Starting /dee2/code/volunteer_pipeline.sh SRR6958184 current disk space = 1550394036224 free memory = 1601804112 SRR6958184 SRAfilesize fd95703d98da564bbb2c7285105f9b95 SRR6958184.sra SRR6958184.sra file validated SRR6958184 is paired end SRR6958184 is conventional basespace SRR6958184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.4385 18.0 18.0 27.0 18.0 32.0 2 24.0195 25.0 18.0 29.0 18.0 31.0 3 27.3075 29.0 25.0 31.0 18.0 33.0 4 31.15975 32.0 32.0 33.0 27.0 33.0 5 31.97225 33.0 32.0 33.0 31.0 33.0 6 36.3415 37.0 36.0 38.0 34.0 38.0 7 37.2455 38.0 38.0 38.0 36.0 38.0 8 37.612 38.0 38.0 38.0 37.0 38.0 9 37.57075 38.0 38.0 38.0 38.0 38.0 10-14 37.5099 38.0 38.0 38.0 37.8 38.0 15-19 37.500099999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.468450000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.03145 38.0 38.0 38.0 35.6 38.0 30-34 37.422450000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.448750000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.35875 38.0 38.0 38.0 37.0 38.0 45-49 37.34405 38.0 38.0 38.0 37.0 38.0 50-54 37.2737 38.0 38.0 38.0 37.0 38.0 55-59 37.37135 38.0 38.0 38.0 37.0 38.0 60-64 37.3563 38.0 38.0 38.0 37.0 38.0 65-69 37.329699999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.25975 38.0 38.0 38.0 36.6 38.0 75-79 37.33665 38.0 38.0 38.0 37.0 38.0 80-84 37.2657 38.0 38.0 38.0 36.6 38.0 85-89 36.86065 38.0 38.0 38.0 35.0 38.0 90-94 35.774750000000004 38.0 37.0 38.0 31.2 38.0 95-99 36.03205 38.0 37.0 38.0 31.8 38.0 100-104 35.84905 38.0 37.2 38.0 31.4 38.0 105-109 35.982600000000005 38.0 37.2 38.0 32.4 38.0 110-114 35.93645 38.0 37.2 38.0 32.2 38.0 115-119 36.188950000000006 38.0 37.6 38.0 33.4 38.0 120-124 36.42975 38.0 38.0 38.0 34.0 38.0 125-129 36.49595 38.0 38.0 38.0 34.0 38.0 130-134 36.278800000000004 38.0 37.8 38.0 33.8 38.0 135-139 36.1813 38.0 37.6 38.0 33.6 38.0 140-144 35.09205 38.0 35.0 38.0 29.0 38.0 145-149 34.34055 38.0 34.4 38.0 27.0 38.0 150-151 31.323249999999998 36.5 30.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 5.0 19 1.0 20 0.0 21 0.0 22 3.0 23 5.0 24 4.0 25 8.0 26 12.0 27 14.0 28 21.0 29 26.0 30 41.0 31 48.0 32 74.0 33 116.0 34 191.0 35 333.0 36 861.0 37 2234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.87378640776699 21.63661581137309 8.488210818307905 39.00138696255201 2 24.4 12.65 32.05 30.9 3 21.525 18.224999999999998 23.65 36.6 4 27.825 23.45 20.325 28.4 5 26.35 27.474999999999998 24.05 22.125 6 22.475 32.5 23.599999999999998 21.425 7 17.175 22.2 40.975 19.650000000000002 8 22.25 22.25 29.125 26.375 9 20.25 20.875 33.800000000000004 25.074999999999996 10-14 22.7 26.240000000000002 25.83 25.230000000000004 15-19 23.03 25.095 25.814999999999998 26.06 20-24 22.78113905695285 25.29626481324066 26.671333566678335 25.251262563128158 25-29 23.005 24.81 26.68 25.505 30-34 22.63 25.35 26.450000000000003 25.569999999999997 35-39 23.395 24.995 26.179999999999996 25.430000000000003 40-44 23.29 25.56 25.805 25.345000000000002 45-49 22.650000000000002 25.645 26.0 25.705 50-54 23.59 25.3 25.445 25.665 55-59 23.14 25.0 26.11 25.75 60-64 23.34 25.61 25.755 25.295 65-69 23.195 25.435000000000002 25.945 25.424999999999997 70-74 23.055 25.095 25.885 25.965 75-79 23.135 24.67 26.235000000000003 25.96 80-84 23.830000000000002 24.905 26.040000000000003 25.224999999999998 85-89 23.57 24.735 26.150000000000002 25.545 90-94 23.565 25.15 25.650000000000002 25.635 95-99 23.51 24.610000000000003 26.1 25.779999999999998 100-104 23.74 24.2 26.255 25.805 105-109 23.91 24.98 25.069999999999997 26.040000000000003 110-114 23.845 25.119999999999997 25.7 25.335 115-119 23.549999999999997 25.14 25.590000000000003 25.72 120-124 24.29 24.805 25.324999999999996 25.580000000000002 125-129 23.669999999999998 24.555 26.384999999999998 25.39 130-134 23.9 24.615000000000002 26.055 25.430000000000003 135-139 24.175 24.755 25.47 25.6 140-144 24.075 25.27 25.25 25.405 145-149 23.91 25.35 25.035 25.705 150-151 23.6375 25.112499999999997 24.887500000000003 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 3.0 29 3.5 30 7.0 31 13.0 32 15.5 33 20.5 34 28.5 35 43.5 36 50.0 37 52.5 38 78.0 39 106.5 40 130.5 41 146.0 42 170.5 43 212.5 44 223.5 45 213.5 46 209.5 47 194.5 48 185.5 49 174.0 50 158.5 51 149.0 52 130.5 53 115.5 54 107.0 55 105.0 56 98.0 57 82.5 58 72.0 59 75.5 60 79.5 61 71.5 62 58.5 63 57.5 64 61.5 65 51.5 66 44.5 67 42.5 68 29.5 69 21.0 70 23.5 71 22.0 72 14.5 73 13.5 74 13.0 75 6.5 76 3.0 77 2.5 78 2.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACTT 10 0.004973884 161.00002 1 TCAGGAG 10 0.0068449317 144.90001 8 CAGGAGA 10 0.0068449317 144.90001 9 GTAGCAG 10 0.0068449317 144.90001 145 GGTAAGA 10 0.0068449317 144.90001 145 >>END_MODULE SRR6958184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.087 33.0 33.0 34.0 32.0 34.0 2 33.208 34.0 33.0 34.0 33.0 34.0 3 33.20075 34.0 33.0 34.0 33.0 34.0 4 33.157 34.0 33.0 34.0 33.0 34.0 5 33.016 34.0 33.0 34.0 32.0 34.0 6 37.19375 38.0 38.0 38.0 37.0 38.0 7 37.323 38.0 38.0 38.0 37.0 38.0 8 37.19475 38.0 38.0 38.0 37.0 38.0 9 37.261 38.0 38.0 38.0 37.0 38.0 10-14 36.8254 38.0 38.0 38.0 35.4 38.0 15-19 36.82889999999999 38.0 38.0 38.0 35.4 38.0 20-24 36.80695 38.0 38.0 38.0 35.8 38.0 25-29 36.94745 38.0 38.0 38.0 36.2 38.0 30-34 36.82325 38.0 38.0 38.0 35.2 38.0 35-39 37.1922 38.0 38.0 38.0 36.8 38.0 40-44 36.925050000000006 38.0 37.8 38.0 35.2 38.0 45-49 36.451350000000005 38.0 37.8 38.0 33.0 38.0 50-54 36.18814999999999 38.0 36.2 38.0 32.2 38.0 55-59 36.36645 38.0 37.4 38.0 33.6 38.0 60-64 33.87435 37.2 31.8 38.0 24.6 38.0 65-69 36.63975000000001 38.0 37.8 38.0 35.0 38.0 70-74 35.872949999999996 38.0 37.2 38.0 31.2 38.0 75-79 36.24375 38.0 37.8 38.0 33.4 38.0 80-84 34.62515 37.8 34.2 38.0 27.4 38.0 85-89 35.829449999999994 38.0 37.4 38.0 31.2 38.0 90-94 36.30265 38.0 38.0 38.0 33.4 38.0 95-99 34.5628 37.4 31.8 38.0 28.4 38.0 100-104 36.33225 38.0 37.2 38.0 33.4 38.0 105-109 36.51135000000001 38.0 38.0 38.0 34.8 38.0 110-114 36.01525 38.0 38.0 38.0 33.4 38.0 115-119 35.920550000000006 38.0 37.6 38.0 33.0 38.0 120-124 35.2618 38.0 36.6 38.0 29.2 38.0 125-129 34.30105 38.0 34.4 38.0 24.0 38.0 130-134 34.5651 38.0 34.8 38.0 24.4 38.0 135-139 35.39555 38.0 36.2 38.0 30.8 38.0 140-144 34.55415000000001 38.0 34.6 38.0 25.8 38.0 145-149 34.76915 38.0 36.0 38.0 30.2 38.0 150-151 30.114375 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 3.0 5 1.0 6 2.0 7 1.0 8 0.0 9 2.0 10 3.0 11 0.0 12 1.0 13 3.0 14 4.0 15 2.0 16 1.0 17 2.0 18 3.0 19 1.0 20 3.0 21 5.0 22 10.0 23 8.0 24 8.0 25 16.0 26 19.0 27 27.0 28 32.0 29 31.0 30 58.0 31 88.0 32 102.0 33 143.0 34 175.0 35 355.0 36 980.0 37 1903.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.449999999999996 19.575 12.825000000000001 32.15 2 30.725 23.25 26.85 19.175 3 23.325000000000003 25.924999999999997 28.275 22.475 4 26.125 32.275 19.6 22.0 5 26.924999999999997 33.85 18.15 21.075 6 23.375 35.925000000000004 19.75 20.95 7 22.175 19.775000000000002 34.849999999999994 23.200000000000003 8 23.25 23.400000000000002 24.8 28.549999999999997 9 23.799999999999997 24.525 25.8 25.874999999999996 10-14 26.545 25.919999999999998 23.105 24.43 15-19 25.885 26.064999999999998 23.825 24.224999999999998 20-24 25.230000000000004 25.865 24.33 24.575 25-29 25.655 25.335 24.705 24.305 30-34 25.424999999999997 25.545 24.765 24.265 35-39 25.435000000000002 25.745 24.025 24.795 40-44 26.005 25.740000000000002 24.465 23.79 45-49 26.08 25.069999999999997 24.11 24.740000000000002 50-54 26.135 25.35 24.240000000000002 24.275 55-59 25.85 25.635 24.474999999999998 24.04 60-64 26.240000000000002 25.205 24.64 23.915 65-69 26.235000000000003 25.64 24.005000000000003 24.12 70-74 26.25 25.3 24.325 24.125 75-79 26.07 25.185000000000002 24.779999999999998 23.965 80-84 25.95 25.235000000000003 24.66 24.154999999999998 85-89 26.275 25.88 24.16 23.685000000000002 90-94 25.509999999999998 26.179999999999996 24.36 23.95 95-99 25.805 26.240000000000002 24.25 23.705000000000002 100-104 26.0 25.89 24.545 23.565 105-109 25.5 25.115 24.975 24.41 110-114 26.02 25.5 24.365000000000002 24.115000000000002 115-119 25.240000000000002 25.624999999999996 25.085 24.05 120-124 25.745 25.83 24.725 23.7 125-129 25.974999999999998 25.735000000000003 24.295 23.995 130-134 26.645000000000003 25.715 24.4 23.24 135-139 26.174999999999997 26.200000000000003 24.25 23.375 140-144 26.135 25.935000000000002 24.6 23.330000000000002 145-149 26.790000000000003 25.955000000000002 23.98 23.275000000000002 150-151 25.025 26.337500000000002 25.424999999999997 23.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.5 27 3.0 28 2.5 29 2.0 30 5.5 31 9.0 32 11.5 33 16.0 34 16.0 35 26.0 36 46.0 37 61.0 38 80.5 39 106.5 40 117.0 41 126.5 42 150.5 43 178.0 44 185.5 45 185.0 46 191.5 47 188.5 48 189.5 49 173.5 50 165.5 51 159.0 52 136.0 53 115.5 54 99.0 55 91.0 56 88.5 57 96.5 58 100.5 59 96.5 60 86.5 61 75.5 62 72.0 63 71.5 64 75.0 65 68.0 66 50.0 67 46.5 68 48.0 69 44.0 70 39.5 71 28.5 72 18.5 73 18.0 74 14.5 75 7.0 76 3.0 77 2.5 78 1.0 79 1.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26823113802675 98.35000000000001 2 0.6308352258390109 1.25 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.025233409033560434 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9875 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAGC 10 0.006830828 145.0 2 >>END_MODULE Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955622 spots for SRR6958184.sra Written 955622 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra Read 955613 spots for SRR6958184.sra Written 955613 spots for SRR6958184.sra SRR ids: ['SRR6958184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5hj1a68u SRR6958184.sra spots: 19112269 blocks: [[1, 955613], [955614, 1911226], [1911227, 2866839], [2866840, 3822452], [3822453, 4778065], [4778066, 5733678], [5733679, 6689291], [6689292, 7644904], [7644905, 8600517], [8600518, 9556130], [9556131, 10511743], [10511744, 11467356], [11467357, 12422969], [12422970, 13378582], [13378583, 14334195], [14334196, 15289808], [15289809, 16245421], [16245422, 17201034], [17201035, 18156647], [18156648, 19112269]] SRR6958184 file size 6454820 SRR6958184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958184 SRR6958184_1.fastq SRR6958184_2.fastq Input file: SRR6958184_1.fastq Paired file: SRR6958184_2.fastq trimmed: SRR6958184-trimmed-pair1.fastq, SRR6958184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:24:51 2024 >> started Fri Dec 6 15:25:13 2024 >> done (22.059s) 19112269 read pairs processed; of these: 15176 ( 0.08%) short read pairs filtered out after trimming by size control 12098 ( 0.06%) empty read pairs filtered out after trimming by size control 19084995 (99.86%) read pairs available; of these: 5955374 (31.20%) trimmed read pairs available after processing 13129621 (68.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 1 0.00% 24 6 0.00% 25 3 0.00% 26 6 0.00% 27 8 0.00% 28 8 0.00% 29 2 0.00% 30 4 0.00% 31 3 0.00% 32 3 0.00% 33 3 0.00% 34 3 0.00% 35 5 0.00% 36 9 0.00% 37 6 0.00% 38 6 0.00% 39 6 0.00% 40 6 0.00% 41 11 0.00% 42 7 0.00% 43 9 0.00% 44 14 0.00% 45 14 0.00% 46 11 0.00% 47 16 0.00% 48 10 0.00% 49 13 0.00% 50 20 0.00% 51 29 0.00% 52 18 0.00% 53 22 0.00% 54 16 0.00% 55 34 0.00% 56 31 0.00% 57 31 0.00% 58 40 0.00% 59 35 0.00% 60 55 0.00% 61 62 0.00% 62 62 0.00% 63 73 0.00% 64 91 0.00% 65 100 0.00% 66 94 0.00% 67 122 0.00% 68 118 0.00% 69 153 0.00% 70 176 0.00% 71 202 0.00% 72 234 0.00% 73 263 0.00% 74 329 0.00% 75 365 0.00% 76 390 0.00% 77 463 0.00% 78 467 0.00% 79 561 0.00% 80 679 0.00% 81 800 0.00% 82 901 0.00% 83 1020 0.01% 84 1796 0.01% 85 2328 0.01% 86 2211 0.01% 87 2346 0.01% 88 2492 0.01% 89 2601 0.01% 90 2721 0.01% 91 3011 0.02% 92 3164 0.02% 93 3567 0.02% 94 3715 0.02% 95 4039 0.02% 96 4331 0.02% 97 4608 0.02% 98 4853 0.03% 99 5143 0.03% 100 5546 0.03% 101 5970 0.03% 102 6595 0.03% 103 7118 0.04% 104 7753 0.04% 105 8325 0.04% 106 8597 0.05% 107 9183 0.05% 108 9623 0.05% 109 10098 0.05% 110 10537 0.06% 111 11289 0.06% 112 12122 0.06% 113 12791 0.07% 114 13750 0.07% 115 14729 0.08% 116 15615 0.08% 117 16261 0.09% 118 16905 0.09% 119 17381 0.09% 120 18009 0.09% 121 19128 0.10% 122 20434 0.11% 123 21562 0.11% 124 22660 0.12% 125 23875 0.13% 126 25187 0.13% 127 26023 0.14% 128 27118 0.14% 129 28440 0.15% 130 29246 0.15% 131 30536 0.16% 132 32778 0.17% 133 34314 0.18% 134 36319 0.19% 135 38708 0.20% 136 40863 0.21% 137 42724 0.22% 138 45086 0.24% 139 48499 0.25% 140 51285 0.27% 141 55303 0.29% 142 61177 0.32% 143 68859 0.36% 144 77947 0.41% 145 92393 0.48% 146 112307 0.59% 147 148700 0.78% 148 226761 1.19% 149 459135 2.41% 150 3708617 19.43% 151 13129621 68.80% 19084995 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=22 prefix-density=0.87 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=136.57 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.9 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=21 prefix-density=0.61 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=102.80 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958184 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:26:34 Started mapping on | Dec 06 15:26:34 Finished on | Dec 06 15:28:32 Mapping speed, Million of reads per hour | 582.25 Number of input reads | 19084995 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17493587 Uniquely mapped reads % | 91.66% Average mapped length | 289.88 Number of splices: Total | 20272931 Number of splices: Annotated (sjdb) | 19093363 Number of splices: GT/AG | 19988707 Number of splices: GC/AG | 238869 Number of splices: AT/AC | 7048 Number of splices: Non-canonical | 38307 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205573 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 23733 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.66% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1397520 1397520 1397520 N_multimapping 205573 205573 205573 N_noFeature 610750 16969482 739712 N_ambiguous 471343 2392 77376 UnstrandedReadsAssigned:16411494 PositiveStrandReadsAssigned:521713 NegativeStrandReadsAssigned:16676499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958184-trimmed-pair1.fastq SRR6958184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,084,995 reads, 17,450,497 reads pseudoaligned [quant] estimated average fragment length: 268.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958184.ke.tsv 35125 SRR6958184.se.tsv 88098 total ==> SRR6958184.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.465 0 0 PNS24247 1044 776.974 60.9235 6.76642 PNS24249 1928 1660.97 30.2911 1.57374 PNS24246 1044 776.974 60.9235 6.76642 PNS24248 1044 776.974 60.9235 6.76642 PNS24244 1471 1203.97 35.9385 2.57587 PNS24243 293 86.2633 0 0 KQK14069 1603 1335.97 6987.01 451.309 KQK14071 474 225.014 142.706 54.7286 ==> SRR6958184.se.tsv <== BRADI_1g14170v3 7210 BRADI_1g53295v3 993 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 273 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 204 BRADI_1g48960v3 0 SRR6958184 completed mapping pipeline successfully