Starting /dee2/code/volunteer_pipeline.sh SRR6958189 current disk space = 1550402269184 free memory = 1599704296 SRR6958189 SRAfilesize b83d724b171d4b61b87d6164a31c3ab2 SRR6958189.sra SRR6958189.sra file validated SRR6958189 is paired end SRR6958189 is conventional basespace SRR6958189 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.66425 33.0 31.0 33.0 18.0 34.0 2 30.58925 31.0 29.0 33.0 27.0 34.0 3 30.75725 33.0 29.0 33.0 27.0 34.0 4 31.443 33.0 31.0 33.0 29.0 34.0 5 32.0755 33.0 32.0 33.0 31.0 34.0 6 35.914 38.0 36.0 38.0 32.0 38.0 7 36.71975 38.0 37.0 38.0 34.0 38.0 8 36.93175 38.0 38.0 38.0 35.0 38.0 9 37.35 38.0 38.0 38.0 37.0 38.0 10-14 37.37175 38.0 38.0 38.0 37.0 38.0 15-19 37.38009999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.40975 38.0 38.0 38.0 37.0 38.0 25-29 37.3344 38.0 38.0 38.0 36.8 38.0 30-34 37.266749999999995 38.0 38.0 38.0 36.8 38.0 35-39 37.0681 38.0 38.0 38.0 36.0 38.0 40-44 36.988 38.0 38.0 38.0 35.4 38.0 45-49 37.1476 38.0 38.0 38.0 36.0 38.0 50-54 37.0912 38.0 38.0 38.0 36.0 38.0 55-59 36.81975 38.0 38.0 38.0 35.0 38.0 60-64 36.9208 38.0 38.0 38.0 35.2 38.0 65-69 36.90875 38.0 38.0 38.0 35.2 38.0 70-74 36.9502 38.0 38.0 38.0 35.2 38.0 75-79 36.671 38.0 38.0 38.0 34.2 38.0 80-84 36.3779 38.0 37.4 38.0 33.6 38.0 85-89 36.16705 38.0 37.0 38.0 32.6 38.0 90-94 36.28455 38.0 37.2 38.0 33.4 38.0 95-99 36.3023 38.0 37.0 38.0 33.6 38.0 100-104 36.2084 38.0 37.0 38.0 33.0 38.0 105-109 35.832100000000004 38.0 36.4 38.0 31.4 38.0 110-114 35.504949999999994 38.0 35.8 38.0 30.0 38.0 115-119 35.30145 38.0 35.4 38.0 28.8 38.0 120-124 35.16089999999999 38.0 35.0 38.0 28.4 38.0 125-129 34.9166 38.0 35.2 38.0 28.2 38.0 130-134 34.6622 38.0 34.8 38.0 27.2 38.0 135-139 34.6616 38.0 35.0 38.0 27.2 38.0 140-144 33.9596 38.0 34.2 38.0 23.2 38.0 145-149 32.3631 37.0 32.8 38.0 15.2 38.0 150-151 28.192375 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 4.0 23 3.0 24 5.0 25 10.0 26 21.0 27 26.0 28 31.0 29 45.0 30 59.0 31 77.0 32 124.0 33 161.0 34 241.0 35 457.0 36 972.0 37 1755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.28150273936864 9.209496477954605 9.783459431254892 43.72554135142187 2 21.875 12.975 37.275000000000006 27.875 3 19.5 15.075 24.075 41.349999999999994 4 24.725 24.375 21.3 29.599999999999998 5 25.78144536134033 28.08202050512628 25.531382845711427 20.605151287821954 6 23.724999999999998 31.8 23.65 20.825 7 18.099999999999998 25.174999999999997 38.525 18.2 8 20.424999999999997 25.35 27.975 26.25 9 19.975 21.325 35.0 23.7 10-14 22.545 26.529999999999998 26.235000000000003 24.69 15-19 22.59 25.545 26.56 25.305 20-24 22.935 25.564999999999998 26.229999999999997 25.27 25-29 22.575 26.21 26.1 25.115 30-34 22.939999999999998 25.790000000000003 25.525 25.745 35-39 22.595000000000002 25.61 26.875 24.92 40-44 22.775000000000002 25.52 26.605 25.1 45-49 23.119999999999997 25.44 26.36 25.080000000000002 50-54 23.27 25.735000000000003 25.915 25.080000000000002 55-59 22.965 25.835 26.135 25.064999999999998 60-64 22.78 26.064999999999998 25.435000000000002 25.72 65-69 22.85 25.86 26.1 25.19 70-74 23.505000000000003 25.435000000000002 25.905 25.155 75-79 22.645 24.975 26.765 25.615 80-84 22.830000000000002 25.540000000000003 26.19 25.44 85-89 22.765 25.935000000000002 26.015 25.285000000000004 90-94 23.345 24.745 26.090000000000003 25.82 95-99 22.58 25.46 26.784999999999997 25.174999999999997 100-104 23.494999999999997 25.825 25.130000000000003 25.55 105-109 22.985 25.34 26.029999999999998 25.645 110-114 22.735 25.735000000000003 26.14 25.39 115-119 23.345 25.535000000000004 25.955000000000002 25.165 120-124 23.27 24.825 26.619999999999997 25.285000000000004 125-129 23.16 25.35 26.26 25.230000000000004 130-134 23.41 25.374999999999996 25.655 25.56 135-139 22.765 25.285000000000004 25.795 26.155 140-144 23.345 25.75 25.515 25.39 145-149 23.855 25.174999999999997 25.869999999999997 25.1 150-151 24.274637318659327 24.824912456228116 26.23811905952976 24.662331165582792 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 3.0 28 5.0 29 6.0 30 6.5 31 11.5 32 19.5 33 26.5 34 37.0 35 47.5 36 49.5 37 62.5 38 89.5 39 108.0 40 129.0 41 156.0 42 181.5 43 195.0 44 217.5 45 220.0 46 211.0 47 219.5 48 193.0 49 170.5 50 168.5 51 155.0 52 133.0 53 107.0 54 96.5 55 93.0 56 84.0 57 88.0 58 79.0 59 66.5 60 79.0 61 74.0 62 58.0 63 50.5 64 50.0 65 49.0 66 41.5 67 30.0 68 24.0 69 25.0 70 18.5 71 16.5 72 17.0 73 13.0 74 8.5 75 4.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.175 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCCG 10 0.0068396386 144.9375 7 TTTTTTT 35 0.0035454615 20.705357 45-49 >>END_MODULE SRR6958189 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958189_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97225 33.0 33.0 34.0 32.0 34.0 2 32.962 33.0 33.0 34.0 32.0 34.0 3 32.84375 34.0 33.0 34.0 32.0 34.0 4 32.884 33.0 33.0 34.0 32.0 34.0 5 32.98025 34.0 33.0 34.0 32.0 34.0 6 37.144 38.0 38.0 38.0 36.0 38.0 7 36.91825 38.0 38.0 38.0 36.0 38.0 8 37.064 38.0 38.0 38.0 36.0 38.0 9 36.889 38.0 38.0 38.0 36.0 38.0 10-14 36.893899999999995 38.0 38.0 38.0 35.4 38.0 15-19 36.8263 38.0 38.0 38.0 35.4 38.0 20-24 36.9367 38.0 38.0 38.0 35.8 38.0 25-29 37.01825 38.0 38.0 38.0 36.0 38.0 30-34 37.062149999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.86435 38.0 38.0 38.0 35.6 38.0 40-44 36.8798 38.0 38.0 38.0 35.4 38.0 45-49 36.767450000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.8359 38.0 38.0 38.0 35.2 38.0 55-59 36.789750000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.82025 38.0 38.0 38.0 35.2 38.0 65-69 36.543699999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.5449 38.0 38.0 38.0 33.8 38.0 75-79 36.350199999999994 38.0 37.6 38.0 33.6 38.0 80-84 36.28075 38.0 37.8 38.0 33.4 38.0 85-89 36.104499999999994 38.0 37.2 38.0 33.0 38.0 90-94 35.94115 38.0 37.0 38.0 32.0 38.0 95-99 35.971199999999996 38.0 37.0 38.0 33.0 38.0 100-104 35.79855 38.0 37.0 38.0 31.2 38.0 105-109 35.48095 38.0 36.0 38.0 30.4 38.0 110-114 35.20945 38.0 35.8 38.0 28.2 38.0 115-119 35.087 38.0 35.2 38.0 28.0 38.0 120-124 34.8928 38.0 35.0 38.0 27.6 38.0 125-129 34.7515 38.0 35.0 38.0 27.4 38.0 130-134 34.3357 38.0 34.6 38.0 25.0 38.0 135-139 33.68985 38.0 33.8 38.0 21.0 38.0 140-144 33.21945 38.0 33.4 38.0 19.4 38.0 145-149 32.213800000000006 38.0 31.6 38.0 13.2 38.0 150-151 27.271625 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 2.0 17 2.0 18 3.0 19 7.0 20 4.0 21 4.0 22 8.0 23 13.0 24 14.0 25 21.0 26 19.0 27 23.0 28 38.0 29 52.0 30 77.0 31 85.0 32 125.0 33 176.0 34 217.0 35 390.0 36 832.0 37 1877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.30782695673918 16.029007251812956 14.153538384596148 38.50962740685171 2 29.049999999999997 23.400000000000002 28.599999999999998 18.95 3 22.680670167541887 24.781195298824706 28.35708927231808 24.18104526131533 4 26.724999999999998 28.249999999999996 23.05 21.975 5 27.881970492623154 32.6081520380095 20.330082520630157 19.179794948737182 6 22.900000000000002 37.675 21.099999999999998 18.325 7 23.125 19.45 34.025 23.400000000000002 8 23.65 24.5 24.025 27.825 9 23.200000000000003 22.75 29.275000000000002 24.775 10-14 25.85 27.139999999999997 23.635 23.375 15-19 25.56 26.19 24.685000000000002 23.565 20-24 25.235000000000003 26.325 24.275 24.165 25-29 25.765 25.924999999999997 24.795 23.515 30-34 25.4 26.505000000000003 24.54 23.555 35-39 25.814999999999998 26.724999999999998 23.93 23.53 40-44 26.025 25.44 24.52 24.015 45-49 25.56 26.045 25.2 23.195 50-54 25.755 26.305 24.610000000000003 23.330000000000002 55-59 25.629999999999995 25.55 25.0 23.82 60-64 25.97 25.445 25.16 23.425 65-69 25.785000000000004 25.985000000000003 24.834999999999997 23.395 70-74 25.505 25.205 25.415 23.875 75-79 25.124999999999996 26.185000000000002 25.174999999999997 23.515 80-84 26.025 25.785000000000004 25.069999999999997 23.119999999999997 85-89 24.925 26.26 24.98 23.835 90-94 25.835 25.2 25.155 23.810000000000002 95-99 25.95 25.629999999999995 25.069999999999997 23.35 100-104 25.979999999999997 25.85 25.03 23.14 105-109 25.445 26.56 24.87 23.125 110-114 25.89 26.384999999999998 24.855 22.869999999999997 115-119 25.385 25.674999999999997 25.369999999999997 23.57 120-124 25.72 26.25 25.195 22.835 125-129 25.900000000000002 26.015 24.77 23.315 130-134 26.224999999999998 26.36 24.8 22.615 135-139 25.305 25.974999999999998 25.44 23.28 140-144 25.91 26.26 25.0 22.830000000000002 145-149 25.91 26.11 24.87 23.11 150-151 27.288644322161083 26.20060030015007 24.087043521760883 22.423711855927962 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 2.5 27 4.5 28 3.5 29 5.5 30 8.5 31 9.5 32 13.0 33 17.0 34 22.0 35 32.5 36 44.0 37 62.5 38 85.5 39 102.0 40 131.0 41 163.5 42 173.5 43 182.0 44 187.0 45 191.0 46 212.0 47 200.0 48 179.0 49 176.5 50 169.0 51 165.0 52 135.0 53 110.0 54 100.5 55 91.5 56 93.5 57 98.5 58 88.0 59 74.5 60 72.0 61 70.5 62 69.5 63 63.0 64 57.5 65 50.5 66 42.5 67 39.5 68 41.5 69 38.0 70 29.5 71 25.0 72 21.0 73 14.0 74 11.0 75 6.0 76 2.5 77 3.0 78 2.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75697615423643 97.32499999999999 2 1.141552511415525 2.25 3 0.025367833587011668 0.075 4 0.025367833587011668 0.1 5 0.050735667174023336 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 5 0.125 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra Read 1117586 spots for SRR6958189.sra Written 1117586 spots for SRR6958189.sra SRR ids: ['SRR6958189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2r20yd1w SRR6958189.sra spots: 22351720 blocks: [[1, 1117586], [1117587, 2235172], [2235173, 3352758], [3352759, 4470344], [4470345, 5587930], [5587931, 6705516], [6705517, 7823102], [7823103, 8940688], [8940689, 10058274], [10058275, 11175860], [11175861, 12293446], [12293447, 13411032], [13411033, 14528618], [14528619, 15646204], [15646205, 16763790], [16763791, 17881376], [17881377, 18998962], [18998963, 20116548], [20116549, 21234134], [21234135, 22351720]] SRR6958189 file size 7552564 SRR6958189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958189 SRR6958189_1.fastq SRR6958189_2.fastq Input file: SRR6958189_1.fastq Paired file: SRR6958189_2.fastq trimmed: SRR6958189-trimmed-pair1.fastq, SRR6958189-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:33:47 2024 >> started Fri Dec 6 15:34:19 2024 >> done (31.730s) 22351720 read pairs processed; of these: 10331 ( 0.05%) short read pairs filtered out after trimming by size control 7991 ( 0.04%) empty read pairs filtered out after trimming by size control 22333398 (99.92%) read pairs available; of these: 7987290 (35.76%) trimmed read pairs available after processing 14346108 (64.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 6 0.00% 22 3 0.00% 23 3 0.00% 24 6 0.00% 25 1 0.00% 26 5 0.00% 27 3 0.00% 28 12 0.00% 29 5 0.00% 30 6 0.00% 31 9 0.00% 32 11 0.00% 33 13 0.00% 34 10 0.00% 35 9 0.00% 36 15 0.00% 37 13 0.00% 38 13 0.00% 39 10 0.00% 40 18 0.00% 41 6 0.00% 42 18 0.00% 43 17 0.00% 44 17 0.00% 45 21 0.00% 46 17 0.00% 47 17 0.00% 48 23 0.00% 49 33 0.00% 50 33 0.00% 51 33 0.00% 52 35 0.00% 53 52 0.00% 54 46 0.00% 55 63 0.00% 56 60 0.00% 57 61 0.00% 58 86 0.00% 59 76 0.00% 60 90 0.00% 61 121 0.00% 62 141 0.00% 63 172 0.00% 64 199 0.00% 65 173 0.00% 66 180 0.00% 67 204 0.00% 68 238 0.00% 69 256 0.00% 70 399 0.00% 71 373 0.00% 72 409 0.00% 73 441 0.00% 74 500 0.00% 75 531 0.00% 76 648 0.00% 77 729 0.00% 78 720 0.00% 79 818 0.00% 80 1007 0.00% 81 1115 0.00% 82 1249 0.01% 83 1418 0.01% 84 1932 0.01% 85 2409 0.01% 86 2532 0.01% 87 2904 0.01% 88 3283 0.01% 89 3338 0.01% 90 3633 0.02% 91 4053 0.02% 92 3982 0.02% 93 4233 0.02% 94 4872 0.02% 95 4971 0.02% 96 5230 0.02% 97 5610 0.03% 98 5833 0.03% 99 6438 0.03% 100 6946 0.03% 101 7307 0.03% 102 7666 0.03% 103 8111 0.04% 104 8671 0.04% 105 9198 0.04% 106 10039 0.04% 107 10527 0.05% 108 11151 0.05% 109 11932 0.05% 110 12605 0.06% 111 13379 0.06% 112 14071 0.06% 113 15370 0.07% 114 15673 0.07% 115 17339 0.08% 116 17481 0.08% 117 18417 0.08% 118 19546 0.09% 119 20589 0.09% 120 21365 0.10% 121 22539 0.10% 122 23581 0.11% 123 24540 0.11% 124 26187 0.12% 125 27693 0.12% 126 28885 0.13% 127 30805 0.14% 128 32241 0.14% 129 33792 0.15% 130 35456 0.16% 131 38075 0.17% 132 39970 0.18% 133 42865 0.19% 134 45412 0.20% 135 48134 0.22% 136 52268 0.23% 137 55680 0.25% 138 59517 0.27% 139 65049 0.29% 140 70744 0.32% 141 77375 0.35% 142 86772 0.39% 143 99556 0.45% 144 116077 0.52% 145 142486 0.64% 146 185235 0.83% 147 247886 1.11% 148 390287 1.75% 149 837986 3.75% 150 4644531 20.80% 151 14346108 64.24% 22333398 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=18 prefix-density=0.85 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=43.62 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=92.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.0 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGA SRR6958189 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:35:01 Started mapping on | Dec 06 15:35:01 Finished on | Dec 06 15:37:10 Mapping speed, Million of reads per hour | 623.26 Number of input reads | 22333398 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21900769 Uniquely mapped reads % | 98.06% Average mapped length | 297.75 Number of splices: Total | 26632901 Number of splices: Annotated (sjdb) | 25183428 Number of splices: GT/AG | 26278417 Number of splices: GC/AG | 313962 Number of splices: AT/AC | 10354 Number of splices: Non-canonical | 30168 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181899 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 7856 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257192 257192 257192 N_multimapping 181899 181899 181899 N_noFeature 703722 21290634 871283 N_ambiguous 530522 2772 89605 UnstrandedReadsAssigned:20666525 PositiveStrandReadsAssigned:607363 NegativeStrandReadsAssigned:20939881 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958189 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958189-trimmed-pair1.fastq SRR6958189-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,333,398 reads, 20,949,478 reads pseudoaligned [quant] estimated average fragment length: 273.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6958189.ke.tsv 35125 SRR6958189.se.tsv 88098 total ==> SRR6958189.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.822 0 0 PNS24247 1044 771.49 62.0135 5.72405 PNS24249 1928 1655.49 46.3753 1.99484 PNS24246 1044 771.49 62.0135 5.72405 PNS24248 1044 771.49 62.0135 5.72405 PNS24244 1471 1198.49 6.58429 0.391221 PNS24243 293 77.8873 0 0 KQK14069 1603 1330.49 3092.1 165.497 KQK14071 474 217.023 64.327 21.1074 ==> SRR6958189.se.tsv <== BRADI_1g14170v3 3570 BRADI_1g53295v3 300 BRADI_1g59795v3 280 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 391 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 315 BRADI_1g48960v3 0 SRR6958189 completed mapping pipeline successfully