1g48960v3 0 SRR6958183 completed mapping pipeline successfully