Starting /dee2/code/volunteer_pipeline.sh SRR6958188 current disk space = 1550337253376 free memory = 1599769492 SRR6958188 SRAfilesize 26203851e68210c5f3302f6c7909490e SRR6958188.sra SRR6958188.sra file validated SRR6958188 is paired end SRR6958188 is conventional basespace SRR6958188 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958188_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.39925 30.0 18.0 33.0 18.0 33.0 2 26.708 29.0 18.0 31.0 18.0 33.0 3 30.5315 31.0 29.0 33.0 27.0 33.0 4 31.2915 32.0 32.0 33.0 27.0 33.0 5 32.267 33.0 32.0 33.0 32.0 33.0 6 36.313 38.0 36.0 38.0 34.0 38.0 7 36.7915 38.0 37.0 38.0 34.0 38.0 8 35.42175 38.0 37.0 38.0 29.0 38.0 9 36.97875 38.0 38.0 38.0 35.0 38.0 10-14 36.34155 38.0 36.4 38.0 31.4 38.0 15-19 37.438199999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.62135 38.0 38.0 38.0 38.0 38.0 25-29 37.5633 38.0 38.0 38.0 37.8 38.0 30-34 37.5182 38.0 38.0 38.0 38.0 38.0 35-39 37.3404 38.0 38.0 38.0 37.2 38.0 40-44 37.4748 38.0 38.0 38.0 37.6 38.0 45-49 37.4919 38.0 38.0 38.0 38.0 38.0 50-54 36.64255 38.0 37.6 38.0 33.6 38.0 55-59 37.239549999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.33655 38.0 38.0 38.0 37.0 38.0 65-69 37.355149999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.38985 38.0 38.0 38.0 37.0 38.0 75-79 36.8903 38.0 37.8 38.0 35.2 38.0 80-84 37.0597 38.0 38.0 38.0 35.6 38.0 85-89 37.234700000000004 38.0 38.0 38.0 36.6 38.0 90-94 35.51649999999999 38.0 35.0 38.0 29.6 38.0 95-99 36.95195 38.0 38.0 38.0 35.4 38.0 100-104 36.985 38.0 38.0 38.0 35.6 38.0 105-109 36.880399999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.80970000000001 38.0 38.0 38.0 35.0 38.0 115-119 36.4453 38.0 37.6 38.0 33.6 38.0 120-124 36.3453 38.0 37.8 38.0 34.0 38.0 125-129 36.322500000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.296549999999996 38.0 38.0 38.0 34.0 38.0 135-139 36.1635 38.0 38.0 38.0 33.0 38.0 140-144 35.8086 38.0 36.4 38.0 31.4 38.0 145-149 35.13655 38.0 36.0 38.0 31.0 38.0 150-151 31.085749999999997 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 5.0 25 8.0 26 10.0 27 21.0 28 18.0 29 25.0 30 23.0 31 47.0 32 62.0 33 85.0 34 150.0 35 275.0 36 798.0 37 2464.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.387229660144186 8.779608650875387 7.492276004119465 39.340885684860964 2 28.125 11.975 31.974999999999998 27.925 3 22.45 14.774999999999999 23.75 39.025 4 25.3 23.875 20.775 30.049999999999997 5 27.0 28.175 22.6 22.225 6 22.1 31.775 23.875 22.25 7 17.875 22.925 39.45 19.75 8 20.625 23.575 29.925 25.874999999999996 9 19.975 20.125 33.800000000000004 26.1 10-14 23.445 25.905 25.865 24.785 15-19 23.115 24.759999999999998 26.325 25.8 20-24 22.96 25.035 25.81 26.195 25-29 23.18 25.474999999999998 26.185000000000002 25.16 30-34 22.85 24.85 26.435 25.865 35-39 23.68 25.040000000000003 25.44 25.840000000000003 40-44 22.78 25.305 26.165 25.75 45-49 22.86 25.25 25.77 26.119999999999997 50-54 23.549999999999997 25.36 25.505 25.585 55-59 23.715 25.119999999999997 25.165 26.0 60-64 23.080000000000002 25.21 25.845000000000002 25.865 65-69 23.385 24.990000000000002 26.0 25.624999999999996 70-74 23.56 25.715 25.180000000000003 25.545 75-79 23.86 24.32 25.874999999999996 25.945 80-84 23.345 25.14 26.06 25.455 85-89 23.605 25.259999999999998 25.915 25.22 90-94 23.985 25.06 25.259999999999998 25.695 95-99 23.555 24.87 25.56 26.015 100-104 24.14 24.715 25.580000000000002 25.564999999999998 105-109 23.61 24.805 25.319999999999997 26.265 110-114 23.745 25.11 25.619999999999997 25.525 115-119 24.044999999999998 24.88 25.564999999999998 25.509999999999998 120-124 23.68 24.905 25.495 25.919999999999998 125-129 24.0 25.22 25.35 25.430000000000003 130-134 23.905 24.775 25.095 26.224999999999998 135-139 23.74 24.825 25.490000000000002 25.945 140-144 23.575 25.245 25.490000000000002 25.69 145-149 23.655 25.295 25.3 25.75 150-151 24.05 24.85 25.1875 25.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 4.0 30 4.5 31 10.5 32 18.5 33 16.0 34 17.5 35 28.0 36 42.5 37 60.0 38 77.5 39 102.5 40 130.0 41 151.5 42 170.5 43 185.0 44 190.5 45 199.0 46 209.5 47 205.5 48 188.0 49 181.5 50 172.5 51 152.0 52 141.0 53 125.0 54 108.5 55 97.5 56 90.5 57 94.0 58 90.0 59 82.0 60 74.5 61 69.5 62 55.5 63 49.5 64 53.0 65 55.5 66 55.5 67 49.5 68 43.0 69 30.0 70 27.5 71 25.0 72 19.0 73 14.0 74 8.0 75 6.0 76 5.5 77 3.5 78 2.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958188 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958188_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.029 33.0 33.0 34.0 32.0 34.0 2 33.10575 34.0 33.0 34.0 32.0 34.0 3 33.145 34.0 33.0 34.0 33.0 34.0 4 33.19525 34.0 33.0 34.0 33.0 34.0 5 32.98725 34.0 33.0 34.0 32.0 34.0 6 37.24775 38.0 38.0 38.0 37.0 38.0 7 37.2005 38.0 38.0 38.0 37.0 38.0 8 37.2885 38.0 38.0 38.0 37.0 38.0 9 37.29575 38.0 38.0 38.0 37.0 38.0 10-14 37.32135 38.0 38.0 38.0 37.0 38.0 15-19 37.372550000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.3632 38.0 38.0 38.0 37.0 38.0 25-29 37.21315 38.0 38.0 38.0 36.6 38.0 30-34 37.26605 38.0 38.0 38.0 37.0 38.0 35-39 36.7564 38.0 38.0 38.0 35.2 38.0 40-44 36.67615 38.0 38.0 38.0 34.8 38.0 45-49 36.6959 38.0 38.0 38.0 34.8 38.0 50-54 37.0869 38.0 38.0 38.0 36.6 38.0 55-59 35.72234999999999 38.0 36.8 38.0 28.6 38.0 60-64 37.056450000000005 38.0 38.0 38.0 36.2 38.0 65-69 37.034749999999995 38.0 38.0 38.0 36.2 38.0 70-74 36.993100000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.563900000000004 38.0 37.8 38.0 34.0 38.0 80-84 36.8865 38.0 38.0 38.0 35.4 38.0 85-89 36.03895 38.0 37.2 38.0 30.2 38.0 90-94 36.38805 38.0 38.0 38.0 33.8 38.0 95-99 36.42625 38.0 38.0 38.0 34.2 38.0 100-104 36.40945 38.0 38.0 38.0 34.0 38.0 105-109 36.467 38.0 38.0 38.0 34.0 38.0 110-114 36.309999999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.20825 38.0 38.0 38.0 33.6 38.0 120-124 35.77545 38.0 37.0 38.0 31.8 38.0 125-129 35.537400000000005 38.0 36.4 38.0 31.0 38.0 130-134 34.50015 38.0 34.6 38.0 25.8 38.0 135-139 33.49905 38.0 32.6 38.0 21.4 38.0 140-144 34.4132 38.0 35.2 38.0 26.6 38.0 145-149 33.7164 38.0 34.2 38.0 22.8 38.0 150-151 28.36025 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 1.0 20 3.0 21 6.0 22 7.0 23 12.0 24 12.0 25 9.0 26 23.0 27 28.0 28 36.0 29 41.0 30 35.0 31 57.0 32 82.0 33 122.0 34 191.0 35 296.0 36 686.0 37 2334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 18.35 11.425 33.475 2 29.425 24.3 27.35 18.925 3 21.8 25.775 27.05 25.374999999999996 4 27.224999999999998 30.15 20.349999999999998 22.275 5 28.199999999999996 32.275 19.825 19.7 6 22.575 37.025000000000006 19.525000000000002 20.875 7 21.75 20.075000000000003 34.9 23.275000000000002 8 22.25 24.65 24.9 28.199999999999996 9 23.35 22.875 27.650000000000002 26.125 10-14 26.31 25.61 23.79 24.29 15-19 25.77 25.405 24.455 24.37 20-24 25.570114022804564 25.71014202840568 24.399879975995198 24.319863972794558 25-29 25.88 25.5 24.044999999999998 24.575 30-34 25.240000000000002 26.055 24.515 24.19 35-39 25.445 26.035000000000004 24.625 23.895 40-44 25.669999999999998 25.615 24.48 24.235 45-49 25.415 25.935000000000002 24.215 24.435000000000002 50-54 25.47 25.535000000000004 24.884999999999998 24.11 55-59 26.26 25.41 24.83 23.5 60-64 25.77 25.3 24.404999999999998 24.525 65-69 25.656414103525883 25.946486621655414 24.10602650662666 24.29107276819205 70-74 25.855 25.729999999999997 24.32 24.095 75-79 26.21 24.585 24.87 24.335 80-84 26.32 25.465 24.38 23.835 85-89 26.16154038509627 25.136284071017755 24.88122030507627 23.820955238809702 90-94 25.5 25.6 24.395 24.505 95-99 25.555 25.985000000000003 24.525 23.935000000000002 100-104 26.44 25.6 24.349999999999998 23.61 105-109 26.33 25.535000000000004 24.215 23.919999999999998 110-114 26.436321816090803 25.6112805640282 24.491224561228062 23.461173058652932 115-119 26.591647911977994 25.376344086021508 24.316079019754937 23.71592898224556 120-124 26.815 25.645 24.285 23.255 125-129 26.26 25.569999999999997 24.585 23.585 130-134 26.138920838125717 26.05890883632545 24.19862979446917 23.603540531079663 135-139 25.711427856964242 25.95648912228057 24.38609652413103 23.945986496624155 140-144 26.834999999999997 26.22 24.365000000000002 22.58 145-149 27.400000000000002 26.43 23.895 22.275 150-151 27.537499999999998 26.174999999999997 24.6125 21.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 3.5 27 3.0 28 4.5 29 4.0 30 6.0 31 13.0 32 14.5 33 17.5 34 19.5 35 30.0 36 36.0 37 46.0 38 72.5 39 97.0 40 120.0 41 137.5 42 155.0 43 165.0 44 180.5 45 195.5 46 201.0 47 207.5 48 199.5 49 175.0 50 153.0 51 137.0 52 124.0 53 126.0 54 117.5 55 111.5 56 109.5 57 95.0 58 89.0 59 87.0 60 83.0 61 75.5 62 72.0 63 65.0 64 57.5 65 66.0 66 63.0 67 47.0 68 41.0 69 40.0 70 35.0 71 28.0 72 25.0 73 16.0 74 11.0 75 8.5 76 3.5 77 1.5 78 1.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80740928698299 97.35000000000001 2 0.96422227860949 1.9 3 0.17761989342806395 0.525 4 0.025374270489723422 0.1 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.512499999999999 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAC 10 0.006830828 145.0 1 TACATTC 10 0.006830828 145.0 9 >>END_MODULE Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205542 spots for SRR6958188.sra Written 1205542 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra Read 1205528 spots for SRR6958188.sra Written 1205528 spots for SRR6958188.sra SRR ids: ['SRR6958188.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x0l5m7qs SRR6958188.sra spots: 24110574 blocks: [[1, 1205528], [1205529, 2411056], [2411057, 3616584], [3616585, 4822112], [4822113, 6027640], [6027641, 7233168], [7233169, 8438696], [8438697, 9644224], [9644225, 10849752], [10849753, 12055280], [12055281, 13260808], [13260809, 14466336], [14466337, 15671864], [15671865, 16877392], [16877393, 18082920], [18082921, 19288448], [19288449, 20493976], [20493977, 21699504], [21699505, 22905032], [22905033, 24110574]] SRR6958188 file size 8148582 SRR6958188 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958188 SRR6958188_1.fastq SRR6958188_2.fastq Input file: SRR6958188_1.fastq Paired file: SRR6958188_2.fastq trimmed: SRR6958188-trimmed-pair1.fastq, SRR6958188-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:32:58 2024 >> started Fri Dec 6 15:33:24 2024 >> done (26.178s) 24110574 read pairs processed; of these: 13509 ( 0.06%) short read pairs filtered out after trimming by size control 11142 ( 0.05%) empty read pairs filtered out after trimming by size control 24085923 (99.90%) read pairs available; of these: 9205418 (38.22%) trimmed read pairs available after processing 14880505 (61.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 10 0.00% 22 6 0.00% 23 4 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 8 0.00% 28 10 0.00% 29 12 0.00% 30 12 0.00% 31 16 0.00% 32 9 0.00% 33 16 0.00% 34 13 0.00% 35 13 0.00% 36 20 0.00% 37 16 0.00% 38 32 0.00% 39 21 0.00% 40 28 0.00% 41 22 0.00% 42 32 0.00% 43 24 0.00% 44 30 0.00% 45 36 0.00% 46 45 0.00% 47 44 0.00% 48 50 0.00% 49 79 0.00% 50 93 0.00% 51 82 0.00% 52 102 0.00% 53 103 0.00% 54 124 0.00% 55 113 0.00% 56 151 0.00% 57 154 0.00% 58 196 0.00% 59 232 0.00% 60 268 0.00% 61 294 0.00% 62 338 0.00% 63 384 0.00% 64 411 0.00% 65 478 0.00% 66 519 0.00% 67 594 0.00% 68 610 0.00% 69 744 0.00% 70 875 0.00% 71 1050 0.00% 72 1137 0.00% 73 1301 0.01% 74 1438 0.01% 75 1625 0.01% 76 1875 0.01% 77 2181 0.01% 78 2261 0.01% 79 2591 0.01% 80 2923 0.01% 81 3288 0.01% 82 3787 0.02% 83 4233 0.02% 84 5283 0.02% 85 6186 0.03% 86 6588 0.03% 87 7257 0.03% 88 7762 0.03% 89 8266 0.03% 90 9059 0.04% 91 9651 0.04% 92 10694 0.04% 93 11506 0.05% 94 12733 0.05% 95 13395 0.06% 96 14297 0.06% 97 15289 0.06% 98 16516 0.07% 99 17733 0.07% 100 19014 0.08% 101 19863 0.08% 102 21713 0.09% 103 22647 0.09% 104 24353 0.10% 105 25598 0.11% 106 26942 0.11% 107 28300 0.12% 108 29488 0.12% 109 31095 0.13% 110 31973 0.13% 111 33667 0.14% 112 35625 0.15% 113 37181 0.15% 114 39036 0.16% 115 41283 0.17% 116 42853 0.18% 117 44580 0.19% 118 45887 0.19% 119 47243 0.20% 120 49205 0.20% 121 50716 0.21% 122 52044 0.22% 123 54667 0.23% 124 57063 0.24% 125 58882 0.24% 126 60781 0.25% 127 62926 0.26% 128 63900 0.27% 129 66061 0.27% 130 68212 0.28% 131 70892 0.29% 132 73160 0.30% 133 77002 0.32% 134 79948 0.33% 135 82125 0.34% 136 84615 0.35% 137 87967 0.37% 138 90524 0.38% 139 96525 0.40% 140 102059 0.42% 141 106887 0.44% 142 115372 0.48% 143 124743 0.52% 144 138588 0.58% 145 158900 0.66% 146 188857 0.78% 147 242735 1.01% 148 351778 1.46% 149 684690 2.84% 150 4745839 19.70% 151 14880505 61.78% 24085923 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=18 prefix-density=0.75 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=52.44 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.7 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=21 prefix-density=0.55 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=68.94 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958188 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:34:16 Started mapping on | Dec 06 15:34:16 Finished on | Dec 06 15:36:48 Mapping speed, Million of reads per hour | 570.46 Number of input reads | 24085923 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23308861 Uniquely mapped reads % | 96.77% Average mapped length | 294.56 Number of splices: Total | 26800847 Number of splices: Annotated (sjdb) | 25171407 Number of splices: GT/AG | 26424127 Number of splices: GC/AG | 313195 Number of splices: AT/AC | 10192 Number of splices: Non-canonical | 53333 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299951 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 32044 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485913 485913 485913 N_multimapping 299951 299951 299951 N_noFeature 859599 22623498 1048794 N_ambiguous 582366 2971 87079 UnstrandedReadsAssigned:21866896 PositiveStrandReadsAssigned:682392 NegativeStrandReadsAssigned:22172988 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958188 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958188-trimmed-pair1.fastq SRR6958188-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,085,923 reads, 22,183,655 reads pseudoaligned [quant] estimated average fragment length: 255.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR6958188.ke.tsv 35125 SRR6958188.se.tsv 88098 total ==> SRR6958188.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.791 0 0 PNS24247 1044 789.259 55.5332 4.724 PNS24249 1928 1673.26 65.4366 2.62563 PNS24246 1044 789.259 55.5332 4.724 PNS24248 1044 789.259 55.5332 4.724 PNS24244 1471 1216.26 46.9636 2.59246 PNS24243 293 94.2753 0 0 KQK14069 1603 1348.26 4968.05 247.394 KQK14071 474 236.557 103.245 29.3029 ==> SRR6958188.se.tsv <== BRADI_1g14170v3 5711 BRADI_1g53295v3 1579 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 509 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 321 BRADI_1g48960v3 0 SRR6958188 completed mapping pipeline successfully