Starting /dee2/code/volunteer_pipeline.sh SRR6958192 current disk space = 1550407716864 free memory = 1601268204 SRR6958192 SRAfilesize d13e17021bc6019057cbec01be6378f2 SRR6958192.sra SRR6958192.sra file validated SRR6958192 is paired end SRR6958192 is conventional basespace SRR6958192 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958192_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.85625 32.0 18.0 33.0 18.0 33.0 2 29.684 31.0 27.0 33.0 25.0 33.0 3 30.76375 31.0 29.0 33.0 27.0 33.0 4 32.265 33.0 32.0 33.0 32.0 33.0 5 32.643 33.0 33.0 33.0 32.0 34.0 6 36.79575 38.0 37.0 38.0 34.0 38.0 7 37.32125 38.0 38.0 38.0 37.0 38.0 8 37.5925 38.0 38.0 38.0 38.0 38.0 9 37.67025 38.0 38.0 38.0 38.0 38.0 10-14 37.17065 38.0 38.0 38.0 36.0 38.0 15-19 35.9165 37.8 35.4 38.0 31.2 38.0 20-24 35.96615 38.0 36.6 38.0 29.8 38.0 25-29 37.52355 38.0 38.0 38.0 37.6 38.0 30-34 37.632 38.0 38.0 38.0 38.0 38.0 35-39 37.5711 38.0 38.0 38.0 38.0 38.0 40-44 37.61635 38.0 38.0 38.0 38.0 38.0 45-49 37.6207 38.0 38.0 38.0 38.0 38.0 50-54 37.6292 38.0 38.0 38.0 38.0 38.0 55-59 37.53885 38.0 38.0 38.0 38.0 38.0 60-64 37.550650000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.53875 38.0 38.0 38.0 38.0 38.0 70-74 37.502250000000004 38.0 38.0 38.0 37.8 38.0 75-79 36.789649999999995 38.0 37.6 38.0 34.2 38.0 80-84 37.41310000000001 38.0 38.0 38.0 37.0 38.0 85-89 37.4019 38.0 38.0 38.0 37.0 38.0 90-94 36.84675 38.0 37.8 38.0 34.8 38.0 95-99 37.3011 38.0 38.0 38.0 37.0 38.0 100-104 37.2511 38.0 38.0 38.0 36.6 38.0 105-109 37.16975 38.0 38.0 38.0 36.2 38.0 110-114 37.143600000000006 38.0 38.0 38.0 36.0 38.0 115-119 36.9775 38.0 38.0 38.0 35.6 38.0 120-124 36.7307 38.0 38.0 38.0 34.8 38.0 125-129 36.77155 38.0 38.0 38.0 35.0 38.0 130-134 36.671949999999995 38.0 38.0 38.0 34.8 38.0 135-139 36.560199999999995 38.0 38.0 38.0 34.4 38.0 140-144 36.33195 38.0 38.0 38.0 34.0 38.0 145-149 36.012550000000005 38.0 38.0 38.0 32.8 38.0 150-151 32.280875 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 4.0 24 2.0 25 4.0 26 6.0 27 14.0 28 7.0 29 17.0 30 20.0 31 28.0 32 49.0 33 58.0 34 108.0 35 195.0 36 617.0 37 2864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43161634103019 11.113930474498858 6.876427302715046 42.5780258817559 2 22.475 13.225000000000001 34.625 29.675 3 20.724999999999998 17.65 24.95 36.675000000000004 4 26.6 25.6 20.674999999999997 27.125 5 25.624999999999996 28.9 24.05 21.425 6 22.255563890972745 33.05826456614154 23.305826456614152 21.380345086271568 7 15.299999999999999 24.275 40.0 20.424999999999997 8 19.325 24.349999999999998 30.049999999999997 26.275 9 18.975 21.625 34.975 24.425 10-14 21.925 26.735 26.805 24.535 15-19 22.035 25.835 27.045 25.085 20-24 21.945 26.38 26.240000000000002 25.435000000000002 25-29 22.415 25.91 26.634999999999998 25.040000000000003 30-34 22.491124556227813 26.071303565178262 26.30131506575329 25.136256812840642 35-39 22.297229722972297 25.777577757775777 26.712671267126716 25.212521252125214 40-44 22.285 26.305 26.235000000000003 25.174999999999997 45-49 21.959999999999997 25.979999999999997 26.779999999999998 25.28 50-54 22.900000000000002 25.955000000000002 26.369999999999997 24.775 55-59 23.16 25.85 25.869999999999997 25.119999999999997 60-64 22.57 26.355 26.235000000000003 24.84 65-69 22.456122806140307 25.93629681484074 26.48632431621581 25.121256062803138 70-74 22.466123306165308 26.266313315665784 26.156307815390768 25.11125556277814 75-79 22.625 25.264999999999997 26.584999999999997 25.525 80-84 22.541127056352817 25.416270813540677 26.426321316065803 25.616280814040703 85-89 21.959999999999997 25.97 26.16 25.91 90-94 22.085 26.35 26.055 25.509999999999998 95-99 22.902290229022903 25.742574257425744 25.982598259825984 25.372537253725376 100-104 23.005 25.490000000000002 26.314999999999998 25.19 105-109 23.121156057802892 25.956297814890743 25.501275063753187 25.42127106355318 110-114 22.71113555677784 26.201310065503275 26.23131156557828 24.856242812140607 115-119 22.636131806590328 25.5962798139907 26.07630381519076 25.691284564228212 120-124 23.169999999999998 26.14 25.840000000000003 24.85 125-129 22.692269226922694 25.687568756875688 26.547654765476548 25.072507250725074 130-134 23.23 25.36 26.06 25.35 135-139 23.05 25.465 25.974999999999998 25.509999999999998 140-144 22.78 25.564999999999998 26.47 25.185000000000002 145-149 23.025000000000002 25.94 25.755 25.28 150-151 22.9625 25.112499999999997 25.85 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.5 28 4.0 29 7.5 30 8.0 31 12.0 32 17.0 33 20.0 34 28.5 35 41.5 36 56.5 37 76.0 38 95.0 39 120.5 40 147.0 41 156.5 42 182.5 43 219.0 44 222.5 45 226.0 46 235.0 47 220.0 48 197.5 49 178.0 50 158.5 51 145.0 52 139.5 53 124.0 54 98.0 55 77.5 56 79.0 57 79.0 58 72.5 59 67.5 60 62.0 61 54.5 62 43.5 63 39.0 64 52.5 65 53.5 66 33.0 67 24.5 68 24.5 69 24.5 70 17.5 71 13.0 72 12.5 73 9.0 74 6.0 75 4.5 76 2.0 77 1.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGGA 10 0.006830828 145.0 2 >>END_MODULE SRR6958192 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958192_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81725 33.0 33.0 34.0 32.0 34.0 2 33.10125 33.0 33.0 34.0 32.0 34.0 3 33.20925 34.0 33.0 34.0 33.0 34.0 4 33.25 34.0 33.0 34.0 33.0 34.0 5 31.63675 33.0 33.0 34.0 27.0 34.0 6 37.05975 38.0 38.0 38.0 36.0 38.0 7 37.29525 38.0 38.0 38.0 37.0 38.0 8 37.48475 38.0 38.0 38.0 38.0 38.0 9 37.465 38.0 38.0 38.0 38.0 38.0 10-14 37.4457 38.0 38.0 38.0 38.0 38.0 15-19 37.45575 38.0 38.0 38.0 38.0 38.0 20-24 37.5041 38.0 38.0 38.0 38.0 38.0 25-29 37.449149999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.452999999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.34835 38.0 38.0 38.0 37.8 38.0 40-44 37.16315 38.0 38.0 38.0 37.0 38.0 45-49 37.15765 38.0 38.0 38.0 36.8 38.0 50-54 37.341899999999995 38.0 38.0 38.0 37.6 38.0 55-59 37.41485 38.0 38.0 38.0 38.0 38.0 60-64 37.34010000000001 38.0 38.0 38.0 37.8 38.0 65-69 37.346500000000006 38.0 38.0 38.0 37.6 38.0 70-74 37.27705 38.0 38.0 38.0 37.6 38.0 75-79 37.2571 38.0 38.0 38.0 37.0 38.0 80-84 37.2596 38.0 38.0 38.0 37.0 38.0 85-89 37.17125 38.0 38.0 38.0 37.0 38.0 90-94 37.0649 38.0 38.0 38.0 36.2 38.0 95-99 36.854099999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.94075 38.0 38.0 38.0 35.8 38.0 105-109 36.92295 38.0 38.0 38.0 35.6 38.0 110-114 36.8568 38.0 38.0 38.0 35.0 38.0 115-119 36.643899999999995 38.0 38.0 38.0 35.0 38.0 120-124 35.815599999999996 38.0 37.0 38.0 31.0 38.0 125-129 36.348 38.0 38.0 38.0 34.0 38.0 130-134 36.331700000000005 38.0 38.0 38.0 33.8 38.0 135-139 36.11435 38.0 38.0 38.0 33.2 38.0 140-144 35.8712 38.0 38.0 38.0 32.6 38.0 145-149 35.47485 38.0 37.2 38.0 31.2 38.0 150-151 29.202375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 3.0 20 2.0 21 1.0 22 3.0 23 5.0 24 3.0 25 10.0 26 8.0 27 10.0 28 18.0 29 14.0 30 27.0 31 35.0 32 48.0 33 84.0 34 95.0 35 183.0 36 432.0 37 2999.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 18.3 11.95 31.624999999999996 2 30.125 24.2 28.975 16.7 3 21.591193395046286 25.99449587190393 28.32124093069802 24.093069802351764 4 25.2 31.574999999999996 21.25 21.975 5 26.450000000000003 34.325 19.900000000000002 19.325 6 22.725 35.125 22.475 19.675 7 23.400000000000002 19.275000000000002 35.25 22.075 8 23.25 24.025 25.900000000000002 26.825 9 23.025000000000002 22.400000000000002 29.299999999999997 25.275 10-14 25.745 26.25 24.01 23.995 15-19 24.875 26.305 24.725 24.095 20-24 25.629999999999995 26.150000000000002 24.67 23.549999999999997 25-29 25.071253562678137 25.706285314265713 24.831241562078105 24.39121956097805 30-34 25.805 25.96 25.115 23.119999999999997 35-39 25.41 25.615 25.324999999999996 23.65 40-44 25.46 25.759999999999998 25.295 23.485 45-49 25.245 25.945 24.975 23.835 50-54 25.045 26.340000000000003 25.275 23.34 55-59 25.34 25.66 25.669999999999998 23.330000000000002 60-64 25.195 25.979999999999997 25.525 23.3 65-69 25.405 26.229999999999997 24.925 23.44 70-74 25.865 25.895000000000003 25.34 22.900000000000002 75-79 25.230000000000004 25.419999999999998 25.474999999999998 23.875 80-84 25.166258312915645 25.731286564328215 26.08630431521576 23.016150807540377 85-89 25.115 26.38 24.975 23.53 90-94 25.095 26.21 25.669999999999998 23.025000000000002 95-99 25.195 26.125 25.759999999999998 22.919999999999998 100-104 25.290000000000003 26.045 25.985000000000003 22.68 105-109 25.635 26.369999999999997 25.275 22.720000000000002 110-114 25.44 26.384999999999998 25.055 23.119999999999997 115-119 25.56 26.455000000000002 25.080000000000002 22.905 120-124 25.735000000000003 26.045 25.35 22.869999999999997 125-129 25.665 26.545 25.035 22.755 130-134 26.415 26.645000000000003 24.645 22.295 135-139 25.71 25.924999999999997 25.895000000000003 22.470000000000002 140-144 26.045 26.36 25.15 22.445 145-149 26.436321816090803 26.681334066703332 25.06625331266563 21.816090804540227 150-151 26.087500000000002 27.025 25.0375 21.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 2.5 23 2.5 24 0.5 25 2.0 26 3.0 27 3.0 28 4.0 29 5.0 30 10.0 31 17.5 32 24.0 33 25.0 34 26.5 35 35.5 36 49.5 37 63.0 38 85.5 39 117.5 40 136.5 41 156.0 42 179.5 43 192.5 44 191.0 45 197.5 46 201.0 47 181.5 48 181.5 49 183.5 50 173.5 51 147.5 52 113.5 53 95.5 54 94.0 55 95.5 56 96.0 57 94.0 58 81.0 59 79.5 60 76.5 61 71.5 62 63.0 63 61.0 64 61.5 65 50.5 66 47.0 67 51.0 68 38.0 69 26.0 70 28.0 71 22.0 72 14.5 73 13.0 74 12.0 75 5.5 76 2.0 77 1.0 78 0.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.6303580433686334 1.25 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.9250000000000003 0.0 0.0 0.0 0.0 138-139 4.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052522 spots for SRR6958192.sra Written 1052522 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra Read 1052520 spots for SRR6958192.sra Written 1052520 spots for SRR6958192.sra SRR ids: ['SRR6958192.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2e6zzzpk SRR6958192.sra spots: 21050402 blocks: [[1, 1052520], [1052521, 2105040], [2105041, 3157560], [3157561, 4210080], [4210081, 5262600], [5262601, 6315120], [6315121, 7367640], [7367641, 8420160], [8420161, 9472680], [9472681, 10525200], [10525201, 11577720], [11577721, 12630240], [12630241, 13682760], [13682761, 14735280], [14735281, 15787800], [15787801, 16840320], [16840321, 17892840], [17892841, 18945360], [18945361, 19997880], [19997881, 21050402]] SRR6958192 file size 7111590 SRR6958192 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958192 SRR6958192_1.fastq SRR6958192_2.fastq Input file: SRR6958192_1.fastq Paired file: SRR6958192_2.fastq trimmed: SRR6958192-trimmed-pair1.fastq, SRR6958192-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:42:24 2024 >> started Fri Dec 6 15:42:45 2024 >> done (21.915s) 21050402 read pairs processed; of these: 10363 ( 0.05%) short read pairs filtered out after trimming by size control 9162 ( 0.04%) empty read pairs filtered out after trimming by size control 21030877 (99.91%) read pairs available; of these: 6732880 (32.01%) trimmed read pairs available after processing 14297997 (67.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 7 0.00% 21 6 0.00% 22 7 0.00% 23 12 0.00% 24 12 0.00% 25 9 0.00% 26 14 0.00% 27 11 0.00% 28 14 0.00% 29 17 0.00% 30 15 0.00% 31 8 0.00% 32 7 0.00% 33 16 0.00% 34 16 0.00% 35 13 0.00% 36 11 0.00% 37 18 0.00% 38 15 0.00% 39 13 0.00% 40 16 0.00% 41 21 0.00% 42 23 0.00% 43 18 0.00% 44 20 0.00% 45 13 0.00% 46 27 0.00% 47 31 0.00% 48 36 0.00% 49 37 0.00% 50 50 0.00% 51 45 0.00% 52 56 0.00% 53 48 0.00% 54 64 0.00% 55 76 0.00% 56 81 0.00% 57 91 0.00% 58 89 0.00% 59 105 0.00% 60 123 0.00% 61 152 0.00% 62 167 0.00% 63 128 0.00% 64 194 0.00% 65 210 0.00% 66 212 0.00% 67 278 0.00% 68 259 0.00% 69 329 0.00% 70 378 0.00% 71 440 0.00% 72 500 0.00% 73 566 0.00% 74 657 0.00% 75 746 0.00% 76 746 0.00% 77 910 0.00% 78 957 0.00% 79 1097 0.01% 80 1220 0.01% 81 1430 0.01% 82 1578 0.01% 83 1819 0.01% 84 2454 0.01% 85 2992 0.01% 86 3202 0.02% 87 3332 0.02% 88 3870 0.02% 89 3876 0.02% 90 4229 0.02% 91 4572 0.02% 92 4998 0.02% 93 5399 0.03% 94 5815 0.03% 95 6346 0.03% 96 6717 0.03% 97 7269 0.03% 98 7601 0.04% 99 8271 0.04% 100 9029 0.04% 101 9444 0.04% 102 10221 0.05% 103 10923 0.05% 104 11886 0.06% 105 12375 0.06% 106 13187 0.06% 107 13976 0.07% 108 14596 0.07% 109 15398 0.07% 110 16382 0.08% 111 17311 0.08% 112 18132 0.09% 113 19314 0.09% 114 20347 0.10% 115 21564 0.10% 116 22774 0.11% 117 23184 0.11% 118 24244 0.12% 119 24666 0.12% 120 25881 0.12% 121 26833 0.13% 122 28276 0.13% 123 29542 0.14% 124 31174 0.15% 125 32255 0.15% 126 33837 0.16% 127 35144 0.17% 128 36028 0.17% 129 36739 0.17% 130 38816 0.18% 131 40458 0.19% 132 41577 0.20% 133 44136 0.21% 134 46332 0.22% 135 48415 0.23% 136 50496 0.24% 137 52756 0.25% 138 54911 0.26% 139 58260 0.28% 140 61328 0.29% 141 65828 0.31% 142 71795 0.34% 143 78238 0.37% 144 88765 0.42% 145 102986 0.49% 146 125727 0.60% 147 164277 0.78% 148 246378 1.17% 149 495365 2.36% 150 4014136 19.09% 151 14297997 67.99% 21030877 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=36.54 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.1 sequence=ATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=18 prefix-density=0.48 prefix-fanout=2.8 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=63.76 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=12.8 sequence=GCCGCCGCCGCC SRR6958192 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:43:35 Started mapping on | Dec 06 15:43:35 Finished on | Dec 06 15:45:06 Mapping speed, Million of reads per hour | 831.99 Number of input reads | 21030877 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20600219 Uniquely mapped reads % | 97.95% Average mapped length | 297.50 Number of splices: Total | 23248008 Number of splices: Annotated (sjdb) | 21831263 Number of splices: GT/AG | 22940641 Number of splices: GC/AG | 276848 Number of splices: AT/AC | 10438 Number of splices: Non-canonical | 20081 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159738 % of reads mapped to multiple loci | 0.76% Number of reads mapped to too many loci | 16747 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278976 278976 278976 N_multimapping 159738 159738 159738 N_noFeature 949838 20028080 1127881 N_ambiguous 479339 2845 85983 UnstrandedReadsAssigned:19171042 PositiveStrandReadsAssigned:569294 NegativeStrandReadsAssigned:19386355 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958192 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958192-trimmed-pair1.fastq SRR6958192-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,030,877 reads, 19,426,953 reads pseudoaligned [quant] estimated average fragment length: 275.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR6958192.ke.tsv 35125 SRR6958192.se.tsv 88098 total ==> SRR6958192.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.036 0 0 PNS24247 1044 769.275 95.3893 9.87318 PNS24249 1928 1653.27 55.3475 2.66558 PNS24246 1044 769.275 95.3893 9.87318 PNS24248 1044 769.275 95.3893 9.87318 PNS24244 1471 1196.27 54.4845 3.62644 PNS24243 293 85.1259 0 0 KQK14069 1603 1328.27 5467.05 327.721 KQK14071 474 221.109 100.307 36.1213 ==> SRR6958192.se.tsv <== BRADI_1g14170v3 6296 BRADI_1g53295v3 517 BRADI_1g59795v3 712 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 279 BRADI_1g74790v3 136 BRADI_1g09890v3 1 BRADI_1g77505v3 333 BRADI_1g48960v3 0 SRR6958192 completed mapping pipeline successfully