Starting /dee2/code/volunteer_pipeline.sh SRR6958194 current disk space = 1550401708032 free memory = 1603430308 SRR6958194 SRAfilesize 7199c6d5b3bc624214084864bb9c84fa SRR6958194.sra SRR6958194.sra file validated SRR6958194 is paired end SRR6958194 is conventional basespace SRR6958194 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958194_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.4525 32.0 18.0 33.0 18.0 33.0 2 28.02625 29.0 25.0 33.0 18.0 33.0 3 30.78 31.0 29.0 33.0 27.0 33.0 4 30.49725 31.0 29.0 33.0 27.0 33.0 5 31.91525 33.0 31.0 33.0 29.0 33.0 6 34.48075 36.0 34.0 38.0 28.0 38.0 7 36.4205 38.0 37.0 38.0 34.0 38.0 8 37.34275 38.0 38.0 38.0 36.0 38.0 9 37.44 38.0 38.0 38.0 37.0 38.0 10-14 37.47965000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.424850000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.505849999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.551550000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.4942 38.0 38.0 38.0 37.6 38.0 35-39 37.22685 38.0 38.0 38.0 36.4 38.0 40-44 37.4988 38.0 38.0 38.0 37.8 38.0 45-49 37.3888 38.0 38.0 38.0 37.2 38.0 50-54 37.324 38.0 38.0 38.0 37.0 38.0 55-59 37.0161 38.0 38.0 38.0 35.6 38.0 60-64 37.331849999999996 38.0 38.0 38.0 37.0 38.0 65-69 36.941050000000004 38.0 37.8 38.0 35.2 38.0 70-74 37.0413 38.0 38.0 38.0 35.8 38.0 75-79 36.714800000000004 38.0 37.8 38.0 34.2 38.0 80-84 37.0899 38.0 38.0 38.0 36.0 38.0 85-89 37.0576 38.0 38.0 38.0 36.0 38.0 90-94 36.974000000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.8326 38.0 38.0 38.0 35.0 38.0 100-104 36.686099999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.49805 38.0 38.0 38.0 34.2 38.0 110-114 36.414500000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.23795 38.0 37.4 38.0 33.6 38.0 120-124 35.942449999999994 38.0 37.0 38.0 32.6 38.0 125-129 35.9366 38.0 36.8 38.0 32.6 38.0 130-134 35.69985 38.0 36.6 38.0 31.8 38.0 135-139 34.27305 38.0 34.0 38.0 24.4 38.0 140-144 30.710050000000003 34.4 25.0 38.0 19.2 38.0 145-149 33.65265 38.0 33.0 38.0 23.2 38.0 150-151 29.030625 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 2.0 21 4.0 22 1.0 23 7.0 24 5.0 25 14.0 26 9.0 27 17.0 28 24.0 29 34.0 30 33.0 31 52.0 32 85.0 33 99.0 34 202.0 35 380.0 36 1155.0 37 1868.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.79310344827586 9.893899204244033 7.427055702917771 28.885941644562337 2 27.025 11.475 33.800000000000004 27.700000000000003 3 20.575 19.650000000000002 28.075 31.7 4 25.424999999999997 25.0 25.35 24.224999999999998 5 25.650000000000002 30.375000000000004 24.224999999999998 19.75 6 21.125 34.449999999999996 23.35 21.075 7 15.55 24.55 42.125 17.775 8 19.575 23.275000000000002 30.85 26.3 9 18.55 21.95 35.5 24.0 10-14 22.675 28.025 26.479999999999997 22.82 15-19 21.755 26.075 27.505000000000003 24.665 20-24 22.07 27.26 26.915 23.755000000000003 25-29 22.195 26.685 27.11 24.01 30-34 22.45 26.775 26.615 24.16 35-39 22.16 26.545 27.339999999999996 23.955000000000002 40-44 22.78 26.815 26.490000000000002 23.915 45-49 21.785 26.484999999999996 27.485 24.245 50-54 22.68 26.505000000000003 26.83 23.985 55-59 21.945 26.875 26.795 24.385 60-64 22.41 26.240000000000002 27.01 24.34 65-69 21.17 27.05 27.08 24.7 70-74 21.93 26.63 26.935 24.505 75-79 21.73 26.900000000000002 26.325 25.045 80-84 22.0 26.555 26.93 24.515 85-89 22.384999999999998 26.674999999999997 26.795 24.145 90-94 22.16 26.87 26.424999999999997 24.545 95-99 22.1 26.21 26.71 24.98 100-104 22.39 27.125 26.085 24.4 105-109 22.57 26.51 26.745 24.175 110-114 22.475 26.810000000000002 26.71 24.005000000000003 115-119 22.658398759813974 27.084062609391406 25.863879581937287 24.393659048857327 120-124 22.62 26.56 26.235000000000003 24.585 125-129 22.444488897779554 26.810362072414485 26.04020804160832 24.70494098819764 130-134 21.959999999999997 26.900000000000002 25.915 25.224999999999998 135-139 21.52 27.765 25.385 25.330000000000002 140-144 21.57 27.58 25.474999999999998 25.374999999999996 145-149 21.975 27.605 25.205 25.215 150-151 21.05 27.8125 25.25 25.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 1.5 26 2.5 27 3.5 28 5.5 29 7.0 30 11.0 31 15.5 32 19.0 33 23.0 34 29.5 35 49.0 36 73.5 37 90.5 38 103.0 39 124.0 40 157.5 41 188.0 42 209.5 43 218.0 44 234.0 45 241.5 46 242.5 47 234.0 48 211.5 49 187.5 50 169.0 51 160.5 52 138.5 53 124.5 54 100.5 55 72.5 56 67.0 57 62.5 58 51.0 59 46.0 60 42.0 61 35.5 62 41.0 63 37.0 64 28.0 65 28.5 66 23.0 67 21.0 68 19.0 69 11.0 70 9.0 71 8.0 72 5.5 73 5.0 74 3.5 75 1.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0125 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.0875 0.0 0.025 0.0 0.0 80-81 0.1 0.0 0.025 0.0 0.0 82-83 0.1125 0.0 0.025 0.0 0.0 84-85 0.15 0.0 0.025 0.0 0.0 86-87 0.1875 0.0 0.025 0.0 0.0 88-89 0.275 0.0 0.025 0.0 0.0 90-91 0.3375 0.0 0.025 0.0 0.0 92-93 0.4125 0.0 0.025 0.0 0.0 94-95 0.4375 0.0 0.025 0.0 0.0 96-97 0.5125 0.0 0.025 0.0 0.0 98-99 0.6875 0.0 0.025 0.0 0.0 100-101 0.8500000000000001 0.0 0.025 0.0 0.0 102-103 1.0875 0.0 0.025 0.0 0.0 104-105 1.2875 0.0 0.025 0.0 0.0 106-107 1.625 0.0 0.025 0.0 0.0 108-109 1.8625 0.0 0.025 0.0 0.0 110-111 2.175 0.0 0.025 0.0 0.0 112-113 2.575 0.0 0.025 0.0 0.0 114-115 3.025 0.0 0.025 0.0 0.0 116-117 3.7625 0.0 0.025 0.0 0.0 118-119 4.2125 0.0 0.025 0.0 0.0 120-121 4.5625 0.0 0.025 0.0 0.0 122-123 5.025 0.0 0.025 0.0 0.0 124-125 5.487500000000001 0.0 0.025 0.0 0.0 126-127 6.1875 0.0 0.025 0.0 0.0 128-129 6.725 0.0 0.025 0.0 0.0 130-131 7.05 0.0 0.025 0.0 0.0 132-133 7.324999999999999 0.0 0.025 0.0 0.0 134-135 7.725 0.0 0.025 0.0 0.0 136-137 8.2875 0.0 0.025 0.0 0.0 138-139 8.95 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCAG 10 0.0068378756 144.95 6 >>END_MODULE SRR6958194 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958194_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13275 33.0 33.0 34.0 33.0 34.0 2 33.25025 34.0 33.0 34.0 33.0 34.0 3 33.283 34.0 33.0 34.0 33.0 34.0 4 33.2375 34.0 33.0 34.0 33.0 34.0 5 33.28175 34.0 33.0 34.0 33.0 34.0 6 37.474 38.0 38.0 38.0 38.0 38.0 7 37.55425 38.0 38.0 38.0 38.0 38.0 8 37.51325 38.0 38.0 38.0 38.0 38.0 9 37.514 38.0 38.0 38.0 38.0 38.0 10-14 37.417249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.166399999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.42535 38.0 38.0 38.0 38.0 38.0 25-29 37.511050000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.504650000000005 38.0 38.0 38.0 38.0 38.0 35-39 36.7291 38.0 37.6 38.0 34.4 38.0 40-44 37.415549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.332800000000006 38.0 38.0 38.0 37.8 38.0 50-54 37.35359999999999 38.0 38.0 38.0 37.8 38.0 55-59 37.33435 38.0 38.0 38.0 37.6 38.0 60-64 37.26865 38.0 38.0 38.0 37.0 38.0 65-69 37.2319 38.0 38.0 38.0 37.0 38.0 70-74 37.15705 38.0 38.0 38.0 37.0 38.0 75-79 37.1767 38.0 38.0 38.0 37.0 38.0 80-84 36.04305 38.0 36.0 38.0 32.4 38.0 85-89 36.526500000000006 38.0 37.4 38.0 33.8 38.0 90-94 35.48805 38.0 36.0 38.0 29.8 38.0 95-99 34.472899999999996 37.8 33.6 38.0 26.2 38.0 100-104 34.71575 37.8 34.0 38.0 27.8 38.0 105-109 36.47975 38.0 37.8 38.0 34.2 38.0 110-114 36.51435 38.0 38.0 38.0 33.8 38.0 115-119 36.37675 38.0 38.0 38.0 33.0 38.0 120-124 36.1334 38.0 38.0 38.0 33.0 38.0 125-129 35.53045 38.0 36.8 38.0 30.8 38.0 130-134 35.60795 38.0 37.6 38.0 31.2 38.0 135-139 35.040949999999995 38.0 36.0 38.0 28.8 38.0 140-144 31.997500000000002 36.6 30.0 38.0 19.0 38.0 145-149 29.3113 35.2 26.4 38.0 5.6 38.0 150-151 21.669874999999998 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 3.0 19 3.0 20 0.0 21 5.0 22 11.0 23 8.0 24 7.0 25 13.0 26 4.0 27 18.0 28 19.0 29 46.0 30 49.0 31 67.0 32 81.0 33 114.0 34 216.0 35 412.0 36 1186.0 37 1717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 20.825 9.25 23.95 2 30.55 23.95 27.875 17.625 3 21.9 26.400000000000002 30.175 21.525 4 26.0 33.125 20.9 19.975 5 26.6 36.3 19.125 17.974999999999998 6 21.975 37.9 21.15 18.975 7 22.05 20.424999999999997 36.6 20.925 8 22.85 24.175 26.25 26.724999999999998 9 24.125 23.200000000000003 28.549999999999997 24.125 10-14 25.474999999999998 27.54 24.52 22.465 15-19 24.7 27.22 25.91 22.17 20-24 24.68 27.284999999999997 25.61 22.425 25-29 24.8 26.46 26.009999999999998 22.73 30-34 25.324999999999996 25.990000000000002 26.43 22.255 35-39 24.41 26.945000000000004 25.979999999999997 22.665 40-44 24.82 26.33 25.885 22.965 45-49 24.995 26.745 26.229999999999997 22.03 50-54 24.688641024358525 26.564297504126444 26.30420647226529 22.442854999249736 55-59 24.65123256162808 26.901345067253363 26.126306315315766 22.32111605580279 60-64 25.052515754726418 27.053115934780436 25.797739321796538 22.096628988696608 65-69 24.64369655448317 26.403960594089114 26.448967345101764 22.50337550632595 70-74 24.692346173086545 26.163081540770385 26.373186593296648 22.771385692846422 75-79 24.333516730855802 26.679337768218875 26.804381533536738 22.182763967388585 80-84 24.605993896032423 27.427828088257368 25.571621554010104 22.394556461700105 85-89 25.105063037822696 26.660996597958775 26.43085851510907 21.803081849109464 90-94 24.51990398079616 26.660332066413282 26.350270054010807 22.469493898779756 95-99 24.709999999999997 26.75 25.94 22.6 100-104 24.98624931246562 26.776338816940846 26.18630931546577 22.051102555127756 105-109 24.8536987945781 27.25453908868104 25.834041914670138 22.057720202070723 110-114 25.395 27.189999999999998 25.665 21.75 115-119 25.475095019003803 27.225445089017803 25.190038007601522 22.109421884376875 120-124 25.192519251925194 27.32773277327733 25.717571757175715 21.76217621762176 125-129 25.673851077661645 27.329099364904735 25.278791818772817 21.7182577386608 130-134 26.33 26.83 25.765 21.075 135-139 25.692707812343702 27.203160948284484 26.09782934880464 21.00630189056717 140-144 25.742574257425744 27.607760776077605 25.62756275627563 21.02210221022102 145-149 25.73757375737574 27.502750275027505 25.782578257825783 20.977097709770977 150-151 25.85646411602901 27.181795448862218 26.25656414103526 20.705176294073517 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 2.5 27 4.5 28 5.0 29 9.0 30 14.0 31 17.5 32 21.0 33 24.0 34 28.5 35 42.5 36 61.5 37 71.5 38 89.0 39 127.0 40 156.0 41 190.0 42 217.5 43 214.0 44 220.0 45 228.0 46 223.0 47 209.0 48 202.0 49 189.5 50 165.5 51 154.5 52 138.0 53 114.5 54 101.0 55 89.5 56 78.5 57 77.5 58 67.5 59 57.0 60 53.0 61 45.5 62 42.0 63 40.0 64 34.5 65 28.5 66 28.5 67 27.5 68 20.5 69 19.5 70 16.0 71 9.0 72 6.5 73 6.0 74 7.5 75 4.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.034999999999999996 55-59 0.005 60-64 0.03 65-69 0.015 70-74 0.05 75-79 0.034999999999999996 80-84 0.065 85-89 0.06 90-94 0.02 95-99 0.0 100-104 0.005 105-109 0.034999999999999996 110-114 0.0 115-119 0.02 120-124 0.01 125-129 0.015 130-134 0.0 135-139 0.03 140-144 0.01 145-149 0.01 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.4125 0.0 0.0 0.0 0.0 126-127 6.1375 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.15 0.0 0.0 0.0 0.0 132-133 7.4875 0.0 0.0 0.0 0.0 134-135 7.925 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 9.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908020 spots for SRR6958194.sra Written 908020 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra Read 908016 spots for SRR6958194.sra Written 908016 spots for SRR6958194.sra SRR ids: ['SRR6958194.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_61sti9ey SRR6958194.sra spots: 18160324 blocks: [[1, 908016], [908017, 1816032], [1816033, 2724048], [2724049, 3632064], [3632065, 4540080], [4540081, 5448096], [5448097, 6356112], [6356113, 7264128], [7264129, 8172144], [8172145, 9080160], [9080161, 9988176], [9988177, 10896192], [10896193, 11804208], [11804209, 12712224], [12712225, 13620240], [13620241, 14528256], [14528257, 15436272], [15436273, 16344288], [16344289, 17252304], [17252305, 18160324]] SRR6958194 file size 6132237 SRR6958194 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958194 SRR6958194_1.fastq SRR6958194_2.fastq Input file: SRR6958194_1.fastq Paired file: SRR6958194_2.fastq trimmed: SRR6958194-trimmed-pair1.fastq, SRR6958194-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:43:47 2024 >> started Fri Dec 6 15:44:09 2024 >> done (21.359s) 18160324 read pairs processed; of these: 11419 ( 0.06%) short read pairs filtered out after trimming by size control 13737 ( 0.08%) empty read pairs filtered out after trimming by size control 18135168 (99.86%) read pairs available; of these: 7774910 (42.87%) trimmed read pairs available after processing 10360258 (57.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 16 0.00% 21 9 0.00% 22 8 0.00% 23 11 0.00% 24 12 0.00% 25 11 0.00% 26 14 0.00% 27 17 0.00% 28 19 0.00% 29 17 0.00% 30 6 0.00% 31 22 0.00% 32 12 0.00% 33 25 0.00% 34 11 0.00% 35 19 0.00% 36 21 0.00% 37 22 0.00% 38 25 0.00% 39 36 0.00% 40 44 0.00% 41 36 0.00% 42 42 0.00% 43 39 0.00% 44 35 0.00% 45 35 0.00% 46 56 0.00% 47 62 0.00% 48 68 0.00% 49 90 0.00% 50 96 0.00% 51 106 0.00% 52 134 0.00% 53 151 0.00% 54 127 0.00% 55 149 0.00% 56 171 0.00% 57 194 0.00% 58 224 0.00% 59 234 0.00% 60 316 0.00% 61 332 0.00% 62 382 0.00% 63 410 0.00% 64 496 0.00% 65 477 0.00% 66 552 0.00% 67 696 0.00% 68 740 0.00% 69 783 0.00% 70 960 0.01% 71 1159 0.01% 72 1348 0.01% 73 1488 0.01% 74 1579 0.01% 75 1668 0.01% 76 2054 0.01% 77 2256 0.01% 78 2340 0.01% 79 2855 0.02% 80 3139 0.02% 81 3517 0.02% 82 3981 0.02% 83 4626 0.03% 84 5539 0.03% 85 6072 0.03% 86 6679 0.04% 87 7018 0.04% 88 7688 0.04% 89 8510 0.05% 90 9136 0.05% 91 9795 0.05% 92 11086 0.06% 93 11923 0.07% 94 13024 0.07% 95 13774 0.08% 96 14748 0.08% 97 15539 0.09% 98 16532 0.09% 99 18561 0.10% 100 21364 0.12% 101 24066 0.13% 102 20645 0.11% 103 22089 0.12% 104 23607 0.13% 105 24553 0.14% 106 25903 0.14% 107 26558 0.15% 108 27758 0.15% 109 28409 0.16% 110 29905 0.16% 111 31663 0.17% 112 33470 0.18% 113 34633 0.19% 114 36676 0.20% 115 38406 0.21% 116 39290 0.22% 117 39749 0.22% 118 41382 0.23% 119 42446 0.23% 120 43289 0.24% 121 44740 0.25% 122 47506 0.26% 123 49470 0.27% 124 51683 0.28% 125 52320 0.29% 126 53920 0.30% 127 56047 0.31% 128 56514 0.31% 129 57861 0.32% 130 59458 0.33% 131 60994 0.34% 132 63469 0.35% 133 66573 0.37% 134 68008 0.38% 135 71360 0.39% 136 74342 0.41% 137 76329 0.42% 138 79146 0.44% 139 82352 0.45% 140 86585 0.48% 141 91170 0.50% 142 97984 0.54% 143 106712 0.59% 144 119907 0.66% 145 137980 0.76% 146 164571 0.91% 147 213453 1.18% 148 310073 1.71% 149 607651 3.35% 150 3794652 20.92% 151 10360258 57.13% 18135168 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=19 prefix-density=0.42 prefix-fanout=3.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=44.94 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.8 sequence=TTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=27.00 fanout-score-rank=4 prefix-density=1.06 prefix-fanout=7.3 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTGAATCGTGAATCGTATATGTATGTTCACATGTACACTGTGTTCTTCTGTTCAGAACTTGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=59.11 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAG SRR6958194 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:44:52 Started mapping on | Dec 06 15:44:53 Finished on | Dec 06 15:46:23 Mapping speed, Million of reads per hour | 725.41 Number of input reads | 18135168 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17716139 Uniquely mapped reads % | 97.69% Average mapped length | 293.21 Number of splices: Total | 19636818 Number of splices: Annotated (sjdb) | 18523296 Number of splices: GT/AG | 19397909 Number of splices: GC/AG | 198896 Number of splices: AT/AC | 7844 Number of splices: Non-canonical | 32169 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144081 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 8097 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 282707 282707 282707 N_multimapping 144081 144081 144081 N_noFeature 820790 17262884 976650 N_ambiguous 347872 2636 51818 UnstrandedReadsAssigned:16547477 PositiveStrandReadsAssigned:450619 NegativeStrandReadsAssigned:16687671 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958194 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958194-trimmed-pair1.fastq SRR6958194-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,135,168 reads, 16,682,178 reads pseudoaligned [quant] estimated average fragment length: 234.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52973 SRR6958194.ke.tsv 35125 SRR6958194.se.tsv 88098 total ==> SRR6958194.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.454 3.66556 0.490671 PNS24247 1044 810.11 58.1834 6.75341 PNS24249 1928 1694.11 52.6675 2.92327 PNS24246 1044 810.11 58.1834 6.75341 PNS24248 1044 810.11 58.1834 6.75341 PNS24244 1471 1237.11 53.1167 4.03729 PNS24243 293 98.3069 0 0 KQK14069 1603 1369.11 274.027 18.8201 KQK14071 474 248.326 4.08771 1.54784 ==> SRR6958194.se.tsv <== BRADI_1g14170v3 363 BRADI_1g53295v3 452 BRADI_1g59795v3 210 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 611 BRADI_1g74790v3 421 BRADI_1g09890v3 0 BRADI_1g77505v3 169 BRADI_1g48960v3 0 SRR6958194 completed mapping pipeline successfully