Starting /dee2/code/volunteer_pipeline.sh SRR6958190 current disk space = 1550416855040 free memory = 1320488884 SRR6958190 SRAfilesize 29f08d7fd5f84e29d088b41530c332ed SRR6958190.sra SRR6958190.sra file validated SRR6958190 is paired end SRR6958190 is conventional basespace SRR6958190 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958190_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.06725 25.0 18.0 31.0 18.0 33.0 2 28.53675 29.0 27.0 31.0 18.0 33.0 3 30.21125 31.0 29.0 33.0 25.0 33.0 4 32.26875 33.0 32.0 33.0 32.0 33.0 5 32.9115 33.0 33.0 33.0 32.0 34.0 6 36.77225 38.0 37.0 38.0 34.0 38.0 7 37.3845 38.0 38.0 38.0 37.0 38.0 8 37.46175 38.0 38.0 38.0 37.0 38.0 9 37.13775 38.0 38.0 38.0 36.0 38.0 10-14 37.452999999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.48215 38.0 38.0 38.0 37.8 38.0 20-24 37.285199999999996 38.0 38.0 38.0 36.8 38.0 25-29 36.8627 38.0 38.0 38.0 35.4 38.0 30-34 36.9821 38.0 37.8 38.0 35.0 38.0 35-39 37.22729999999999 38.0 38.0 38.0 36.6 38.0 40-44 37.5466 38.0 38.0 38.0 38.0 38.0 45-49 37.5882 38.0 38.0 38.0 38.0 38.0 50-54 37.5558 38.0 38.0 38.0 38.0 38.0 55-59 37.22195 38.0 38.0 38.0 36.2 38.0 60-64 37.0206 38.0 38.0 38.0 35.6 38.0 65-69 37.47265 38.0 38.0 38.0 37.6 38.0 70-74 37.417950000000005 38.0 38.0 38.0 37.2 38.0 75-79 36.30694999999999 38.0 37.2 38.0 32.6 38.0 80-84 36.6471 38.0 37.4 38.0 34.0 38.0 85-89 37.306650000000005 38.0 38.0 38.0 36.8 38.0 90-94 37.325900000000004 38.0 38.0 38.0 37.0 38.0 95-99 37.214800000000004 38.0 38.0 38.0 36.0 38.0 100-104 37.08655 38.0 38.0 38.0 36.0 38.0 105-109 37.025549999999996 38.0 38.0 38.0 35.6 38.0 110-114 37.1579 38.0 38.0 38.0 36.0 38.0 115-119 36.8862 38.0 38.0 38.0 35.0 38.0 120-124 36.602999999999994 38.0 38.0 38.0 34.4 38.0 125-129 36.579899999999995 38.0 38.0 38.0 34.4 38.0 130-134 35.80515 38.0 36.8 38.0 29.6 38.0 135-139 35.06125 38.0 35.4 38.0 26.8 38.0 140-144 35.77645 38.0 36.6 38.0 30.8 38.0 145-149 35.93364999999999 38.0 37.4 38.0 33.2 38.0 150-151 32.509 35.5 33.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 3.0 23 0.0 24 6.0 25 5.0 26 7.0 27 4.0 28 18.0 29 16.0 30 31.0 31 41.0 32 56.0 33 84.0 34 133.0 35 266.0 36 747.0 37 2575.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.237382703525235 12.376363175247274 6.061374587877251 33.32487953335024 2 27.05 12.55 30.0 30.4 3 21.025 16.925 24.6 37.45 4 26.174999999999997 24.349999999999998 21.875 27.6 5 27.325 28.825 21.85 22.0 6 23.474999999999998 31.825 22.85 21.85 7 17.75 24.0 39.825 18.425 8 20.5 22.7 28.849999999999998 27.950000000000003 9 19.400000000000002 20.5 33.6 26.5 10-14 22.95 25.929999999999996 25.674999999999997 25.445 15-19 23.16 25.080000000000002 25.755 26.005 20-24 23.055 25.695 25.82 25.430000000000003 25-29 23.185 25.685000000000002 25.490000000000002 25.64 30-34 23.3 24.825 25.865 26.009999999999998 35-39 23.655 25.074999999999996 25.435000000000002 25.835 40-44 23.74 25.419999999999998 25.115 25.724999999999998 45-49 23.445 24.875 25.580000000000002 26.1 50-54 23.705000000000002 25.34 24.865000000000002 26.090000000000003 55-59 24.165 25.25 25.080000000000002 25.505 60-64 23.605 25.365 25.045 25.985000000000003 65-69 23.971198559928 24.746237311865592 25.43627181359068 25.84629231461573 70-74 23.65 25.335 25.155 25.86 75-79 23.535 24.185000000000002 25.935000000000002 26.345000000000002 80-84 24.005000000000003 24.93 25.455 25.61 85-89 23.47 24.93 25.56 26.040000000000003 90-94 24.27 24.705 25.009999999999998 26.015 95-99 23.32 24.335 25.71 26.634999999999998 100-104 24.255 24.505 25.215 26.025 105-109 24.435000000000002 24.58 25.03 25.955000000000002 110-114 24.099999999999998 24.67 25.264999999999997 25.965 115-119 24.3 25.3 24.935 25.465 120-124 24.349999999999998 25.025 24.21 26.415 125-129 24.665 25.319999999999997 24.305 25.71 130-134 24.490000000000002 24.97 24.735 25.805 135-139 24.44 24.91 24.84 25.81 140-144 24.095 25.074999999999996 24.27 26.56 145-149 24.19 25.405 24.905 25.5 150-151 23.7125 25.1875 24.1875 26.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 2.0 28 2.0 29 4.0 30 5.0 31 9.0 32 12.5 33 18.0 34 27.0 35 36.5 36 43.0 37 57.0 38 77.0 39 92.5 40 120.0 41 159.5 42 171.0 43 170.5 44 185.5 45 198.0 46 202.0 47 186.5 48 176.5 49 186.5 50 178.0 51 149.5 52 127.0 53 115.5 54 111.5 55 99.0 56 93.0 57 89.5 58 88.0 59 82.0 60 68.5 61 74.5 62 74.0 63 64.0 64 60.5 65 57.5 66 57.5 67 50.0 68 37.0 69 33.0 70 33.0 71 29.0 72 22.0 73 18.0 74 12.5 75 9.0 76 9.0 77 5.5 78 2.0 79 1.5 80 1.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTCA 10 0.006830828 145.0 8 >>END_MODULE SRR6958190 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958190_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0895 33.0 33.0 34.0 32.0 34.0 2 33.1675 34.0 33.0 34.0 33.0 34.0 3 33.2595 34.0 33.0 34.0 33.0 34.0 4 33.18275 34.0 33.0 34.0 33.0 34.0 5 33.05775 34.0 33.0 34.0 33.0 34.0 6 37.41 38.0 38.0 38.0 37.0 38.0 7 37.41875 38.0 38.0 38.0 38.0 38.0 8 37.39325 38.0 38.0 38.0 38.0 38.0 9 37.41475 38.0 38.0 38.0 38.0 38.0 10-14 37.36495 38.0 38.0 38.0 37.8 38.0 15-19 37.38785 38.0 38.0 38.0 38.0 38.0 20-24 37.419799999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.35315 38.0 38.0 38.0 37.8 38.0 30-34 37.37285 38.0 38.0 38.0 38.0 38.0 35-39 37.2328 38.0 38.0 38.0 37.2 38.0 40-44 36.9313 38.0 38.0 38.0 36.2 38.0 45-49 36.931 38.0 38.0 38.0 36.4 38.0 50-54 37.05635 38.0 38.0 38.0 36.6 38.0 55-59 37.231500000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.24435 38.0 38.0 38.0 37.4 38.0 65-69 37.20125 38.0 38.0 38.0 37.0 38.0 70-74 37.1952 38.0 38.0 38.0 37.0 38.0 75-79 37.158699999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.01485 38.0 38.0 38.0 36.2 38.0 85-89 36.82795 38.0 38.0 38.0 35.8 38.0 90-94 36.86585 38.0 38.0 38.0 36.0 38.0 95-99 36.73245 38.0 38.0 38.0 35.0 38.0 100-104 36.73254999999999 38.0 38.0 38.0 35.2 38.0 105-109 36.8251 38.0 38.0 38.0 35.0 38.0 110-114 36.63955 38.0 38.0 38.0 34.6 38.0 115-119 36.52135 38.0 38.0 38.0 34.6 38.0 120-124 36.36855 38.0 38.0 38.0 34.0 38.0 125-129 36.26485 38.0 38.0 38.0 33.8 38.0 130-134 36.20465 38.0 38.0 38.0 33.8 38.0 135-139 35.8359 38.0 37.2 38.0 33.0 38.0 140-144 35.4759 38.0 36.0 38.0 31.0 38.0 145-149 35.04435 38.0 36.0 38.0 31.0 38.0 150-151 30.626875 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 3.0 5 3.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 3.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 2.0 23 2.0 24 3.0 25 7.0 26 9.0 27 14.0 28 21.0 29 26.0 30 32.0 31 36.0 32 55.0 33 79.0 34 124.0 35 182.0 36 433.0 37 2941.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.449999999999996 21.575 9.6 26.375 2 32.375 23.275000000000002 26.025 18.325 3 22.325 25.15 28.749999999999996 23.775 4 24.775 31.974999999999998 21.65 21.6 5 27.750000000000004 33.275 19.400000000000002 19.575 6 23.724999999999998 35.475 20.150000000000002 20.65 7 22.8 19.05 35.4 22.75 8 23.849999999999998 22.650000000000002 23.75 29.75 9 22.5 21.375 27.675 28.449999999999996 10-14 25.865 26.064999999999998 22.85 25.22 15-19 25.85758575857586 25.542554255425543 24.352435243524354 24.247424742474248 20-24 26.215 25.89 23.755000000000003 24.14 25-29 25.83 25.455 24.169999999999998 24.545 30-34 25.435000000000002 25.435000000000002 24.73 24.4 35-39 25.595000000000002 24.865000000000002 23.885 25.655 40-44 26.165 25.275 23.64 24.92 45-49 25.88 25.119999999999997 24.415 24.585 50-54 26.155 25.955000000000002 23.705000000000002 24.185000000000002 55-59 26.195 25.135 24.08 24.59 60-64 26.41 25.080000000000002 24.154999999999998 24.355 65-69 25.86 25.035 24.26 24.845 70-74 26.185000000000002 24.92 24.355 24.54 75-79 26.39 24.905 24.36 24.345 80-84 26.515 25.369999999999997 23.57 24.545 85-89 25.990000000000002 25.319999999999997 24.485 24.205 90-94 26.229999999999997 25.259999999999998 24.0 24.51 95-99 26.361318065903294 25.391269563478176 24.516225811290564 23.731186559327966 100-104 27.279999999999998 24.610000000000003 23.830000000000002 24.279999999999998 105-109 26.16 25.615 23.94 24.285 110-114 26.290000000000003 25.88 23.775 24.055 115-119 26.877687768776877 25.367536753675367 23.827382738273826 23.927392739273927 120-124 26.27 26.0 24.015 23.715 125-129 26.939999999999998 25.515 24.03 23.515 130-134 27.395000000000003 25.55 23.285 23.77 135-139 27.32 25.169999999999998 24.695 22.814999999999998 140-144 27.366368318415923 25.906295314765735 23.801190059502975 22.926146307315364 145-149 27.365000000000002 25.86 23.935000000000002 22.84 150-151 27.0 26.325 23.8125 22.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.5 26 1.5 27 1.0 28 3.0 29 4.5 30 6.0 31 8.5 32 9.0 33 13.5 34 20.0 35 32.5 36 54.5 37 64.5 38 69.5 39 83.5 40 104.0 41 133.0 42 150.5 43 166.5 44 177.0 45 179.0 46 177.5 47 185.0 48 181.5 49 158.0 50 154.5 51 148.0 52 130.0 53 116.5 54 108.0 55 102.0 56 108.0 57 108.0 58 94.5 59 92.0 60 89.5 61 77.5 62 73.5 63 73.5 64 72.0 65 73.0 66 66.5 67 55.0 68 51.5 69 49.5 70 38.5 71 26.0 72 23.5 73 24.5 74 18.0 75 11.5 76 9.5 77 5.5 78 3.5 79 3.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21598381385938 98.075 2 0.556398583712696 1.0999999999999999 3 0.12645422357106728 0.375 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.4625 0.0 0.0 0.0 0.0 132-133 5.862500000000001 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973149 spots for SRR6958190.sra Written 973149 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra Read 973148 spots for SRR6958190.sra Written 973148 spots for SRR6958190.sra SRR ids: ['SRR6958190.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rww_knlv SRR6958190.sra spots: 19462961 blocks: [[1, 973148], [973149, 1946296], [1946297, 2919444], [2919445, 3892592], [3892593, 4865740], [4865741, 5838888], [5838889, 6812036], [6812037, 7785184], [7785185, 8758332], [8758333, 9731480], [9731481, 10704628], [10704629, 11677776], [11677777, 12650924], [12650925, 13624072], [13624073, 14597220], [14597221, 15570368], [15570369, 16543516], [16543517, 17516664], [17516665, 18489812], [18489813, 19462961]] SRR6958190 file size 6573658 SRR6958190 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958190 SRR6958190_1.fastq SRR6958190_2.fastq Input file: SRR6958190_1.fastq Paired file: SRR6958190_2.fastq trimmed: SRR6958190-trimmed-pair1.fastq, SRR6958190-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:34:24 2024 >> started Fri Dec 6 15:34:46 2024 >> done (21.241s) 19462961 read pairs processed; of these: 22047 ( 0.11%) short read pairs filtered out after trimming by size control 23091 ( 0.12%) empty read pairs filtered out after trimming by size control 19417823 (99.77%) read pairs available; of these: 7210847 (37.14%) trimmed read pairs available after processing 12206976 (62.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 13 0.00% 21 14 0.00% 22 10 0.00% 23 16 0.00% 24 17 0.00% 25 13 0.00% 26 20 0.00% 27 16 0.00% 28 21 0.00% 29 16 0.00% 30 13 0.00% 31 14 0.00% 32 21 0.00% 33 7 0.00% 34 30 0.00% 35 20 0.00% 36 32 0.00% 37 21 0.00% 38 26 0.00% 39 41 0.00% 40 35 0.00% 41 41 0.00% 42 40 0.00% 43 35 0.00% 44 35 0.00% 45 48 0.00% 46 37 0.00% 47 51 0.00% 48 62 0.00% 49 76 0.00% 50 76 0.00% 51 78 0.00% 52 98 0.00% 53 87 0.00% 54 117 0.00% 55 118 0.00% 56 159 0.00% 57 144 0.00% 58 149 0.00% 59 209 0.00% 60 234 0.00% 61 267 0.00% 62 297 0.00% 63 362 0.00% 64 366 0.00% 65 400 0.00% 66 485 0.00% 67 514 0.00% 68 623 0.00% 69 692 0.00% 70 781 0.00% 71 920 0.00% 72 1102 0.01% 73 1183 0.01% 74 1304 0.01% 75 1450 0.01% 76 1756 0.01% 77 1997 0.01% 78 2038 0.01% 79 2291 0.01% 80 2586 0.01% 81 2889 0.01% 82 3365 0.02% 83 3774 0.02% 84 5130 0.03% 85 6146 0.03% 86 6374 0.03% 87 7038 0.04% 88 7391 0.04% 89 7545 0.04% 90 8329 0.04% 91 9167 0.05% 92 9584 0.05% 93 10564 0.05% 94 11315 0.06% 95 12201 0.06% 96 13001 0.07% 97 13784 0.07% 98 14498 0.07% 99 15420 0.08% 100 16538 0.09% 101 17509 0.09% 102 19006 0.10% 103 19849 0.10% 104 21403 0.11% 105 22183 0.11% 106 23813 0.12% 107 24309 0.13% 108 25644 0.13% 109 27148 0.14% 110 28127 0.14% 111 29350 0.15% 112 30965 0.16% 113 31878 0.16% 114 33882 0.17% 115 35295 0.18% 116 36802 0.19% 117 38396 0.20% 118 39353 0.20% 119 40344 0.21% 120 41897 0.22% 121 43163 0.22% 122 44360 0.23% 123 45796 0.24% 124 48021 0.25% 125 49802 0.26% 126 51523 0.27% 127 53100 0.27% 128 53614 0.28% 129 55451 0.29% 130 57146 0.29% 131 58937 0.30% 132 61305 0.32% 133 62835 0.32% 134 64698 0.33% 135 67700 0.35% 136 69452 0.36% 137 71397 0.37% 138 74217 0.38% 139 77793 0.40% 140 80808 0.42% 141 84892 0.44% 142 93210 0.48% 143 106484 0.55% 144 106799 0.55% 145 121428 0.63% 146 145452 0.75% 147 191907 0.99% 148 275570 1.42% 149 499831 2.57% 150 3599204 18.54% 151 12206976 62.86% 19417823 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=60.08 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=87.57 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.9 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958190 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:35:45 Started mapping on | Dec 06 15:35:45 Finished on | Dec 06 15:37:09 Mapping speed, Million of reads per hour | 832.19 Number of input reads | 19417823 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19075928 Uniquely mapped reads % | 98.24% Average mapped length | 294.52 Number of splices: Total | 20644270 Number of splices: Annotated (sjdb) | 19315484 Number of splices: GT/AG | 20377367 Number of splices: GC/AG | 241880 Number of splices: AT/AC | 7923 Number of splices: Non-canonical | 17100 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 140060 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 10794 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217872 217872 217872 N_multimapping 140060 140060 140060 N_noFeature 731108 18483689 944352 N_ambiguous 455341 2650 77211 UnstrandedReadsAssigned:17889479 PositiveStrandReadsAssigned:589589 NegativeStrandReadsAssigned:18054365 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958190 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958190-trimmed-pair1.fastq SRR6958190-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,417,823 reads, 18,077,996 reads pseudoaligned [quant] estimated average fragment length: 254.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR6958190.ke.tsv 35125 SRR6958190.se.tsv 88098 total ==> SRR6958190.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.368 0 0 PNS24247 1044 790.715 56.9312 5.89152 PNS24249 1928 1674.72 73.3983 3.58626 PNS24246 1044 790.715 56.9312 5.89152 PNS24248 1044 790.715 56.9312 5.89152 PNS24244 1471 1217.72 56.8081 3.81734 PNS24243 293 96.2212 0 0 KQK14069 1603 1349.72 6516.55 395.069 KQK14071 474 239.27 149.752 51.2131 ==> SRR6958190.se.tsv <== BRADI_1g14170v3 7600 BRADI_1g53295v3 261 BRADI_1g59795v3 394 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 156 BRADI_1g74790v3 149 BRADI_1g09890v3 0 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR6958190 completed mapping pipeline successfully