Starting /dee2/code/volunteer_pipeline.sh SRR6958195 current disk space = 1550351220736 free memory = 1601630128 SRR6958195 SRAfilesize 7a46e14927eb3d2559032c36a9b84376 SRR6958195.sra SRR6958195.sra file validated SRR6958195 is paired end SRR6958195 is conventional basespace SRR6958195 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958195_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.97675 18.0 18.0 31.0 18.0 32.0 2 22.82825 18.0 18.0 27.0 18.0 31.0 3 27.53925 27.0 27.0 30.0 25.0 33.0 4 28.16825 29.0 27.0 31.0 15.0 33.0 5 30.02875 32.0 30.0 33.0 25.0 33.0 6 34.9515 37.0 34.0 38.0 29.0 38.0 7 36.5075 38.0 37.0 38.0 34.0 38.0 8 36.84925 38.0 37.0 38.0 34.0 38.0 9 37.02925 38.0 38.0 38.0 35.0 38.0 10-14 37.302099999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.40185 38.0 38.0 38.0 37.0 38.0 20-24 37.353449999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.5064 38.0 38.0 38.0 37.8 38.0 30-34 37.49975 38.0 38.0 38.0 37.8 38.0 35-39 37.62035 38.0 38.0 38.0 38.0 38.0 40-44 37.60575 38.0 38.0 38.0 38.0 38.0 45-49 37.5244 38.0 38.0 38.0 37.8 38.0 50-54 37.374700000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.35215 38.0 38.0 38.0 37.0 38.0 60-64 37.3696 38.0 38.0 38.0 37.0 38.0 65-69 37.258449999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.22105 38.0 38.0 38.0 36.0 38.0 75-79 37.004200000000004 38.0 38.0 38.0 35.8 38.0 80-84 35.70865 38.0 35.6 38.0 29.8 38.0 85-89 37.03585 38.0 38.0 38.0 36.0 38.0 90-94 36.97019999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.8269 38.0 38.0 38.0 35.2 38.0 100-104 36.6823 38.0 38.0 38.0 34.4 38.0 105-109 36.6856 38.0 38.0 38.0 34.2 38.0 110-114 36.59589999999999 38.0 38.0 38.0 34.4 38.0 115-119 36.306 38.0 37.6 38.0 33.6 38.0 120-124 36.1352 38.0 37.2 38.0 33.2 38.0 125-129 35.98505 38.0 36.8 38.0 32.6 38.0 130-134 35.702749999999995 38.0 36.0 38.0 32.0 38.0 135-139 35.589999999999996 38.0 36.0 38.0 31.2 38.0 140-144 35.13720000000001 38.0 35.2 38.0 30.6 38.0 145-149 34.584649999999996 38.0 35.4 38.0 28.8 38.0 150-151 30.11475 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 6.0 22 2.0 23 3.0 24 7.0 25 6.0 26 2.0 27 13.0 28 12.0 29 26.0 30 29.0 31 34.0 32 70.0 33 108.0 34 190.0 35 355.0 36 1128.0 37 2001.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.161993769470403 33.09968847352025 7.892004153686397 45.84631360332295 2 19.325 18.025 32.2 30.45 3 19.675 18.4 22.525000000000002 39.4 4 23.775 27.1 21.7 27.425 5 23.525 32.6 23.0 20.875 6 21.25 35.125 22.725 20.9 7 16.45 25.924999999999997 39.800000000000004 17.825 8 19.575 23.849999999999998 31.025000000000002 25.55 9 18.375 23.05 35.099999999999994 23.474999999999998 10-14 21.69 28.345 26.025 23.94 15-19 21.84 27.075 26.86 24.224999999999998 20-24 21.656082804140205 27.266363318165908 26.65633281664083 24.421221061053053 25-29 22.045 26.674999999999997 26.974999999999998 24.305 30-34 22.445 26.479999999999997 26.529999999999998 24.545 35-39 22.07 26.135 27.400000000000002 24.395 40-44 22.035 26.939999999999998 26.575 24.45 45-49 21.94 26.76 26.43 24.87 50-54 21.83 27.08 26.179999999999996 24.91 55-59 21.505 26.995 26.68 24.82 60-64 22.3 26.865 26.26 24.575 65-69 22.095000000000002 26.919999999999998 26.424999999999997 24.560000000000002 70-74 21.955 27.04 26.540000000000003 24.465 75-79 22.24 26.83 26.174999999999997 24.755 80-84 21.98 26.479999999999997 26.939999999999998 24.6 85-89 22.37 26.740000000000002 26.229999999999997 24.66 90-94 22.25 25.885 26.955000000000002 24.91 95-99 22.58 26.305 26.290000000000003 24.825 100-104 22.261113055652782 26.831341567078354 26.441322066103307 24.466223311165557 105-109 22.965 26.345000000000002 26.584999999999997 24.104999999999997 110-114 23.235 26.605 26.075 24.085 115-119 22.466123306165308 27.1963598179909 25.616280814040703 24.72123606180309 120-124 22.58 26.715 26.085 24.62 125-129 22.245 26.14 26.82 24.795 130-134 22.53 26.87 25.685000000000002 24.915000000000003 135-139 22.945 26.435 25.935000000000002 24.685000000000002 140-144 22.755 26.35 26.015 24.88 145-149 22.325 26.39 25.974999999999998 25.31 150-151 22.7625 26.474999999999998 26.075 24.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 3.5 28 4.0 29 9.0 30 13.0 31 14.5 32 23.0 33 30.5 34 40.0 35 49.5 36 65.5 37 84.5 38 108.0 39 121.5 40 146.5 41 196.5 42 216.5 43 218.0 44 227.5 45 227.0 46 236.0 47 237.0 48 218.5 49 203.5 50 163.5 51 132.0 52 128.0 53 118.0 54 100.0 55 90.0 56 81.5 57 61.0 58 50.5 59 55.5 60 53.0 61 46.0 62 37.5 63 30.5 64 28.0 65 30.0 66 25.0 67 16.5 68 13.5 69 10.5 70 8.0 71 5.0 72 3.0 73 3.5 74 3.5 75 3.5 76 2.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.225 0.0 0.0 0.0 0.0 94-95 1.5125000000000002 0.0 0.0 0.0 0.0 96-97 1.7999999999999998 0.0 0.0 0.0 0.0 98-99 2.0625 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.7375 0.0 0.0 0.0 0.0 104-105 3.1624999999999996 0.0 0.0 0.0 0.0 106-107 3.625 0.0 0.0 0.0 0.0 108-109 4.25 0.0 0.0 0.0 0.0 110-111 4.762499999999999 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.8125 0.0 0.0 0.0 0.0 116-117 6.5 0.0 0.0 0.0 0.0 118-119 7.0625 0.0 0.0 0.0 0.0 120-121 7.7125 0.0 0.0 0.0 0.0 122-123 8.412500000000001 0.0 0.0 0.0 0.0 124-125 8.975000000000001 0.0 0.0 0.0 0.0 126-127 9.7375 0.0 0.0 0.0 0.0 128-129 10.5125 0.0 0.0 0.0 0.0 130-131 11.274999999999999 0.0 0.0 0.0 0.0 132-133 12.2875 0.0 0.0 0.0 0.0 134-135 13.100000000000001 0.0 0.0 0.0 0.0 136-137 13.8875 0.0 0.0 0.0 0.0 138-139 14.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATACA 10 0.006836113 144.9625 6 GGAACAC 10 0.006836113 144.9625 4 >>END_MODULE SRR6958195 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958195_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16975 33.0 33.0 34.0 33.0 34.0 2 33.29725 34.0 33.0 34.0 33.0 34.0 3 33.351 34.0 33.0 34.0 33.0 34.0 4 33.29575 34.0 33.0 34.0 33.0 34.0 5 33.323 34.0 33.0 34.0 33.0 34.0 6 37.53775 38.0 38.0 38.0 38.0 38.0 7 37.557 38.0 38.0 38.0 38.0 38.0 8 37.5025 38.0 38.0 38.0 38.0 38.0 9 37.55425 38.0 38.0 38.0 38.0 38.0 10-14 37.53095 38.0 38.0 38.0 38.0 38.0 15-19 36.3509 38.0 37.0 38.0 33.2 38.0 20-24 36.18405 38.0 36.8 38.0 30.2 38.0 25-29 37.3415 38.0 38.0 38.0 37.2 38.0 30-34 37.50815 38.0 38.0 38.0 38.0 38.0 35-39 37.427949999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.481350000000006 38.0 38.0 38.0 37.8 38.0 45-49 37.427350000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.30200000000001 38.0 38.0 38.0 37.4 38.0 55-59 37.38315 38.0 38.0 38.0 37.4 38.0 60-64 37.3437 38.0 38.0 38.0 37.0 38.0 65-69 37.3227 38.0 38.0 38.0 37.0 38.0 70-74 37.2166 38.0 38.0 38.0 37.0 38.0 75-79 37.21225 38.0 38.0 38.0 37.0 38.0 80-84 37.1823 38.0 38.0 38.0 36.8 38.0 85-89 37.15599999999999 38.0 38.0 38.0 36.8 38.0 90-94 35.765299999999996 38.0 36.4 38.0 30.0 38.0 95-99 34.2259 37.6 32.8 38.0 24.2 38.0 100-104 34.38205000000001 37.8 33.0 38.0 26.2 38.0 105-109 36.5812 38.0 37.8 38.0 34.4 38.0 110-114 36.32885 38.0 37.8 38.0 32.8 38.0 115-119 35.77695 38.0 37.0 38.0 30.6 38.0 120-124 35.5559 38.0 36.6 38.0 30.2 38.0 125-129 35.60255 38.0 36.2 38.0 31.0 38.0 130-134 33.3079 37.2 29.4 38.0 24.4 38.0 135-139 34.32805 38.0 34.6 38.0 25.2 38.0 140-144 33.666999999999994 38.0 34.0 38.0 21.6 38.0 145-149 33.721199999999996 38.0 33.4 38.0 23.0 38.0 150-151 29.14025 35.0 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 2.0 14 1.0 15 1.0 16 3.0 17 0.0 18 1.0 19 3.0 20 7.0 21 7.0 22 4.0 23 4.0 24 9.0 25 8.0 26 10.0 27 17.0 28 19.0 29 31.0 30 37.0 31 40.0 32 89.0 33 116.0 34 197.0 35 371.0 36 1158.0 37 1857.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.35 19.975 12.775 32.9 2 29.65 25.15 28.125 17.075000000000003 3 21.15 27.200000000000003 28.875 22.775000000000002 4 26.525 30.7 21.675 21.099999999999998 5 25.3 33.975 21.9 18.825 6 21.575 37.4 21.85 19.175 7 22.400000000000002 20.075000000000003 36.6 20.925 8 22.8 25.074999999999996 26.400000000000002 25.724999999999998 9 22.650000000000002 23.45 29.425 24.474999999999998 10-14 25.785000000000004 27.315 24.29 22.61 15-19 24.815 26.97 25.685000000000002 22.53 20-24 25.009999999999998 26.479999999999997 25.705 22.805 25-29 25.080000000000002 26.779999999999998 25.785000000000004 22.355 30-34 24.65 27.32 25.619999999999997 22.41 35-39 24.325 26.545 26.555 22.575 40-44 24.665 26.82 26.045 22.470000000000002 45-49 24.65 26.615 26.484999999999996 22.25 50-54 24.752425727718315 26.547964389316796 26.28288486545964 22.41672501750525 55-59 25.436446400880396 26.717022660197088 25.886648992046418 21.959881946876095 60-64 24.52480992396959 26.450580232092836 26.450580232092836 22.574029611844736 65-69 24.58360426149152 26.6193167608663 26.484269494323016 22.312809483319164 70-74 25.07628432794758 25.9566805062278 26.296833575108796 22.67020159071582 75-79 24.404761904761905 26.87074829931973 26.53561424569828 22.18887555022009 80-84 24.96248124062031 26.36818409204602 26.398199099549775 22.271135567783894 85-89 24.931219048571858 26.376869591316094 26.506928117652944 22.184983242459104 90-94 24.602380714214263 26.913073922176658 26.347904371311394 22.13664099229769 95-99 24.692407722316695 27.283184955486643 26.217865359607885 21.806541962588778 100-104 25.51265379613884 26.963088926678004 25.157547264179254 22.366710013003903 105-109 24.95748724617385 26.09782934880464 25.972791837551267 22.97189156747024 110-114 25.456364091022753 26.911727931983 25.501375343835956 22.13053263315829 115-119 25.86405241834642 27.39458810583704 25.2688440954334 21.472515380383133 120-124 26.486621655413856 26.976744186046513 25.2863215803951 21.250312578144538 125-129 26.71301390417125 26.958087426227866 25.387616284885468 20.941282384715414 130-134 26.52663165791448 27.301825456364092 25.2863215803951 20.885221305326333 135-139 26.88440954334017 26.119141699594856 26.60431150902816 20.39213724803681 140-144 27.010804321728692 26.445578231292515 26.000400160064025 20.543217286914768 145-149 27.527387324295933 26.812065429443248 24.991246060727327 20.669301185533488 150-151 27.56378189094547 25.925462731365684 26.063031515757878 20.447723861930967 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 2.5 27 4.0 28 5.0 29 6.0 30 8.0 31 12.5 32 17.0 33 23.0 34 35.5 35 49.0 36 61.0 37 78.0 38 98.0 39 120.0 40 145.0 41 179.0 42 212.5 43 221.5 44 227.0 45 215.5 46 205.0 47 220.0 48 212.5 49 196.0 50 181.0 51 153.0 52 129.5 53 115.0 54 96.0 55 83.5 56 82.0 57 80.0 58 78.5 59 70.5 60 55.0 61 44.5 62 39.5 63 39.5 64 36.5 65 29.5 66 24.0 67 24.0 68 23.5 69 15.5 70 10.0 71 7.0 72 6.0 73 6.5 74 4.0 75 1.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.03 55-59 0.045 60-64 0.04 65-69 0.034999999999999996 70-74 0.045 75-79 0.04 80-84 0.05 85-89 0.045 90-94 0.03 95-99 0.03 100-104 0.03 105-109 0.03 110-114 0.025 115-119 0.034999999999999996 120-124 0.025 125-129 0.03 130-134 0.025 135-139 0.034999999999999996 140-144 0.04 145-149 0.045 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42021678850517 98.6 2 0.45374338290899924 0.8999999999999999 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025207965717166627 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9874999999999999 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.8624999999999998 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.4625000000000004 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.35 0.0 0.0 0.0 0.0 108-109 3.975 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 4.7875 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 6.05 0.0 0.0 0.0 0.0 118-119 6.5375 0.0 0.0 0.0 0.0 120-121 7.074999999999999 0.0 0.0 0.0 0.0 122-123 7.575 0.0 0.0 0.0 0.0 124-125 8.0125 0.0 0.0 0.0 0.0 126-127 8.625 0.0 0.0 0.0 0.0 128-129 9.225 0.0 0.0 0.0 0.0 130-131 9.8 0.0 0.0 0.0 0.0 132-133 10.6625 0.0 0.0 0.0 0.0 134-135 11.375 0.0 0.0 0.0 0.0 136-137 12.1125 0.0 0.0 0.0 0.0 138-139 12.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATC 10 0.006830828 145.0 145 TATTTGC 10 0.006830828 145.0 3 >>END_MODULE Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668347 spots for SRR6958195.sra Written 668347 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra Read 668333 spots for SRR6958195.sra Written 668333 spots for SRR6958195.sra SRR ids: ['SRR6958195.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_15pv1u SRR6958195.sra spots: 13366674 blocks: [[1, 668333], [668334, 1336666], [1336667, 2004999], [2005000, 2673332], [2673333, 3341665], [3341666, 4009998], [4009999, 4678331], [4678332, 5346664], [5346665, 6014997], [6014998, 6683330], [6683331, 7351663], [7351664, 8019996], [8019997, 8688329], [8688330, 9356662], [9356663, 10024995], [10024996, 10693328], [10693329, 11361661], [11361662, 12029994], [12029995, 12698327], [12698328, 13366674]] SRR6958195 file size 4507826 SRR6958195 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958195 SRR6958195_1.fastq SRR6958195_2.fastq Input file: SRR6958195_1.fastq Paired file: SRR6958195_2.fastq trimmed: SRR6958195-trimmed-pair1.fastq, SRR6958195-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:45:47 2024 >> started Fri Dec 6 15:46:02 2024 >> done (15.074s) 13366674 read pairs processed; of these: 4397 ( 0.03%) short read pairs filtered out after trimming by size control 12661 ( 0.09%) empty read pairs filtered out after trimming by size control 13349616 (99.87%) read pairs available; of these: 7977427 (59.76%) trimmed read pairs available after processing 5372189 (40.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 5 0.00% 23 8 0.00% 24 11 0.00% 25 7 0.00% 26 7 0.00% 27 2 0.00% 28 9 0.00% 29 14 0.00% 30 9 0.00% 31 10 0.00% 32 12 0.00% 33 11 0.00% 34 16 0.00% 35 20 0.00% 36 20 0.00% 37 23 0.00% 38 42 0.00% 39 24 0.00% 40 37 0.00% 41 34 0.00% 42 40 0.00% 43 49 0.00% 44 48 0.00% 45 41 0.00% 46 61 0.00% 47 63 0.00% 48 102 0.00% 49 93 0.00% 50 127 0.00% 51 126 0.00% 52 159 0.00% 53 162 0.00% 54 176 0.00% 55 193 0.00% 56 202 0.00% 57 248 0.00% 58 262 0.00% 59 305 0.00% 60 397 0.00% 61 452 0.00% 62 536 0.00% 63 559 0.00% 64 638 0.00% 65 718 0.01% 66 770 0.01% 67 899 0.01% 68 1005 0.01% 69 1172 0.01% 70 1326 0.01% 71 1534 0.01% 72 1757 0.01% 73 1978 0.01% 74 2274 0.02% 75 2494 0.02% 76 2921 0.02% 77 3143 0.02% 78 3382 0.03% 79 3945 0.03% 80 4273 0.03% 81 4731 0.04% 82 5324 0.04% 83 6087 0.05% 84 6777 0.05% 85 7494 0.06% 86 8305 0.06% 87 8959 0.07% 88 9559 0.07% 89 10325 0.08% 90 11314 0.08% 91 12421 0.09% 92 13175 0.10% 93 14486 0.11% 94 15712 0.12% 95 16687 0.12% 96 17744 0.13% 97 18990 0.14% 98 20051 0.15% 99 21333 0.16% 100 23973 0.18% 101 25152 0.19% 102 25070 0.19% 103 26124 0.20% 104 27704 0.21% 105 28813 0.22% 106 30078 0.23% 107 31173 0.23% 108 32405 0.24% 109 33528 0.25% 110 35053 0.26% 111 35995 0.27% 112 38037 0.28% 113 39033 0.29% 114 40653 0.30% 115 42371 0.32% 116 43470 0.33% 117 44636 0.33% 118 46063 0.35% 119 46918 0.35% 120 48251 0.36% 121 49052 0.37% 122 50937 0.38% 123 52509 0.39% 124 54289 0.41% 125 56013 0.42% 126 57570 0.43% 127 59405 0.44% 128 60907 0.46% 129 62664 0.47% 130 64070 0.48% 131 65396 0.49% 132 67601 0.51% 133 70883 0.53% 134 73006 0.55% 135 76129 0.57% 136 78689 0.59% 137 81867 0.61% 138 84810 0.64% 139 89397 0.67% 140 93889 0.70% 141 101653 0.76% 142 109302 0.82% 143 120926 0.91% 144 135875 1.02% 145 161008 1.21% 146 196255 1.47% 147 260759 1.95% 148 379289 2.84% 149 728605 5.46% 150 3421728 25.63% 151 5372189 40.24% 13349616 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=112.99 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.3 sequence=CGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=106.62 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGC SRR6958195 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:46:58 Started mapping on | Dec 06 15:46:58 Finished on | Dec 06 15:48:24 Mapping speed, Million of reads per hour | 558.82 Number of input reads | 13349616 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12986082 Uniquely mapped reads % | 97.28% Average mapped length | 288.67 Number of splices: Total | 14649751 Number of splices: Annotated (sjdb) | 13709314 Number of splices: GT/AG | 14444261 Number of splices: GC/AG | 169717 Number of splices: AT/AC | 5200 Number of splices: Non-canonical | 30573 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159374 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 10363 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 206781 206781 206781 N_multimapping 159374 159374 159374 N_noFeature 586554 12578120 719870 N_ambiguous 319573 1547 45349 UnstrandedReadsAssigned:12079955 PositiveStrandReadsAssigned:406415 NegativeStrandReadsAssigned:12220863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR6958195 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958195-trimmed-pair1.fastq SRR6958195-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,349,616 reads, 12,247,449 reads pseudoaligned [quant] estimated average fragment length: 211.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR6958195.ke.tsv 35125 SRR6958195.se.tsv 88098 total ==> SRR6958195.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.292 0 0 PNS24247 1044 833.947 35.4392 5.42953 PNS24249 1928 1717.95 16.3229 1.21395 PNS24246 1044 833.947 35.4392 5.42953 PNS24248 1044 833.947 35.4392 5.42953 PNS24244 1471 1260.95 43.3594 4.39342 PNS24243 293 108.013 0 0 KQK14069 1603 1392.95 3274.45 300.344 KQK14071 474 268.016 80.3745 38.3154 ==> SRR6958195.se.tsv <== BRADI_1g14170v3 4043 BRADI_1g53295v3 938 BRADI_1g59795v3 111 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 161 BRADI_1g74790v3 51 BRADI_1g09890v3 0 BRADI_1g77505v3 178 BRADI_1g48960v3 0 SRR6958195 completed mapping pipeline successfully