Starting /dee2/code/volunteer_pipeline.sh SRR6958187 current disk space = 1550341058560 free memory = 1596419344 SRR6958187 SRAfilesize 0a2018c5120564afdff5e9ef8a23cc88 SRR6958187.sra SRR6958187.sra file validated SRR6958187 is paired end SRR6958187 is conventional basespace SRR6958187 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958187_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.237 32.0 25.0 33.0 18.0 33.0 2 28.3085 29.0 27.0 33.0 18.0 33.0 3 30.285 31.0 29.0 33.0 27.0 33.0 4 30.818 32.0 31.0 33.0 27.0 33.0 5 32.33875 33.0 33.0 33.0 32.0 33.0 6 37.06425 38.0 37.0 38.0 36.0 38.0 7 37.38225 38.0 38.0 38.0 37.0 38.0 8 37.50575 38.0 38.0 38.0 37.0 38.0 9 37.436 38.0 38.0 38.0 37.0 38.0 10-14 35.9978 37.8 35.4 38.0 31.6 38.0 15-19 37.5539 38.0 38.0 38.0 38.0 38.0 20-24 37.6205 38.0 38.0 38.0 38.0 38.0 25-29 37.59695000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.2243 38.0 38.0 38.0 36.8 38.0 35-39 37.38325 38.0 38.0 38.0 37.2 38.0 40-44 37.32115 38.0 38.0 38.0 37.0 38.0 45-49 36.7108 38.0 37.4 38.0 32.6 38.0 50-54 37.3682 38.0 38.0 38.0 37.0 38.0 55-59 37.40285 38.0 38.0 38.0 37.0 38.0 60-64 37.3983 38.0 38.0 38.0 37.0 38.0 65-69 37.353449999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.38815 38.0 38.0 38.0 37.0 38.0 75-79 37.317949999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.32475 38.0 38.0 38.0 37.0 38.0 85-89 36.001149999999996 38.0 36.0 38.0 30.4 38.0 90-94 34.869299999999996 37.8 34.0 38.0 25.8 38.0 95-99 36.862350000000006 38.0 37.8 38.0 35.0 38.0 100-104 37.00075 38.0 38.0 38.0 35.8 38.0 105-109 36.951350000000005 38.0 38.0 38.0 35.6 38.0 110-114 36.8438 38.0 38.0 38.0 35.0 38.0 115-119 36.6685 38.0 38.0 38.0 34.4 38.0 120-124 36.5061 38.0 38.0 38.0 34.0 38.0 125-129 36.326049999999995 38.0 38.0 38.0 33.8 38.0 130-134 36.298649999999995 38.0 38.0 38.0 33.8 38.0 135-139 36.1665 38.0 37.6 38.0 33.8 38.0 140-144 35.80865 38.0 36.4 38.0 32.4 38.0 145-149 33.76705 38.0 32.6 38.0 25.2 38.0 150-151 31.09075 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 0.0 19 1.0 20 2.0 21 1.0 22 3.0 23 4.0 24 3.0 25 5.0 26 11.0 27 12.0 28 14.0 29 27.0 30 30.0 31 34.0 32 56.0 33 82.0 34 165.0 35 290.0 36 961.0 37 2291.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.38830897703549 10.568893528183716 6.602296450939457 41.44050104384134 2 23.875 14.774999999999999 32.75 28.599999999999998 3 22.1 17.424999999999997 23.325000000000003 37.15 4 26.25656414103526 25.03125781445361 22.55563890972743 26.156539134783696 5 26.724999999999998 29.2 23.075000000000003 21.0 6 23.799999999999997 31.474999999999998 23.400000000000002 21.325 7 17.974999999999998 24.375 38.3 19.35 8 20.599999999999998 23.425 29.625 26.35 9 20.05 22.025 32.75 25.174999999999997 10-14 23.455000000000002 26.855 25.36 24.33 15-19 22.695 25.740000000000002 25.945 25.619999999999997 20-24 22.8 25.369999999999997 26.305 25.525 25-29 22.915 26.46 25.575 25.05 30-34 22.865 25.275 26.22 25.64 35-39 23.16 25.39 26.11 25.34 40-44 22.509999999999998 25.945 25.705 25.840000000000003 45-49 22.6 25.575 25.855 25.97 50-54 23.195 25.185000000000002 25.729999999999997 25.89 55-59 23.44 25.52 25.555 25.485000000000003 60-64 23.25 25.09 25.974999999999998 25.685000000000002 65-69 23.095 25.31 26.009999999999998 25.585 70-74 23.68 25.53 25.480000000000004 25.31 75-79 23.04 25.66 25.88 25.419999999999998 80-84 24.04 25.235000000000003 25.395 25.330000000000002 85-89 23.669999999999998 25.305 25.6 25.424999999999997 90-94 23.3 25.335 25.75 25.615 95-99 23.195 25.455 25.45 25.900000000000002 100-104 22.99 25.455 25.805 25.75 105-109 23.68 25.61 25.435000000000002 25.275 110-114 23.605 25.240000000000002 26.090000000000003 25.064999999999998 115-119 23.39 25.22 25.595000000000002 25.795 120-124 23.685000000000002 25.330000000000002 25.11 25.874999999999996 125-129 23.76 25.405 25.52 25.314999999999998 130-134 24.224999999999998 25.465 25.215 25.095 135-139 23.755000000000003 24.955 25.44 25.85 140-144 23.995 25.36 24.69 25.955000000000002 145-149 23.965 25.275 25.405 25.355 150-151 24.2 25.2625 25.0375 25.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 3.5 29 5.0 30 5.5 31 8.5 32 17.5 33 33.0 34 37.0 35 38.0 36 52.0 37 69.5 38 90.5 39 109.5 40 134.5 41 152.0 42 168.0 43 178.0 44 177.0 45 195.5 46 217.5 47 219.5 48 197.0 49 167.5 50 154.5 51 155.5 52 131.5 53 97.5 54 104.5 55 105.0 56 90.5 57 85.5 58 75.5 59 68.5 60 74.5 61 73.5 62 64.5 63 67.5 64 65.5 65 55.0 66 44.0 67 40.5 68 31.0 69 24.5 70 29.5 71 22.5 72 14.0 73 15.0 74 11.0 75 6.0 76 5.0 77 3.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.4125 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTTCA 10 0.006836113 144.9625 4 CAGGTTC 10 0.006836113 144.9625 3 CCAGGTT 10 0.006836113 144.9625 2 AGCACAC 35 0.003315817 62.12679 145 >>END_MODULE SRR6958187 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958187_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7955 33.0 33.0 34.0 32.0 34.0 2 33.062 34.0 33.0 34.0 32.0 34.0 3 33.1825 34.0 33.0 34.0 33.0 34.0 4 32.59025 34.0 33.0 34.0 32.0 34.0 5 33.1005 34.0 33.0 34.0 32.0 34.0 6 37.368 38.0 38.0 38.0 37.0 38.0 7 37.40075 38.0 38.0 38.0 37.0 38.0 8 37.33575 38.0 38.0 38.0 37.0 38.0 9 37.315 38.0 38.0 38.0 37.0 38.0 10-14 36.9229 38.0 37.8 38.0 35.4 38.0 15-19 37.2085 38.0 38.0 38.0 37.0 38.0 20-24 37.30895 38.0 38.0 38.0 37.0 38.0 25-29 37.284749999999995 38.0 38.0 38.0 37.2 38.0 30-34 37.38065 38.0 38.0 38.0 37.8 38.0 35-39 36.98625 38.0 38.0 38.0 36.6 38.0 40-44 36.774950000000004 38.0 38.0 38.0 35.0 38.0 45-49 37.06105 38.0 38.0 38.0 36.8 38.0 50-54 36.94085 38.0 38.0 38.0 35.8 38.0 55-59 36.68075 38.0 37.8 38.0 34.0 38.0 60-64 36.8625 38.0 38.0 38.0 35.6 38.0 65-69 36.722950000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.597300000000004 38.0 37.8 38.0 34.2 38.0 75-79 37.0961 38.0 38.0 38.0 36.4 38.0 80-84 37.03105 38.0 38.0 38.0 36.0 38.0 85-89 36.8577 38.0 38.0 38.0 35.4 38.0 90-94 35.1277 38.0 35.6 38.0 27.4 38.0 95-99 36.4918 38.0 37.8 38.0 34.2 38.0 100-104 36.681050000000006 38.0 38.0 38.0 35.0 38.0 105-109 35.96055 38.0 37.2 38.0 31.6 38.0 110-114 36.510949999999994 38.0 38.0 38.0 34.2 38.0 115-119 36.44705 38.0 38.0 38.0 34.0 38.0 120-124 36.1352 38.0 38.0 38.0 33.6 38.0 125-129 35.798 38.0 37.0 38.0 32.2 38.0 130-134 35.718900000000005 38.0 37.4 38.0 31.2 38.0 135-139 35.4449 38.0 36.6 38.0 31.0 38.0 140-144 34.88305 38.0 36.0 38.0 29.8 38.0 145-149 33.2971 38.0 34.2 38.0 21.2 38.0 150-151 28.029 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 1.0 19 6.0 20 1.0 21 2.0 22 6.0 23 2.0 24 11.0 25 16.0 26 13.0 27 25.0 28 20.0 29 26.0 30 40.0 31 68.0 32 87.0 33 105.0 34 168.0 35 297.0 36 653.0 37 2435.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.475 18.5 10.925 33.1 2 29.175 23.549999999999997 28.4 18.875 3 22.650000000000002 26.200000000000003 26.0 25.15 4 25.874999999999996 31.1 21.5 21.525 5 26.6 31.374999999999996 21.0 21.025 6 23.75 35.099999999999994 20.424999999999997 20.724999999999998 7 22.1 19.525000000000002 35.3 23.075000000000003 8 23.925 22.775000000000002 25.05 28.249999999999996 9 23.7 22.475 28.449999999999996 25.374999999999996 10-14 25.91 25.95 23.425 24.715 15-19 25.485000000000003 25.509999999999998 24.474999999999998 24.529999999999998 20-24 25.490000000000002 25.674999999999997 24.560000000000002 24.275 25-29 25.685000000000002 25.564999999999998 24.735 24.015 30-34 25.080000000000002 25.825 24.425 24.67 35-39 25.7 25.455 24.77 24.075 40-44 25.430000000000003 25.285000000000004 24.505 24.779999999999998 45-49 25.724999999999998 25.275 25.130000000000003 23.87 50-54 26.045 25.155 24.625 24.175 55-59 25.89 25.290000000000003 24.34 24.48 60-64 25.919999999999998 25.945 24.605 23.53 65-69 25.855 25.080000000000002 24.759999999999998 24.305 70-74 25.825 25.380000000000003 24.68 24.115000000000002 75-79 25.724999999999998 25.395 24.855 24.025 80-84 25.485000000000003 24.709999999999997 25.14 24.665 85-89 25.71 25.115 25.335 23.84 90-94 25.619999999999997 25.305 25.345000000000002 23.73 95-99 25.974999999999998 25.97 24.365000000000002 23.69 100-104 25.955000000000002 25.8 24.66 23.585 105-109 25.5 25.95 24.87 23.68 110-114 25.545 26.029999999999998 24.585 23.84 115-119 25.695 26.314999999999998 24.695 23.294999999999998 120-124 26.245 25.755 24.58 23.419999999999998 125-129 26.57 25.89 24.185000000000002 23.355 130-134 26.76 25.145 25.06 23.035 135-139 26.474999999999998 25.919999999999998 24.66 22.945 140-144 26.645000000000003 26.284999999999997 24.585 22.485 145-149 27.700000000000003 25.775 24.13 22.395 150-151 26.9625 25.9875 24.637500000000003 22.412499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 2.5 29 6.5 30 6.0 31 7.5 32 11.0 33 18.5 34 26.0 35 31.0 36 45.5 37 70.0 38 88.5 39 90.5 40 103.5 41 131.0 42 159.0 43 172.5 44 182.0 45 200.0 46 203.5 47 195.0 48 185.0 49 181.5 50 180.0 51 156.5 52 121.0 53 116.0 54 114.0 55 86.5 56 82.0 57 89.0 58 89.0 59 84.0 60 84.5 61 77.0 62 65.5 63 70.5 64 69.0 65 60.5 66 54.5 67 54.0 68 50.0 69 41.5 70 34.5 71 28.0 72 22.5 73 17.0 74 9.0 75 6.0 76 5.0 77 5.5 78 4.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08906882591093 97.89999999999999 2 0.7591093117408907 1.5 3 0.07591093117408906 0.22499999999999998 4 0.025303643724696356 0.1 5 0.025303643724696356 0.125 6 0.025303643724696356 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTCT 10 0.006830828 145.0 6 CCAAAGC 10 0.006830828 145.0 2 AGGCGCT 10 0.006830828 145.0 2 CCTCTTG 10 0.006830828 145.0 8 AAGGCGC 10 0.006830828 145.0 1 AAAGCCT 10 0.006830828 145.0 4 AAGCCTC 10 0.006830828 145.0 5 TTGCTAC 10 0.006830828 145.0 9 GATCGGA 40 0.0076550315 18.125 135-139 ATCGGAA 40 0.0076550315 18.125 135-139 AGATCGG 40 0.0076550315 18.125 135-139 >>END_MODULE Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307117 spots for SRR6958187.sra Written 1307117 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra Read 1307099 spots for SRR6958187.sra Written 1307099 spots for SRR6958187.sra SRR ids: ['SRR6958187.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bpm223ur SRR6958187.sra spots: 26141998 blocks: [[1, 1307099], [1307100, 2614198], [2614199, 3921297], [3921298, 5228396], [5228397, 6535495], [6535496, 7842594], [7842595, 9149693], [9149694, 10456792], [10456793, 11763891], [11763892, 13070990], [13070991, 14378089], [14378090, 15685188], [15685189, 16992287], [16992288, 18299386], [18299387, 19606485], [19606486, 20913584], [20913585, 22220683], [22220684, 23527782], [23527783, 24834881], [24834882, 26141998]] SRR6958187 file size 8836964 SRR6958187 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958187 SRR6958187_1.fastq SRR6958187_2.fastq Input file: SRR6958187_1.fastq Paired file: SRR6958187_2.fastq trimmed: SRR6958187-trimmed-pair1.fastq, SRR6958187-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:31:46 2024 >> started Fri Dec 6 15:32:26 2024 >> done (39.767s) 26141998 read pairs processed; of these: 13855 ( 0.05%) short read pairs filtered out after trimming by size control 10841 ( 0.04%) empty read pairs filtered out after trimming by size control 26117302 (99.91%) read pairs available; of these: 9763177 (37.38%) trimmed read pairs available after processing 16354125 (62.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 9 0.00% 20 7 0.00% 21 12 0.00% 22 11 0.00% 23 10 0.00% 24 20 0.00% 25 19 0.00% 26 14 0.00% 27 19 0.00% 28 14 0.00% 29 10 0.00% 30 21 0.00% 31 20 0.00% 32 19 0.00% 33 20 0.00% 34 25 0.00% 35 22 0.00% 36 15 0.00% 37 18 0.00% 38 27 0.00% 39 24 0.00% 40 33 0.00% 41 53 0.00% 42 37 0.00% 43 61 0.00% 44 39 0.00% 45 60 0.00% 46 50 0.00% 47 67 0.00% 48 68 0.00% 49 96 0.00% 50 71 0.00% 51 103 0.00% 52 114 0.00% 53 121 0.00% 54 119 0.00% 55 138 0.00% 56 174 0.00% 57 200 0.00% 58 224 0.00% 59 254 0.00% 60 301 0.00% 61 332 0.00% 62 364 0.00% 63 449 0.00% 64 449 0.00% 65 492 0.00% 66 545 0.00% 67 619 0.00% 68 762 0.00% 69 820 0.00% 70 949 0.00% 71 1094 0.00% 72 1239 0.00% 73 1400 0.01% 74 1559 0.01% 75 1840 0.01% 76 1893 0.01% 77 2239 0.01% 78 2509 0.01% 79 2868 0.01% 80 3139 0.01% 81 3491 0.01% 82 4092 0.02% 83 4582 0.02% 84 5631 0.02% 85 6525 0.02% 86 7230 0.03% 87 7697 0.03% 88 8172 0.03% 89 8871 0.03% 90 9452 0.04% 91 10337 0.04% 92 11229 0.04% 93 12324 0.05% 94 13366 0.05% 95 14059 0.05% 96 15192 0.06% 97 16067 0.06% 98 16890 0.06% 99 18056 0.07% 100 19639 0.08% 101 20743 0.08% 102 22337 0.09% 103 23383 0.09% 104 25183 0.10% 105 26404 0.10% 106 27879 0.11% 107 29428 0.11% 108 30378 0.12% 109 31918 0.12% 110 33311 0.13% 111 35027 0.13% 112 36836 0.14% 113 38512 0.15% 114 40564 0.16% 115 42219 0.16% 116 44339 0.17% 117 45570 0.17% 118 46969 0.18% 119 47967 0.18% 120 49795 0.19% 121 51727 0.20% 122 53562 0.21% 123 55738 0.21% 124 58241 0.22% 125 59693 0.23% 126 61830 0.24% 127 64348 0.25% 128 65444 0.25% 129 66962 0.26% 130 69726 0.27% 131 71647 0.27% 132 74663 0.29% 133 77462 0.30% 134 80573 0.31% 135 83312 0.32% 136 86194 0.33% 137 89581 0.34% 138 92987 0.36% 139 97965 0.38% 140 102833 0.39% 141 109345 0.42% 142 118750 0.45% 143 128794 0.49% 144 144168 0.55% 145 166273 0.64% 146 198741 0.76% 147 258157 0.99% 148 376486 1.44% 149 728508 2.79% 150 5129488 19.64% 151 16354125 62.62% 26117302 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=22 prefix-density=0.99 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=35.49 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=66.97 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.1 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958187 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:33:14 Started mapping on | Dec 06 15:33:14 Finished on | Dec 06 15:36:03 Mapping speed, Million of reads per hour | 556.34 Number of input reads | 26117302 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 25323155 Uniquely mapped reads % | 96.96% Average mapped length | 294.83 Number of splices: Total | 28208030 Number of splices: Annotated (sjdb) | 26444277 Number of splices: GT/AG | 27811666 Number of splices: GC/AG | 325506 Number of splices: AT/AC | 10004 Number of splices: Non-canonical | 60854 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278578 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 11847 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 526030 526030 526030 N_multimapping 278578 278578 278578 N_noFeature 1065590 24516247 1310231 N_ambiguous 660732 3491 99350 UnstrandedReadsAssigned:23596833 PositiveStrandReadsAssigned:803417 NegativeStrandReadsAssigned:23913574 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958187 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958187-trimmed-pair1.fastq SRR6958187-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,117,302 reads, 23,882,883 reads pseudoaligned [quant] estimated average fragment length: 258.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 SRR6958187.ke.tsv 35125 SRR6958187.se.tsv 88098 total ==> SRR6958187.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.658 0 0 PNS24247 1044 786.925 80.9581 6.53159 PNS24249 1928 1670.93 41.4386 1.57449 PNS24246 1044 786.925 80.9581 6.53159 PNS24248 1044 786.925 80.9581 6.53159 PNS24244 1471 1213.93 65.6872 3.43543 PNS24243 293 93.1135 0 0 KQK14069 1603 1345.93 6854.49 323.33 KQK14071 474 234.473 115.479 31.2681 ==> SRR6958187.se.tsv <== BRADI_1g14170v3 7924 BRADI_1g53295v3 1932 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 302 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR6958187 completed mapping pipeline successfully