Starting /dee2/code/volunteer_pipeline.sh SRR6958191 current disk space = 1550400946176 free memory = 1343116136 SRR6958191 SRAfilesize 227d61450a17434e5239fa02770ab08b SRR6958191.sra SRR6958191.sra file validated SRR6958191 is paired end SRR6958191 is conventional basespace SRR6958191 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958191_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2765 30.0 18.0 33.0 18.0 33.0 2 28.221 29.0 25.0 33.0 18.0 33.0 3 30.3205 31.0 29.0 33.0 27.0 33.0 4 31.14025 32.0 32.0 33.0 27.0 33.0 5 32.44375 33.0 33.0 33.0 32.0 33.0 6 36.728 38.0 37.0 38.0 34.0 38.0 7 36.922 38.0 37.0 38.0 35.0 38.0 8 37.2735 38.0 38.0 38.0 36.0 38.0 9 37.4935 38.0 38.0 38.0 37.0 38.0 10-14 36.9799 38.0 37.8 38.0 35.0 38.0 15-19 35.6693 37.8 35.0 38.0 30.8 38.0 20-24 35.856649999999995 38.0 36.6 38.0 29.0 38.0 25-29 37.43845 38.0 38.0 38.0 37.2 38.0 30-34 37.56830000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.509550000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.583299999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.590250000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.55865 38.0 38.0 38.0 38.0 38.0 55-59 37.47865 38.0 38.0 38.0 38.0 38.0 60-64 37.4413 38.0 38.0 38.0 37.4 38.0 65-69 37.494749999999996 38.0 38.0 38.0 38.0 38.0 70-74 37.4504 38.0 38.0 38.0 37.6 38.0 75-79 36.588350000000005 38.0 37.4 38.0 33.8 38.0 80-84 37.3279 38.0 38.0 38.0 37.0 38.0 85-89 37.3189 38.0 38.0 38.0 37.0 38.0 90-94 36.758449999999996 38.0 37.8 38.0 34.8 38.0 95-99 37.17915 38.0 38.0 38.0 36.4 38.0 100-104 37.153200000000005 38.0 38.0 38.0 36.2 38.0 105-109 37.08385 38.0 38.0 38.0 36.0 38.0 110-114 37.08395 38.0 38.0 38.0 36.0 38.0 115-119 36.866 38.0 38.0 38.0 35.4 38.0 120-124 36.5895 38.0 38.0 38.0 34.6 38.0 125-129 36.6305 38.0 38.0 38.0 34.8 38.0 130-134 36.525150000000004 38.0 38.0 38.0 34.0 38.0 135-139 36.41395 38.0 38.0 38.0 34.0 38.0 140-144 36.2709 38.0 38.0 38.0 33.6 38.0 145-149 35.8907 38.0 38.0 38.0 32.4 38.0 150-151 32.141375000000004 35.5 32.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 1.0 22 3.0 23 3.0 24 2.0 25 3.0 26 4.0 27 10.0 28 14.0 29 22.0 30 23.0 31 37.0 32 55.0 33 67.0 34 123.0 35 213.0 36 667.0 37 2742.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.51217038539554 9.102434077079108 6.288032454361055 39.097363083164296 2 26.224999999999998 12.1 33.2 28.475 3 22.05 15.375 24.825 37.75 4 25.8 25.224999999999998 21.4 27.575 5 27.650000000000002 28.875 22.15 21.325 6 22.1055263815954 31.757939484871216 23.730932733183295 22.405601400350086 7 17.575 23.325000000000003 39.975 19.125 8 20.1 22.625 30.775000000000002 26.5 9 19.3 21.45 33.575 25.674999999999997 10-14 22.765 26.939999999999998 25.52 24.775 15-19 23.215 24.875 26.39 25.52 20-24 23.04 25.035 26.224999999999998 25.7 25-29 23.59 24.935 26.38 25.095 30-34 23.316165808290414 25.211260563028155 26.10130506525326 25.371268563428174 35-39 23.03115155757788 25.131256562828142 26.381319065953296 25.456272813640684 40-44 23.655 24.665 25.509999999999998 26.169999999999998 45-49 23.330000000000002 25.074999999999996 25.900000000000002 25.695 50-54 23.345 25.119999999999997 25.82 25.715 55-59 23.47 25.074999999999996 25.69 25.765 60-64 23.31 24.88 25.865 25.945 65-69 23.53117655882794 25.02125106255313 25.83129156457823 25.616280814040703 70-74 23.381169058452922 25.236261813090653 26.181309065453274 25.20126006300315 75-79 23.635 24.905 25.924999999999997 25.535000000000004 80-84 23.486174308715434 24.71123556177809 26.056302815140757 25.746287314365716 85-89 23.875 25.080000000000002 25.040000000000003 26.005 90-94 24.154999999999998 24.945 25.34 25.56 95-99 24.034806961392277 24.67993598719744 25.600120024004802 25.68513702740548 100-104 23.645 25.7 25.080000000000002 25.575 105-109 24.056202810140505 25.216260813040652 24.821241062053105 25.906295314765735 110-114 23.201160058002902 25.496274813740687 25.571278563928196 25.731286564328215 115-119 23.881194059702985 25.00125006250313 25.256262813140655 25.861293064653236 120-124 23.724999999999998 25.525 25.355 25.395 125-129 23.60118005900295 24.706235311765585 25.43627181359068 26.256312815640783 130-134 24.085 24.93 25.169999999999998 25.814999999999998 135-139 23.71 25.629999999999995 25.195 25.465 140-144 23.215 25.72 25.064999999999998 26.0 145-149 23.72 25.36 25.259999999999998 25.66 150-151 23.6875 26.1125 24.5125 25.687500000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.0 27 2.5 28 5.5 29 5.0 30 5.0 31 8.0 32 15.5 33 22.5 34 28.5 35 38.5 36 44.0 37 52.0 38 67.0 39 94.0 40 130.0 41 145.5 42 160.5 43 187.0 44 200.0 45 194.0 46 193.0 47 215.0 48 201.5 49 176.5 50 169.5 51 148.0 52 139.0 53 116.0 54 101.0 55 108.5 56 103.5 57 95.0 58 84.5 59 81.5 60 84.5 61 80.5 62 70.0 63 59.5 64 56.5 65 60.5 66 45.0 67 32.0 68 33.5 69 29.5 70 29.5 71 23.5 72 14.5 73 9.5 74 5.5 75 4.0 76 7.0 77 8.5 78 3.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0125 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0125 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.07500000000000001 0.025 0.0 0.0 0.0 84-85 0.1375 0.025 0.0 0.0 0.0 86-87 0.2 0.025 0.0 0.0 0.0 88-89 0.21250000000000002 0.025 0.0 0.0 0.0 90-91 0.2375 0.025 0.0 0.0 0.0 92-93 0.275 0.025 0.0 0.0 0.0 94-95 0.3375 0.025 0.0 0.0 0.0 96-97 0.44999999999999996 0.025 0.0 0.0 0.0 98-99 0.5 0.025 0.0 0.0 0.0 100-101 0.6125 0.025 0.0 0.0 0.0 102-103 0.825 0.025 0.0 0.0 0.0 104-105 1.025 0.025 0.0 0.0 0.0 106-107 1.1125 0.025 0.0 0.0 0.0 108-109 1.3625 0.025 0.0 0.0 0.0 110-111 1.625 0.025 0.0 0.0 0.0 112-113 1.9375 0.025 0.0 0.0 0.0 114-115 2.3125 0.025 0.0 0.0 0.0 116-117 2.625 0.025 0.0 0.0 0.0 118-119 2.8625 0.025 0.0 0.0 0.0 120-121 3.2 0.025 0.0 0.0 0.0 122-123 3.55 0.025 0.0 0.0 0.0 124-125 3.8499999999999996 0.025 0.0 0.0 0.0 126-127 4.0875 0.025 0.0 0.0 0.0 128-129 4.5125 0.025 0.0 0.0 0.0 130-131 4.9875 0.025 0.0 0.0 0.0 132-133 5.425 0.025 0.0 0.0 0.0 134-135 5.825 0.025 0.0 0.0 0.0 136-137 6.35 0.025 0.0 0.0 0.0 138-139 6.9375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958191 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958191_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.692 33.0 33.0 34.0 32.0 34.0 2 33.0335 33.0 33.0 34.0 32.0 34.0 3 33.09325 34.0 33.0 34.0 33.0 34.0 4 33.186 34.0 33.0 34.0 33.0 34.0 5 31.399 33.0 32.0 34.0 27.0 34.0 6 36.883 38.0 38.0 38.0 36.0 38.0 7 37.2705 38.0 38.0 38.0 37.0 38.0 8 37.317 38.0 38.0 38.0 37.0 38.0 9 37.42225 38.0 38.0 38.0 37.0 38.0 10-14 37.3866 38.0 38.0 38.0 37.8 38.0 15-19 37.39665 38.0 38.0 38.0 38.0 38.0 20-24 37.385749999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.3172 38.0 38.0 38.0 38.0 38.0 30-34 37.3683 38.0 38.0 38.0 38.0 38.0 35-39 37.19345 38.0 38.0 38.0 37.4 38.0 40-44 37.0432 38.0 38.0 38.0 36.6 38.0 45-49 37.01765 38.0 38.0 38.0 36.6 38.0 50-54 37.201 38.0 38.0 38.0 37.0 38.0 55-59 37.2618 38.0 38.0 38.0 37.0 38.0 60-64 37.1862 38.0 38.0 38.0 37.0 38.0 65-69 37.21495 38.0 38.0 38.0 37.0 38.0 70-74 37.2067 38.0 38.0 38.0 37.0 38.0 75-79 37.1658 38.0 38.0 38.0 37.0 38.0 80-84 37.047000000000004 38.0 38.0 38.0 36.6 38.0 85-89 36.95595 38.0 38.0 38.0 36.0 38.0 90-94 36.8682 38.0 38.0 38.0 35.8 38.0 95-99 36.6287 38.0 38.0 38.0 35.0 38.0 100-104 36.7096 38.0 38.0 38.0 35.0 38.0 105-109 36.7062 38.0 38.0 38.0 35.0 38.0 110-114 36.561099999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.4128 38.0 38.0 38.0 34.2 38.0 120-124 35.451 38.0 36.2 38.0 28.8 38.0 125-129 35.95625 38.0 37.8 38.0 33.0 38.0 130-134 35.9238 38.0 38.0 38.0 32.8 38.0 135-139 35.5084 38.0 36.8 38.0 31.6 38.0 140-144 35.13565 38.0 36.0 38.0 30.4 38.0 145-149 34.583299999999994 38.0 36.0 38.0 29.6 38.0 150-151 28.31125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 3.0 15 3.0 16 2.0 17 0.0 18 2.0 19 0.0 20 4.0 21 6.0 22 4.0 23 10.0 24 11.0 25 12.0 26 17.0 27 17.0 28 20.0 29 23.0 30 33.0 31 39.0 32 53.0 33 82.0 34 123.0 35 203.0 36 507.0 37 2812.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 18.25 9.875 34.150000000000006 2 28.075 24.224999999999998 28.525 19.175 3 21.680420105026258 24.90622655663916 28.432108027006752 24.981245311327832 4 27.224999999999998 30.675 20.05 22.05 5 27.675 32.95 20.0 19.375 6 21.25 36.75 21.575 20.424999999999997 7 22.875 18.525 35.825 22.775000000000002 8 23.95 23.35 24.825 27.875 9 22.725 22.225 28.499999999999996 26.55 10-14 25.985000000000003 25.45 23.674999999999997 24.89 15-19 25.900000000000002 25.025 24.965 24.11 20-24 25.335 25.564999999999998 24.905 24.195 25-29 25.590000000000003 25.155 24.305 24.95 30-34 24.94 25.814999999999998 25.15 24.095 35-39 25.91 25.485000000000003 24.03 24.575 40-44 25.924999999999997 25.545 24.135 24.395 45-49 25.345000000000002 25.650000000000002 24.465 24.54 50-54 25.509999999999998 25.965 24.54 23.985 55-59 25.995 25.28 24.505 24.22 60-64 25.705 25.055 24.615000000000002 24.625 65-69 25.380000000000003 26.345000000000002 24.315 23.96 70-74 25.755 25.064999999999998 24.709999999999997 24.47 75-79 26.169999999999998 25.36 24.65 23.82 80-84 25.195 25.985000000000003 24.7 24.12 85-89 26.55 25.71 23.505000000000003 24.235 90-94 25.845000000000002 25.740000000000002 24.525 23.89 95-99 26.119999999999997 25.715 24.035 24.13 100-104 26.31 25.840000000000003 24.305 23.544999999999998 105-109 26.39 25.080000000000002 24.805 23.724999999999998 110-114 26.025 26.32 24.335 23.32 115-119 26.47 25.575 23.94 24.015 120-124 26.265 25.900000000000002 24.240000000000002 23.595 125-129 26.47 25.715 24.560000000000002 23.255 130-134 27.01 25.85 24.215 22.925 135-139 26.88 25.4 24.855 22.865 140-144 26.755000000000003 26.145000000000003 23.815 23.285 145-149 27.2063603180159 25.966298314915747 24.41622081104055 22.411120556027804 150-151 27.05 26.7625 23.35 22.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 0.5 27 2.0 28 3.5 29 7.0 30 10.0 31 8.5 32 12.5 33 17.5 34 25.0 35 39.0 36 41.0 37 50.0 38 68.5 39 83.5 40 111.0 41 153.0 42 167.5 43 165.0 44 182.0 45 191.5 46 192.5 47 183.0 48 168.0 49 174.5 50 170.5 51 159.0 52 149.5 53 120.5 54 109.5 55 105.5 56 99.5 57 88.0 58 76.5 59 87.0 60 90.0 61 81.0 62 77.0 63 70.0 64 63.0 65 61.5 66 56.5 67 52.0 68 53.0 69 44.0 70 28.5 71 26.0 72 22.5 73 16.5 74 11.0 75 7.0 76 5.0 77 3.5 78 2.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80771182141045 97.375 2 1.06544901065449 2.1 3 0.025367833587011668 0.075 4 0.050735667174023336 0.2 5 0.050735667174023336 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 5 0.125 No Hit ACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 5.8875 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 100-104 >>END_MODULE Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078588 spots for SRR6958191.sra Written 1078588 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra Read 1078581 spots for SRR6958191.sra Written 1078581 spots for SRR6958191.sra SRR ids: ['SRR6958191.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n054wdgd SRR6958191.sra spots: 21571627 blocks: [[1, 1078581], [1078582, 2157162], [2157163, 3235743], [3235744, 4314324], [4314325, 5392905], [5392906, 6471486], [6471487, 7550067], [7550068, 8628648], [8628649, 9707229], [9707230, 10785810], [10785811, 11864391], [11864392, 12942972], [12942973, 14021553], [14021554, 15100134], [15100135, 16178715], [16178716, 17257296], [17257297, 18335877], [18335878, 19414458], [19414459, 20493039], [20493040, 21571627]] SRR6958191 file size 7288216 SRR6958191 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958191 SRR6958191_1.fastq SRR6958191_2.fastq Input file: SRR6958191_1.fastq Paired file: SRR6958191_2.fastq trimmed: SRR6958191-trimmed-pair1.fastq, SRR6958191-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:34:59 2024 >> started Fri Dec 6 15:35:28 2024 >> done (29.180s) 21571627 read pairs processed; of these: 13473 ( 0.06%) short read pairs filtered out after trimming by size control 12370 ( 0.06%) empty read pairs filtered out after trimming by size control 21545784 (99.88%) read pairs available; of these: 7849774 (36.43%) trimmed read pairs available after processing 13696010 (63.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 7 0.00% 21 12 0.00% 22 7 0.00% 23 10 0.00% 24 14 0.00% 25 10 0.00% 26 11 0.00% 27 10 0.00% 28 11 0.00% 29 10 0.00% 30 14 0.00% 31 8 0.00% 32 21 0.00% 33 9 0.00% 34 7 0.00% 35 17 0.00% 36 22 0.00% 37 17 0.00% 38 30 0.00% 39 33 0.00% 40 29 0.00% 41 39 0.00% 42 39 0.00% 43 29 0.00% 44 27 0.00% 45 31 0.00% 46 46 0.00% 47 37 0.00% 48 56 0.00% 49 87 0.00% 50 81 0.00% 51 87 0.00% 52 103 0.00% 53 88 0.00% 54 108 0.00% 55 115 0.00% 56 143 0.00% 57 152 0.00% 58 186 0.00% 59 212 0.00% 60 259 0.00% 61 257 0.00% 62 275 0.00% 63 357 0.00% 64 341 0.00% 65 463 0.00% 66 502 0.00% 67 470 0.00% 68 590 0.00% 69 665 0.00% 70 822 0.00% 71 846 0.00% 72 977 0.00% 73 1158 0.01% 74 1247 0.01% 75 1431 0.01% 76 1638 0.01% 77 1775 0.01% 78 2015 0.01% 79 2339 0.01% 80 2605 0.01% 81 3002 0.01% 82 3193 0.01% 83 3748 0.02% 84 4622 0.02% 85 5476 0.03% 86 5772 0.03% 87 6397 0.03% 88 6841 0.03% 89 7274 0.03% 90 7826 0.04% 91 8862 0.04% 92 9552 0.04% 93 10176 0.05% 94 11342 0.05% 95 11907 0.06% 96 13216 0.06% 97 14136 0.07% 98 14788 0.07% 99 15867 0.07% 100 16833 0.08% 101 18140 0.08% 102 19358 0.09% 103 20561 0.10% 104 21793 0.10% 105 22852 0.11% 106 24439 0.11% 107 25602 0.12% 108 26546 0.12% 109 27997 0.13% 110 29672 0.14% 111 30568 0.14% 112 32949 0.15% 113 34411 0.16% 114 35388 0.16% 115 37085 0.17% 116 38749 0.18% 117 39626 0.18% 118 41845 0.19% 119 42481 0.20% 120 44112 0.20% 121 45535 0.21% 122 47099 0.22% 123 49077 0.23% 124 50901 0.24% 125 53209 0.25% 126 54624 0.25% 127 56558 0.26% 128 57727 0.27% 129 59304 0.28% 130 61960 0.29% 131 63467 0.29% 132 66434 0.31% 133 68652 0.32% 134 71015 0.33% 135 73185 0.34% 136 76131 0.35% 137 78456 0.36% 138 80987 0.38% 139 85313 0.40% 140 88264 0.41% 141 93337 0.43% 142 100623 0.47% 143 106609 0.49% 144 118001 0.55% 145 133831 0.62% 146 157081 0.73% 147 199982 0.93% 148 284268 1.32% 149 539890 2.51% 150 4010225 18.61% 151 13696010 63.57% 21545784 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=21 prefix-density=0.79 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=56.31 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=24 prefix-density=0.59 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=28.68 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958191 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:36:27 Started mapping on | Dec 06 15:36:27 Finished on | Dec 06 15:37:49 Mapping speed, Million of reads per hour | 945.91 Number of input reads | 21545784 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21286662 Uniquely mapped reads % | 98.80% Average mapped length | 295.05 Number of splices: Total | 23784024 Number of splices: Annotated (sjdb) | 22301951 Number of splices: GT/AG | 23479972 Number of splices: GC/AG | 274415 Number of splices: AT/AC | 9094 Number of splices: Non-canonical | 20543 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 131779 % of reads mapped to multiple loci | 0.61% Number of reads mapped to too many loci | 8483 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 136396 136396 136396 N_multimapping 131779 131779 131779 N_noFeature 833750 20648251 1050072 N_ambiguous 504223 2951 83347 UnstrandedReadsAssigned:19948689 PositiveStrandReadsAssigned:635460 NegativeStrandReadsAssigned:20153243 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958191 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958191-trimmed-pair1.fastq SRR6958191-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,545,784 reads, 20,180,187 reads pseudoaligned [quant] estimated average fragment length: 256.477 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958191.ke.tsv 35125 SRR6958191.se.tsv 88098 total ==> SRR6958191.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.294 0 0 PNS24247 1044 788.523 66.9554 6.42071 PNS24249 1928 1672.52 25.2018 1.13939 PNS24246 1044 788.523 66.9554 6.42071 PNS24248 1044 788.523 66.9554 6.42071 PNS24244 1471 1215.52 47.9321 2.98178 PNS24243 293 95.5468 0 0 KQK14069 1603 1347.52 2979.55 167.196 KQK14071 474 238.435 67.3431 21.3568 ==> SRR6958191.se.tsv <== BRADI_1g14170v3 3490 BRADI_1g53295v3 416 BRADI_1g59795v3 286 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 261 BRADI_1g74790v3 164 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 0 SRR6958191 completed mapping pipeline successfully