Starting /dee2/code/volunteer_pipeline.sh SRR6958186 current disk space = 1550358380544 free memory = 1598610180 SRR6958186 SRAfilesize fe07fd81772deb1166864ce7b46b029b SRR6958186.sra SRR6958186.sra file validated SRR6958186 is paired end SRR6958186 is conventional basespace SRR6958186 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958186_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.083 33.0 30.0 33.0 2.0 33.0 2 27.7605 29.0 25.0 33.0 18.0 33.0 3 31.21525 33.0 30.0 33.0 27.0 33.0 4 32.2245 33.0 33.0 33.0 30.0 34.0 5 32.679 33.0 33.0 33.0 31.0 34.0 6 37.03275 38.0 37.0 38.0 36.0 38.0 7 37.347 38.0 38.0 38.0 36.0 38.0 8 37.48825 38.0 38.0 38.0 37.0 38.0 9 37.6615 38.0 38.0 38.0 38.0 38.0 10-14 37.46915 38.0 38.0 38.0 37.6 38.0 15-19 37.53315 38.0 38.0 38.0 37.6 38.0 20-24 37.54684999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.2221 38.0 38.0 38.0 36.8 38.0 30-34 37.40990000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.051199999999994 38.0 38.0 38.0 36.0 38.0 40-44 37.553700000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.3809 38.0 38.0 38.0 37.0 38.0 50-54 37.254000000000005 38.0 38.0 38.0 36.8 38.0 55-59 37.2176 38.0 38.0 38.0 36.4 38.0 60-64 37.34310000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.38935 38.0 38.0 38.0 37.0 38.0 70-74 37.29395000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.2044 38.0 38.0 38.0 36.2 38.0 80-84 37.13185 38.0 38.0 38.0 36.0 38.0 85-89 36.67465 38.0 38.0 38.0 34.6 38.0 90-94 35.999649999999995 38.0 37.4 38.0 32.2 38.0 95-99 34.50915 37.8 34.0 38.0 25.8 38.0 100-104 35.79600000000001 38.0 37.0 38.0 31.2 38.0 105-109 35.7408 38.0 36.8 38.0 30.6 38.0 110-114 35.354150000000004 38.0 36.0 38.0 29.4 38.0 115-119 35.577600000000004 38.0 36.2 38.0 31.0 38.0 120-124 35.467650000000006 38.0 36.2 38.0 30.0 38.0 125-129 35.2763 38.0 36.0 38.0 29.2 38.0 130-134 34.9762 38.0 35.8 38.0 28.0 38.0 135-139 34.245349999999995 38.0 34.4 38.0 25.6 38.0 140-144 32.868900000000004 38.0 32.2 38.0 18.6 38.0 145-149 32.06685 38.0 32.6 38.0 10.6 38.0 150-151 25.952125000000002 33.0 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 4.0 18 2.0 19 3.0 20 2.0 21 5.0 22 5.0 23 6.0 24 5.0 25 11.0 26 28.0 27 21.0 28 41.0 29 42.0 30 45.0 31 77.0 32 99.0 33 143.0 34 260.0 35 393.0 36 892.0 37 1913.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.833705357142854 9.514508928571429 10.295758928571429 36.356026785714285 2 26.025 13.4 32.25 28.325 3 22.05 19.075 24.125 34.75 4 26.424999999999997 25.575 22.125 25.874999999999996 5 24.75 29.325000000000003 23.0 22.925 6 23.425 32.625 23.95 20.0 7 17.75 21.2 40.300000000000004 20.75 8 21.525 23.175 27.825 27.474999999999998 9 20.05 21.224999999999998 33.324999999999996 25.4 10-14 23.39 26.16 25.28 25.169999999999998 15-19 23.445 24.959999999999997 25.814999999999998 25.779999999999998 20-24 23.544999999999998 25.05 26.26 25.145 25-29 23.77 24.645 25.94 25.645 30-34 22.905 25.629999999999995 26.279999999999998 25.185000000000002 35-39 23.595 24.705 25.779999999999998 25.919999999999998 40-44 23.11 24.9 26.25 25.740000000000002 45-49 23.635 24.855 25.474999999999998 26.035000000000004 50-54 23.3 24.8 25.900000000000002 26.0 55-59 23.16 25.365 26.22 25.255 60-64 23.335 24.779999999999998 25.95 25.935000000000002 65-69 23.315 24.875 26.1 25.71 70-74 23.72 24.925 25.585 25.77 75-79 23.24 25.455 25.665 25.64 80-84 23.41 25.615 25.2 25.775 85-89 23.78 24.709999999999997 25.945 25.564999999999998 90-94 23.294999999999998 25.025 25.790000000000003 25.89 95-99 23.28 24.865000000000002 26.145000000000003 25.71 100-104 24.310000000000002 25.195 25.235000000000003 25.259999999999998 105-109 23.855 25.155 25.535000000000004 25.455 110-114 24.05 24.654999999999998 25.230000000000004 26.064999999999998 115-119 23.895 24.855 25.369999999999997 25.88 120-124 23.810000000000002 25.185000000000002 25.05 25.955000000000002 125-129 24.135 25.055 25.115 25.695 130-134 24.635 25.130000000000003 25.2 25.035 135-139 24.060000000000002 25.115 25.095 25.729999999999997 140-144 24.635 24.65 24.91 25.805 145-149 24.2 24.81 24.834999999999997 26.155 150-151 24.099999999999998 25.724999999999998 24.962500000000002 25.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 3.5 29 5.5 30 7.5 31 8.0 32 12.0 33 20.5 34 26.5 35 33.0 36 41.5 37 51.0 38 71.0 39 103.5 40 124.5 41 150.5 42 191.5 43 193.5 44 173.5 45 199.5 46 224.0 47 200.5 48 180.0 49 171.0 50 167.0 51 156.0 52 144.5 53 137.0 54 116.5 55 101.0 56 90.0 57 89.5 58 84.0 59 81.0 60 82.5 61 72.5 62 68.0 63 66.0 64 58.0 65 47.5 66 45.0 67 43.5 68 38.0 69 24.5 70 19.5 71 24.0 72 18.0 73 11.5 74 7.0 75 3.5 76 3.0 77 1.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.6804435483870968 1.35 3 0.025201612903225805 0.075 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958186 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958186_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96775 33.0 33.0 34.0 32.0 34.0 2 33.15975 34.0 33.0 34.0 33.0 34.0 3 33.10775 34.0 33.0 34.0 32.0 34.0 4 33.03775 34.0 33.0 34.0 33.0 34.0 5 32.95425 34.0 33.0 34.0 32.0 34.0 6 37.22625 38.0 38.0 38.0 37.0 38.0 7 37.2225 38.0 38.0 38.0 37.0 38.0 8 36.96825 38.0 38.0 38.0 36.0 38.0 9 37.1165 38.0 38.0 38.0 37.0 38.0 10-14 36.9422 38.0 38.0 38.0 36.0 38.0 15-19 36.943 38.0 38.0 38.0 36.0 38.0 20-24 36.9881 38.0 38.0 38.0 36.4 38.0 25-29 37.16515 38.0 38.0 38.0 37.0 38.0 30-34 37.2117 38.0 38.0 38.0 37.0 38.0 35-39 37.25375 38.0 38.0 38.0 37.0 38.0 40-44 35.253949999999996 38.0 35.0 38.0 28.0 38.0 45-49 35.37675 38.0 35.4 38.0 29.6 38.0 50-54 35.03865 38.0 35.0 38.0 27.2 38.0 55-59 35.36 38.0 35.6 38.0 29.4 38.0 60-64 36.4957 38.0 37.8 38.0 34.2 38.0 65-69 36.1394 38.0 37.4 38.0 32.6 38.0 70-74 36.102650000000004 38.0 37.4 38.0 32.8 38.0 75-79 36.24185 38.0 38.0 38.0 33.8 38.0 80-84 36.1202 38.0 38.0 38.0 33.2 38.0 85-89 35.9083 38.0 37.8 38.0 32.6 38.0 90-94 35.8131 38.0 37.2 38.0 31.4 38.0 95-99 36.00165 38.0 37.8 38.0 32.8 38.0 100-104 33.7808 37.2 30.8 38.0 25.4 38.0 105-109 35.799 38.0 37.2 38.0 32.0 38.0 110-114 35.42425 38.0 36.8 38.0 31.0 38.0 115-119 34.80275 38.0 36.0 38.0 27.6 38.0 120-124 30.531200000000002 34.2 26.2 38.0 15.8 38.0 125-129 29.345 34.6 21.4 38.0 12.6 38.0 130-134 29.616200000000003 34.6 23.8 38.0 12.2 38.0 135-139 32.17815 37.6 31.6 38.0 13.0 38.0 140-144 31.063350000000003 37.2 29.2 38.0 12.4 38.0 145-149 29.7127 36.8 26.4 38.0 3.8 38.0 150-151 23.4555 28.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 3.0 5 0.0 6 3.0 7 0.0 8 2.0 9 0.0 10 3.0 11 1.0 12 2.0 13 0.0 14 8.0 15 3.0 16 7.0 17 3.0 18 7.0 19 9.0 20 17.0 21 16.0 22 25.0 23 14.0 24 18.0 25 32.0 26 38.0 27 39.0 28 54.0 29 65.0 30 83.0 31 113.0 32 160.0 33 228.0 34 344.0 35 584.0 36 1205.0 37 907.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 17.575 12.725 31.825 2 29.75 24.45 26.450000000000003 19.35 3 22.75 25.724999999999998 27.075 24.45 4 25.4 31.900000000000002 19.825 22.875 5 27.125 32.300000000000004 19.900000000000002 20.674999999999997 6 23.799999999999997 34.525 20.075000000000003 21.6 7 21.75 19.225 34.949999999999996 24.075 8 24.825 23.225 22.900000000000002 29.049999999999997 9 23.325000000000003 22.95 27.35 26.375 10-14 25.615 25.874999999999996 22.965 25.545 15-19 25.66 25.355 24.77 24.215 20-24 25.77 25.21 24.625 24.395 25-29 25.385 25.605 24.07 24.94 30-34 25.624999999999996 25.36 24.605 24.41 35-39 26.045 25.45 24.279999999999998 24.224999999999998 40-44 25.855 25.314999999999998 24.529999999999998 24.3 45-49 25.865 24.85 24.425 24.86 50-54 25.71 25.740000000000002 24.224999999999998 24.325 55-59 26.265 24.740000000000002 24.54 24.455 60-64 25.6 25.835 24.925 23.64 65-69 25.745 25.515 24.45 24.29 70-74 26.040000000000003 25.495 23.9 24.565 75-79 25.430000000000003 25.16 25.230000000000004 24.18 80-84 25.72 25.330000000000002 24.54 24.41 85-89 26.224999999999998 25.495 24.235 24.044999999999998 90-94 25.75 25.785000000000004 24.92 23.544999999999998 95-99 26.145000000000003 25.155 24.425 24.275 100-104 26.495 24.884999999999998 24.93 23.69 105-109 25.94 25.665 24.37 24.025 110-114 26.075 25.525 24.725 23.674999999999997 115-119 25.685000000000002 26.145000000000003 24.169999999999998 24.0 120-124 25.595000000000002 25.650000000000002 24.875 23.880000000000003 125-129 26.202620262026205 25.367536753675367 24.007400740074008 24.422442244224424 130-134 26.63 25.840000000000003 24.6 22.93 135-139 27.0 25.535000000000004 24.305 23.16 140-144 26.57 26.205000000000002 24.09 23.135 145-149 26.91 26.13 23.724999999999998 23.235 150-151 27.037499999999998 25.637500000000003 24.3625 22.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 1.5 27 1.5 28 3.0 29 4.5 30 5.5 31 7.5 32 8.5 33 15.5 34 20.0 35 19.0 36 27.5 37 49.0 38 64.5 39 77.0 40 111.5 41 141.0 42 156.5 43 183.0 44 186.5 45 183.0 46 209.5 47 211.0 48 195.0 49 179.5 50 161.5 51 157.0 52 144.5 53 130.0 54 118.5 55 116.5 56 95.5 57 81.0 58 92.0 59 86.5 60 88.0 61 79.5 62 65.0 63 64.5 64 64.0 65 51.5 66 46.5 67 51.5 68 43.5 69 40.5 70 38.0 71 31.0 72 27.0 73 19.5 74 14.5 75 12.0 76 7.5 77 3.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7585335018963337 1.5 3 0.05056890012642225 0.15 4 0.025284450063211124 0.1 5 0.05056890012642225 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 1.9875 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.475 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCCGC 20 0.00593511 29.0 75-79 >>END_MODULE Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916584 spots for SRR6958186.sra Written 916584 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra Read 916566 spots for SRR6958186.sra Written 916566 spots for SRR6958186.sra SRR ids: ['SRR6958186.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nyres_n3 SRR6958186.sra spots: 18331338 blocks: [[1, 916566], [916567, 1833132], [1833133, 2749698], [2749699, 3666264], [3666265, 4582830], [4582831, 5499396], [5499397, 6415962], [6415963, 7332528], [7332529, 8249094], [8249095, 9165660], [9165661, 10082226], [10082227, 10998792], [10998793, 11915358], [11915359, 12831924], [12831925, 13748490], [13748491, 14665056], [14665057, 15581622], [15581623, 16498188], [16498189, 17414754], [17414755, 18331338]] SRR6958186 file size 6190188 SRR6958186 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958186 SRR6958186_1.fastq SRR6958186_2.fastq Input file: SRR6958186_1.fastq Paired file: SRR6958186_2.fastq trimmed: SRR6958186-trimmed-pair1.fastq, SRR6958186-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:30:51 2024 >> started Fri Dec 6 15:31:15 2024 >> done (23.733s) 18331338 read pairs processed; of these: 15202 ( 0.08%) short read pairs filtered out after trimming by size control 12911 ( 0.07%) empty read pairs filtered out after trimming by size control 18303225 (99.85%) read pairs available; of these: 8153929 (44.55%) trimmed read pairs available after processing 10149296 (55.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 7 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 6 0.00% 25 3 0.00% 26 3 0.00% 27 6 0.00% 28 2 0.00% 29 6 0.00% 30 8 0.00% 31 5 0.00% 32 5 0.00% 33 7 0.00% 34 5 0.00% 35 11 0.00% 36 3 0.00% 37 9 0.00% 38 5 0.00% 39 12 0.00% 40 3 0.00% 41 9 0.00% 42 19 0.00% 43 15 0.00% 44 19 0.00% 45 11 0.00% 46 19 0.00% 47 16 0.00% 48 22 0.00% 49 25 0.00% 50 16 0.00% 51 39 0.00% 52 26 0.00% 53 35 0.00% 54 35 0.00% 55 54 0.00% 56 38 0.00% 57 60 0.00% 58 55 0.00% 59 90 0.00% 60 89 0.00% 61 113 0.00% 62 131 0.00% 63 147 0.00% 64 162 0.00% 65 148 0.00% 66 221 0.00% 67 219 0.00% 68 238 0.00% 69 272 0.00% 70 360 0.00% 71 404 0.00% 72 412 0.00% 73 511 0.00% 74 581 0.00% 75 642 0.00% 76 728 0.00% 77 783 0.00% 78 867 0.00% 79 981 0.01% 80 1139 0.01% 81 1320 0.01% 82 1528 0.01% 83 1710 0.01% 84 2498 0.01% 85 2945 0.02% 86 3130 0.02% 87 3294 0.02% 88 3443 0.02% 89 3386 0.02% 90 3823 0.02% 91 4168 0.02% 92 4361 0.02% 93 4871 0.03% 94 5180 0.03% 95 5399 0.03% 96 5721 0.03% 97 6005 0.03% 98 6484 0.04% 99 6685 0.04% 100 7336 0.04% 101 7910 0.04% 102 8231 0.04% 103 8982 0.05% 104 9503 0.05% 105 10459 0.06% 106 10508 0.06% 107 10718 0.06% 108 11317 0.06% 109 11887 0.06% 110 12499 0.07% 111 13343 0.07% 112 14326 0.08% 113 15362 0.08% 114 16309 0.09% 115 17220 0.09% 116 18157 0.10% 117 18587 0.10% 118 19226 0.11% 119 19942 0.11% 120 20991 0.11% 121 22042 0.12% 122 23332 0.13% 123 25066 0.14% 124 26889 0.15% 125 28001 0.15% 126 29504 0.16% 127 31070 0.17% 128 32271 0.18% 129 33908 0.19% 130 35404 0.19% 131 37441 0.20% 132 40027 0.22% 133 42985 0.23% 134 45791 0.25% 135 48950 0.27% 136 52953 0.29% 137 55858 0.31% 138 59404 0.32% 139 64543 0.35% 140 69057 0.38% 141 75826 0.41% 142 85467 0.47% 143 96897 0.53% 144 113276 0.62% 145 137485 0.75% 146 173855 0.95% 147 242501 1.32% 148 375880 2.05% 149 780269 4.26% 150 4899342 26.77% 151 10149296 55.45% 18303225 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=19 prefix-density=1.00 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=31.65 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=15 prefix-density=0.67 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=77.29 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958186 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:32:09 Started mapping on | Dec 06 15:32:10 Finished on | Dec 06 15:34:02 Mapping speed, Million of reads per hour | 588.32 Number of input reads | 18303225 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17690613 Uniquely mapped reads % | 96.65% Average mapped length | 296.53 Number of splices: Total | 20943463 Number of splices: Annotated (sjdb) | 19762526 Number of splices: GT/AG | 20656455 Number of splices: GC/AG | 243377 Number of splices: AT/AC | 7204 Number of splices: Non-canonical | 36427 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198819 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 14016 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 423808 423808 423808 N_multimapping 198819 198819 198819 N_noFeature 510583 17143047 633417 N_ambiguous 490728 2252 66771 UnstrandedReadsAssigned:16689302 PositiveStrandReadsAssigned:545314 NegativeStrandReadsAssigned:16990425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958186 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958186-trimmed-pair1.fastq SRR6958186-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,303,225 reads, 16,963,364 reads pseudoaligned [quant] estimated average fragment length: 273.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958186.ke.tsv 35125 SRR6958186.se.tsv 88098 total ==> SRR6958186.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.103 0 0 PNS24247 1044 771.62 35.9505 3.99786 PNS24249 1928 1655.62 51.6922 2.67911 PNS24246 1044 771.62 35.9505 3.99786 PNS24248 1044 771.62 35.9505 3.99786 PNS24244 1471 1198.62 38.4564 2.75305 PNS24243 293 82.3934 0 0 KQK14069 1603 1330.62 7412.33 477.999 KQK14071 474 220.844 81.5153 31.6724 ==> SRR6958186.se.tsv <== BRADI_1g14170v3 8185 BRADI_1g53295v3 801 BRADI_1g59795v3 72 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 256 BRADI_1g74790v3 62 BRADI_1g09890v3 1 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR6958186 completed mapping pipeline successfully