Starting /dee2/code/volunteer_pipeline.sh SRR6958185 current disk space = 1550419820544 free memory = 1603408388 SRR6958185 SRAfilesize ab8f930ec3cadd0134eafd31ca83a95d SRR6958185.sra SRR6958185.sra file validated SRR6958185 is paired end SRR6958185 is conventional basespace SRR6958185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.7035 30.0 18.0 33.0 18.0 33.0 2 25.44525 26.0 18.0 31.0 18.0 33.0 3 28.6685 29.0 27.0 31.0 25.0 33.0 4 29.34725 31.0 28.0 33.0 25.0 33.0 5 30.031 31.0 29.0 33.0 25.0 33.0 6 35.027 37.0 34.0 38.0 29.0 38.0 7 36.21975 38.0 37.0 38.0 33.0 38.0 8 36.918 38.0 38.0 38.0 35.0 38.0 9 36.98 38.0 38.0 38.0 35.0 38.0 10-14 37.000299999999996 38.0 38.0 38.0 35.8 38.0 15-19 37.2368 38.0 38.0 38.0 36.4 38.0 20-24 37.2042 38.0 38.0 38.0 36.4 38.0 25-29 37.059599999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.85535 38.0 38.0 38.0 35.2 38.0 35-39 36.82625 38.0 38.0 38.0 34.8 38.0 40-44 36.70405 38.0 38.0 38.0 34.6 38.0 45-49 36.7005 38.0 38.0 38.0 34.2 38.0 50-54 36.16675 38.0 37.4 38.0 32.6 38.0 55-59 36.2118 38.0 37.4 38.0 32.6 38.0 60-64 36.50285 38.0 38.0 38.0 34.2 38.0 65-69 36.69485 38.0 38.0 38.0 34.2 38.0 70-74 36.35675 38.0 37.4 38.0 33.2 38.0 75-79 35.797 38.0 36.8 38.0 30.6 38.0 80-84 35.855650000000004 38.0 37.0 38.0 31.0 38.0 85-89 36.07144999999999 38.0 37.0 38.0 32.4 38.0 90-94 35.93915 38.0 37.0 38.0 32.0 38.0 95-99 35.475199999999994 38.0 36.2 38.0 29.4 38.0 100-104 34.78215 38.0 35.0 38.0 26.8 38.0 105-109 34.157650000000004 38.0 34.2 38.0 23.6 38.0 110-114 34.326 38.0 34.0 38.0 23.8 38.0 115-119 34.03895 38.0 34.2 38.0 23.4 38.0 120-124 33.76975 38.0 33.8 38.0 21.6 38.0 125-129 33.76944999999999 38.0 34.0 38.0 22.4 38.0 130-134 33.1408 37.8 32.6 38.0 19.0 38.0 135-139 32.36425 37.2 31.2 38.0 15.4 38.0 140-144 31.3099 36.0 31.0 38.0 13.0 38.0 145-149 28.977999999999998 34.0 25.0 38.0 6.4 38.0 150-151 23.072 30.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 4.0 16 1.0 17 5.0 18 4.0 19 10.0 20 7.0 21 3.0 22 4.0 23 10.0 24 25.0 25 26.0 26 33.0 27 41.0 28 65.0 29 74.0 30 111.0 31 147.0 32 171.0 33 243.0 34 375.0 35 589.0 36 1039.0 37 1008.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.45992936701983 9.1279543602282 7.470795979353436 35.94132029339853 2 26.3 9.875 33.875 29.95 3 21.175 14.274999999999999 26.55 38.0 4 25.924999999999997 21.0 24.349999999999998 28.725 5 27.700000000000003 24.575 24.224999999999998 23.5 6 25.575 29.775000000000002 23.65 21.0 7 18.95 23.35 38.35 19.35 8 21.349999999999998 24.875 26.575 27.200000000000003 9 19.675 21.875 34.325 24.125 10-14 23.695 24.705 26.56 25.040000000000003 15-19 23.24 24.415 26.490000000000002 25.855 20-24 23.445 24.72 26.275 25.56 25-29 23.265 25.180000000000003 26.040000000000003 25.515 30-34 23.645 24.075 25.915 26.365 35-39 23.445 24.355 26.279999999999998 25.919999999999998 40-44 23.955000000000002 25.215 25.47 25.36 45-49 23.075000000000003 24.97 25.869999999999997 26.085 50-54 23.7 24.52 25.474999999999998 26.305 55-59 24.055 24.195 25.869999999999997 25.88 60-64 23.665 24.92 25.41 26.005 65-69 23.86 24.94 25.509999999999998 25.69 70-74 24.145 24.060000000000002 25.61 26.185000000000002 75-79 23.815 24.745 25.66 25.779999999999998 80-84 23.22 25.405 25.729999999999997 25.645 85-89 24.09 24.025 25.755 26.13 90-94 23.87 24.47 25.41 26.25 95-99 23.65 24.55 26.105 25.695 100-104 23.745 24.445 25.740000000000002 26.07 105-109 23.72 23.835 26.35 26.095000000000002 110-114 23.685000000000002 24.365000000000002 26.085 25.865 115-119 23.400000000000002 24.5 26.13 25.97 120-124 23.915 24.315 25.724999999999998 26.045 125-129 23.9 24.765 25.5 25.835 130-134 24.005000000000003 24.815 24.92 26.26 135-139 23.995 23.865 25.97 26.169999999999998 140-144 23.69 24.759999999999998 25.590000000000003 25.96 145-149 24.515 23.93 25.869999999999997 25.685000000000002 150-151 24.075 23.3625 25.362499999999997 27.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 3.0 29 4.5 30 3.5 31 6.0 32 9.0 33 11.5 34 17.0 35 24.0 36 34.5 37 48.0 38 65.5 39 87.5 40 110.5 41 145.0 42 173.0 43 180.0 44 203.5 45 202.0 46 191.5 47 210.0 48 198.5 49 183.0 50 180.0 51 161.5 52 142.0 53 127.0 54 116.0 55 109.0 56 107.0 57 104.0 58 84.0 59 79.5 60 84.0 61 74.0 62 63.5 63 68.5 64 68.5 65 56.0 66 53.0 67 45.0 68 32.5 69 27.5 70 28.0 71 23.5 72 16.0 73 13.0 74 11.0 75 7.0 76 2.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34393136512742 98.425 2 0.47943477163764825 0.95 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.05046681806712087 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCAC 5 0.125 No Hit GGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.5499999999999998 0.0 0.0 0.0 0.0 132-133 1.7375 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.275 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3735 33.0 33.0 34.0 32.0 34.0 2 32.21775 33.0 33.0 34.0 30.0 34.0 3 32.38075 33.0 33.0 34.0 31.0 34.0 4 32.18 33.0 33.0 34.0 31.0 34.0 5 32.261 33.0 33.0 34.0 31.0 34.0 6 36.4295 38.0 38.0 38.0 34.0 38.0 7 36.30225 38.0 38.0 38.0 34.0 38.0 8 36.3115 38.0 38.0 38.0 33.0 38.0 9 36.35975 38.0 38.0 38.0 34.0 38.0 10-14 36.337300000000006 38.0 38.0 38.0 34.0 38.0 15-19 36.529999999999994 38.0 38.0 38.0 34.4 38.0 20-24 36.48755 38.0 38.0 38.0 34.6 38.0 25-29 36.54445 38.0 38.0 38.0 34.8 38.0 30-34 36.5381 38.0 38.0 38.0 34.8 38.0 35-39 36.318 38.0 38.0 38.0 34.0 38.0 40-44 36.2 38.0 38.0 38.0 33.4 38.0 45-49 36.22585 38.0 38.0 38.0 33.8 38.0 50-54 36.2024 38.0 38.0 38.0 33.8 38.0 55-59 36.14235 38.0 38.0 38.0 33.6 38.0 60-64 35.97370000000001 38.0 38.0 38.0 32.6 38.0 65-69 35.71745 38.0 37.2 38.0 31.0 38.0 70-74 35.7675 38.0 37.0 38.0 31.6 38.0 75-79 35.5807 38.0 37.0 38.0 31.0 38.0 80-84 35.4335 38.0 36.8 38.0 29.8 38.0 85-89 35.41195 38.0 37.0 38.0 29.8 38.0 90-94 35.240050000000004 38.0 36.4 38.0 29.6 38.0 95-99 34.950599999999994 38.0 35.8 38.0 28.0 38.0 100-104 34.58669999999999 38.0 35.0 38.0 26.0 38.0 105-109 34.2904 38.0 35.0 38.0 24.2 38.0 110-114 33.653099999999995 38.0 34.4 38.0 19.4 38.0 115-119 33.56475 38.0 33.6 38.0 19.8 38.0 120-124 33.123900000000006 38.0 33.0 38.0 17.4 38.0 125-129 32.19930000000001 37.8 31.2 38.0 14.2 38.0 130-134 31.2755 36.2 30.4 38.0 13.0 38.0 135-139 30.780549999999998 36.0 29.4 38.0 12.6 38.0 140-144 30.214099999999995 36.0 28.0 38.0 9.4 38.0 145-149 28.463 35.2 22.2 38.0 2.0 38.0 150-151 22.128 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 7.0 5 2.0 6 2.0 7 4.0 8 1.0 9 5.0 10 1.0 11 3.0 12 1.0 13 3.0 14 8.0 15 9.0 16 4.0 17 8.0 18 13.0 19 7.0 20 16.0 21 17.0 22 14.0 23 17.0 24 29.0 25 36.0 26 36.0 27 41.0 28 66.0 29 77.0 30 110.0 31 105.0 32 143.0 33 197.0 34 282.0 35 504.0 36 943.0 37 1264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.85 18.475 12.35 30.325000000000003 2 29.299999999999997 23.974999999999998 24.8 21.925 3 24.275 25.95 26.924999999999997 22.85 4 26.625 30.95 19.900000000000002 22.525000000000002 5 26.474999999999998 32.05 20.549999999999997 20.925 6 23.525 35.35 20.375 20.75 7 24.349999999999998 20.05 33.375 22.225 8 25.424999999999997 22.375 23.325000000000003 28.875 9 23.974999999999998 24.025 25.75 26.25 10-14 25.755 25.665 23.47 25.11 15-19 25.845000000000002 25.135 24.3 24.72 20-24 25.985000000000003 25.729999999999997 23.65 24.635 25-29 26.314999999999998 25.019999999999996 24.035 24.63 30-34 25.624999999999996 25.369999999999997 24.075 24.93 35-39 25.895000000000003 25.585 23.810000000000002 24.709999999999997 40-44 25.985000000000003 25.319999999999997 23.875 24.82 45-49 26.0 25.71 23.785 24.505 50-54 25.845000000000002 25.679999999999996 24.03 24.445 55-59 26.565 25.685000000000002 23.919999999999998 23.830000000000002 60-64 25.669999999999998 25.825 23.94 24.565 65-69 25.865 26.029999999999998 23.695 24.41 70-74 26.445 25.064999999999998 24.135 24.355 75-79 25.874999999999996 24.715 24.575 24.834999999999997 80-84 26.395000000000003 25.515 23.965 24.125 85-89 26.424999999999997 25.19 24.01 24.375 90-94 26.095000000000002 25.36 23.875 24.67 95-99 25.705 26.13 24.58 23.585 100-104 26.13 25.674999999999997 23.89 24.305 105-109 25.795 25.205 24.490000000000002 24.51 110-114 26.450000000000003 25.82 23.925 23.805 115-119 26.384999999999998 25.05 24.845 23.72 120-124 25.785000000000004 25.83 24.175 24.21 125-129 26.615 25.840000000000003 23.22 24.325 130-134 26.32 26.224999999999998 23.845 23.61 135-139 26.41 25.759999999999998 24.63 23.200000000000003 140-144 26.505000000000003 25.095 24.59 23.810000000000002 145-149 26.8 25.245 24.05 23.905 150-151 27.375 25.087500000000002 23.75 23.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 0.5 28 1.5 29 2.5 30 3.5 31 4.0 32 7.0 33 11.0 34 12.5 35 21.0 36 29.0 37 39.5 38 57.5 39 92.0 40 123.0 41 137.5 42 158.5 43 169.5 44 183.5 45 203.0 46 206.0 47 198.0 48 183.0 49 170.0 50 159.5 51 139.5 52 125.5 53 119.0 54 119.0 55 121.5 56 106.0 57 97.0 58 97.5 59 91.0 60 83.0 61 79.0 62 77.0 63 78.5 64 71.5 65 60.0 66 60.0 67 62.0 68 53.0 69 41.5 70 36.5 71 32.0 72 24.5 73 15.5 74 12.0 75 6.5 76 3.5 77 3.5 78 2.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77955758962625 97.125 2 0.9916094584286803 1.95 3 0.07627765064836003 0.22499999999999998 4 0.10170353419781336 0.4 5 0.0 0.0 6 0.05085176709890668 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 6 0.15 No Hit GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6749999999999998 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra Read 1111162 spots for SRR6958185.sra Written 1111162 spots for SRR6958185.sra Read 1111161 spots for SRR6958185.sra Written 1111161 spots for SRR6958185.sra SRR ids: ['SRR6958185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e34e7b77 SRR6958185.sra spots: 22223221 blocks: [[1, 1111161], [1111162, 2222322], [2222323, 3333483], [3333484, 4444644], [4444645, 5555805], [5555806, 6666966], [6666967, 7778127], [7778128, 8889288], [8889289, 10000449], [10000450, 11111610], [11111611, 12222771], [12222772, 13333932], [13333933, 14445093], [14445094, 15556254], [15556255, 16667415], [16667416, 17778576], [17778577, 18889737], [18889738, 20000898], [20000899, 21112059], [21112060, 22223221]] SRR6958185 file size 7509020 SRR6958185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958185 SRR6958185_1.fastq SRR6958185_2.fastq Input file: SRR6958185_1.fastq Paired file: SRR6958185_2.fastq trimmed: SRR6958185-trimmed-pair1.fastq, SRR6958185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:26:06 2024 >> started Fri Dec 6 15:26:32 2024 >> done (26.095s) 22223221 read pairs processed; of these: 41584 ( 0.19%) short read pairs filtered out after trimming by size control 44701 ( 0.20%) empty read pairs filtered out after trimming by size control 22136936 (99.61%) read pairs available; of these: 10487642 (47.38%) trimmed read pairs available after processing 11649294 (52.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 0 0.00% 22 9 0.00% 23 11 0.00% 24 4 0.00% 25 3 0.00% 26 9 0.00% 27 6 0.00% 28 8 0.00% 29 10 0.00% 30 12 0.00% 31 9 0.00% 32 5 0.00% 33 16 0.00% 34 13 0.00% 35 12 0.00% 36 15 0.00% 37 14 0.00% 38 12 0.00% 39 14 0.00% 40 20 0.00% 41 18 0.00% 42 24 0.00% 43 23 0.00% 44 25 0.00% 45 42 0.00% 46 39 0.00% 47 45 0.00% 48 48 0.00% 49 37 0.00% 50 52 0.00% 51 58 0.00% 52 60 0.00% 53 76 0.00% 54 75 0.00% 55 107 0.00% 56 115 0.00% 57 102 0.00% 58 125 0.00% 59 138 0.00% 60 167 0.00% 61 153 0.00% 62 191 0.00% 63 213 0.00% 64 232 0.00% 65 244 0.00% 66 277 0.00% 67 320 0.00% 68 306 0.00% 69 378 0.00% 70 431 0.00% 71 454 0.00% 72 540 0.00% 73 564 0.00% 74 680 0.00% 75 772 0.00% 76 771 0.00% 77 909 0.00% 78 1036 0.00% 79 1143 0.01% 80 1254 0.01% 81 1510 0.01% 82 1717 0.01% 83 1961 0.01% 84 3661 0.02% 85 4477 0.02% 86 4517 0.02% 87 4684 0.02% 88 4679 0.02% 89 4971 0.02% 90 5003 0.02% 91 5282 0.02% 92 5452 0.02% 93 5908 0.03% 94 6220 0.03% 95 6774 0.03% 96 6904 0.03% 97 7293 0.03% 98 7537 0.03% 99 8168 0.04% 100 8489 0.04% 101 9143 0.04% 102 9788 0.04% 103 10332 0.05% 104 10758 0.05% 105 11551 0.05% 106 12253 0.06% 107 12983 0.06% 108 13604 0.06% 109 14472 0.07% 110 15365 0.07% 111 16035 0.07% 112 17191 0.08% 113 18169 0.08% 114 19484 0.09% 115 20467 0.09% 116 21780 0.10% 117 22339 0.10% 118 23712 0.11% 119 25081 0.11% 120 26549 0.12% 121 27562 0.12% 122 28904 0.13% 123 30858 0.14% 124 32983 0.15% 125 34916 0.16% 126 37018 0.17% 127 39814 0.18% 128 41249 0.19% 129 44163 0.20% 130 46427 0.21% 131 49692 0.22% 132 53237 0.24% 133 56729 0.26% 134 60800 0.27% 135 65689 0.30% 136 70665 0.32% 137 76390 0.35% 138 81779 0.37% 139 91008 0.41% 140 100182 0.45% 141 111333 0.50% 142 127692 0.58% 143 147328 0.67% 144 175233 0.79% 145 214962 0.97% 146 278669 1.26% 147 388406 1.75% 148 608296 2.75% 149 1222002 5.52% 150 5694940 25.73% 151 11649294 52.62% 22136936 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=18 prefix-density=0.96 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=47.95 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.0 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=286.64 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=13.2 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958185 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:27:17 Started mapping on | Dec 06 15:27:17 Finished on | Dec 06 15:30:08 Mapping speed, Million of reads per hour | 466.04 Number of input reads | 22136936 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21155804 Uniquely mapped reads % | 95.57% Average mapped length | 296.07 Number of splices: Total | 25057943 Number of splices: Annotated (sjdb) | 23589053 Number of splices: GT/AG | 24715123 Number of splices: GC/AG | 292363 Number of splices: AT/AC | 9208 Number of splices: Non-canonical | 41249 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248032 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 14544 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 756656 756656 756656 N_multimapping 248032 248032 248032 N_noFeature 610843 20518006 752547 N_ambiguous 576980 2824 81697 UnstrandedReadsAssigned:19967981 PositiveStrandReadsAssigned:634974 NegativeStrandReadsAssigned:20321560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958185-trimmed-pair1.fastq SRR6958185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,136,936 reads, 20,311,182 reads pseudoaligned [quant] estimated average fragment length: 271.248 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6958185.ke.tsv 35125 SRR6958185.se.tsv 88098 total ==> SRR6958185.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.254 1.00924e-08 1.09101e-09 PNS24247 1044 773.752 55.3478 5.15196 PNS24249 1928 1657.75 36.6408 1.59191 PNS24246 1044 773.752 55.3478 5.15196 PNS24248 1044 773.752 55.3478 5.15196 PNS24244 1471 1200.75 42.3158 2.53818 PNS24243 293 78.5334 0 0 KQK14069 1603 1332.75 5681.13 307.015 KQK14071 474 218.223 95.2746 31.4449 ==> SRR6958185.se.tsv <== BRADI_1g14170v3 6427 BRADI_1g53295v3 1126 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 376 BRADI_1g74790v3 116 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR6958185 completed mapping pipeline successfully