Starting /dee2/code/volunteer_pipeline.sh SRR6958196 current disk space = 1550372433920 free memory = 1600318376 SRR6958196 SRAfilesize 8bf9bf34312776f4031e550d1bd215b2 SRR6958196.sra SRR6958196.sra file validated SRR6958196 is paired end SRR6958196 is conventional basespace SRR6958196 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958196_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.921 33.0 32.0 34.0 28.0 34.0 2 32.299 33.0 33.0 34.0 29.0 34.0 3 32.51325 33.0 33.0 34.0 30.0 34.0 4 33.04025 34.0 33.0 34.0 32.0 34.0 5 33.10525 33.0 33.0 34.0 32.0 34.0 6 37.223 38.0 38.0 38.0 36.0 38.0 7 37.43425 38.0 38.0 38.0 37.0 38.0 8 37.52025 38.0 38.0 38.0 38.0 38.0 9 37.686 38.0 38.0 38.0 38.0 38.0 10-14 37.584050000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.54205 38.0 38.0 38.0 38.0 38.0 20-24 37.6547 38.0 38.0 38.0 38.0 38.0 25-29 37.6769 38.0 38.0 38.0 38.0 38.0 30-34 37.5984 38.0 38.0 38.0 38.0 38.0 35-39 37.5711 38.0 38.0 38.0 38.0 38.0 40-44 37.5712 38.0 38.0 38.0 38.0 38.0 45-49 37.592 38.0 38.0 38.0 38.0 38.0 50-54 37.5784 38.0 38.0 38.0 38.0 38.0 55-59 37.4804 38.0 38.0 38.0 37.6 38.0 60-64 37.2707 38.0 38.0 38.0 37.0 38.0 65-69 37.451499999999996 38.0 38.0 38.0 37.6 38.0 70-74 37.41705 38.0 38.0 38.0 37.0 38.0 75-79 37.35164999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.37760000000001 38.0 38.0 38.0 37.0 38.0 85-89 36.287699999999994 38.0 36.8 38.0 31.2 38.0 90-94 37.1606 38.0 38.0 38.0 36.2 38.0 95-99 37.2093 38.0 38.0 38.0 36.4 38.0 100-104 37.1103 38.0 38.0 38.0 36.0 38.0 105-109 36.9525 38.0 38.0 38.0 35.4 38.0 110-114 36.56155 38.0 37.8 38.0 34.0 38.0 115-119 36.8077 38.0 38.0 38.0 34.8 38.0 120-124 36.64815 38.0 38.0 38.0 34.6 38.0 125-129 36.56945 38.0 38.0 38.0 34.4 38.0 130-134 36.41835 38.0 38.0 38.0 33.8 38.0 135-139 36.25335 38.0 38.0 38.0 33.2 38.0 140-144 35.68125 38.0 37.2 38.0 30.6 38.0 145-149 33.90575 38.0 33.8 38.0 24.2 38.0 150-151 31.695875 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 3.0 23 0.0 24 6.0 25 8.0 26 16.0 27 8.0 28 11.0 29 18.0 30 20.0 31 34.0 32 57.0 33 62.0 34 110.0 35 201.0 36 567.0 37 2871.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.625821719694976 8.861425190638968 7.941099132264003 42.57165395740205 2 25.874999999999996 12.625 33.475 28.025 3 22.125 16.625 24.5 36.75 4 27.55 23.375 21.025 28.050000000000004 5 26.825 28.7 22.95 21.525 6 22.25 30.95 24.125 22.675 7 17.0 23.25 39.775 19.975 8 21.45 22.85 29.475 26.224999999999998 9 18.75 20.325 34.300000000000004 26.625 10-14 23.44 26.779999999999998 25.575 24.205 15-19 22.994999999999997 24.735 26.26 26.009999999999998 20-24 22.67 25.355 26.334999999999997 25.64 25-29 22.555 25.905 25.874999999999996 25.665 30-34 22.935 25.314999999999998 26.095000000000002 25.655 35-39 23.375 25.5 25.46 25.665 40-44 22.939999999999998 25.31 25.69 26.06 45-49 22.575 25.569999999999997 25.5 26.355 50-54 23.119999999999997 25.36 26.16 25.36 55-59 23.025000000000002 25.965 25.330000000000002 25.679999999999996 60-64 23.415 24.55 25.929999999999996 26.105 65-69 22.805 25.245 25.759999999999998 26.19 70-74 23.3 24.825 25.64 26.235000000000003 75-79 23.69 24.705 25.71 25.895000000000003 80-84 23.115 25.45 25.435000000000002 26.0 85-89 23.125 24.485 26.145000000000003 26.245 90-94 23.345 25.28 25.53 25.845000000000002 95-99 23.425 24.955 25.919999999999998 25.7 100-104 23.695 24.29 26.58 25.435000000000002 105-109 23.585 25.055 25.14 26.22 110-114 22.905 25.47 25.75 25.874999999999996 115-119 23.549999999999997 24.395 26.240000000000002 25.814999999999998 120-124 23.73 25.47 25.319999999999997 25.480000000000004 125-129 23.095 25.305 25.705 25.895000000000003 130-134 23.35 24.775 25.545 26.33 135-139 23.855 25.11 25.724999999999998 25.31 140-144 23.485 25.074999999999996 25.525 25.915 145-149 23.150000000000002 25.035 25.745 26.07 150-151 23.31288343558282 25.31613872542882 25.616627018905724 25.75435082008263 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.5 27 3.0 28 2.0 29 5.0 30 10.5 31 16.0 32 19.5 33 22.0 34 23.5 35 31.5 36 41.0 37 55.5 38 78.0 39 99.5 40 125.5 41 147.5 42 164.0 43 183.5 44 203.5 45 201.5 46 191.5 47 186.0 48 187.5 49 189.0 50 178.5 51 163.5 52 141.5 53 137.0 54 120.5 55 86.5 56 90.0 57 102.5 58 91.0 59 74.5 60 57.5 61 60.0 62 72.0 63 63.5 64 54.0 65 58.0 66 50.5 67 45.5 68 41.5 69 26.0 70 27.0 71 22.5 72 9.0 73 6.5 74 8.5 75 7.0 76 4.5 77 4.5 78 2.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 2.9124999999999996 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCAA 10 0.0068343505 144.975 8 >>END_MODULE SRR6958196 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958196_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6555 33.0 33.0 34.0 32.0 34.0 2 33.14675 34.0 33.0 34.0 32.0 34.0 3 33.18925 34.0 33.0 34.0 33.0 34.0 4 33.2505 34.0 33.0 34.0 33.0 34.0 5 32.91325 34.0 33.0 34.0 32.0 34.0 6 37.2995 38.0 38.0 38.0 37.0 38.0 7 37.42125 38.0 38.0 38.0 37.0 38.0 8 37.35425 38.0 38.0 38.0 38.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10-14 37.14515 38.0 38.0 38.0 36.8 38.0 15-19 37.3317 38.0 38.0 38.0 37.4 38.0 20-24 37.4347 38.0 38.0 38.0 38.0 38.0 25-29 37.125150000000005 38.0 38.0 38.0 36.6 38.0 30-34 37.39905 38.0 38.0 38.0 37.8 38.0 35-39 37.29145 38.0 38.0 38.0 37.4 38.0 40-44 36.98585 38.0 38.0 38.0 36.2 38.0 45-49 37.01135 38.0 38.0 38.0 36.2 38.0 50-54 36.872249999999994 38.0 38.0 38.0 35.4 38.0 55-59 37.27315 38.0 38.0 38.0 37.0 38.0 60-64 37.267250000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.431850000000004 38.0 38.0 38.0 33.4 38.0 70-74 37.06914999999999 38.0 38.0 38.0 36.2 38.0 75-79 37.15145 38.0 38.0 38.0 36.8 38.0 80-84 36.97135 38.0 38.0 38.0 36.0 38.0 85-89 36.85770000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.735350000000004 38.0 38.0 38.0 35.4 38.0 95-99 35.4133 38.0 36.4 38.0 28.0 38.0 100-104 36.669349999999994 38.0 38.0 38.0 34.6 38.0 105-109 35.93445 38.0 37.4 38.0 31.6 38.0 110-114 36.5805 38.0 38.0 38.0 34.8 38.0 115-119 36.506499999999996 38.0 38.0 38.0 34.6 38.0 120-124 35.17545 38.0 36.2 38.0 28.0 38.0 125-129 35.888 38.0 37.2 38.0 32.2 38.0 130-134 36.0592 38.0 38.0 38.0 32.8 38.0 135-139 34.557 38.0 34.4 38.0 25.6 38.0 140-144 35.156800000000004 38.0 36.0 38.0 30.0 38.0 145-149 33.927550000000004 38.0 34.6 38.0 24.0 38.0 150-151 29.610125 35.5 27.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 0.0 11 2.0 12 0.0 13 3.0 14 3.0 15 0.0 16 2.0 17 2.0 18 0.0 19 7.0 20 5.0 21 1.0 22 7.0 23 10.0 24 10.0 25 10.0 26 18.0 27 19.0 28 21.0 29 31.0 30 43.0 31 57.0 32 72.0 33 102.0 34 138.0 35 242.0 36 602.0 37 2587.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.426569927445584 18.789091818864147 11.208406304728546 34.57593194896172 2 29.4 23.65 28.449999999999996 18.5 3 22.8 25.75 27.55 23.9 4 27.3 29.975 20.3 22.425 5 26.575 32.95 19.75 20.724999999999998 6 22.15 36.425000000000004 19.575 21.85 7 21.425 20.1 34.575 23.9 8 24.349999999999998 23.525 23.599999999999998 28.525 9 24.925 22.2 27.400000000000002 25.474999999999998 10-14 25.380000000000003 26.195 23.325000000000003 25.1 15-19 25.929999999999996 25.45 23.845 24.775 20-24 25.235000000000003 25.205 25.1 24.46 25-29 26.22 25.61 24.349999999999998 23.82 30-34 25.53 25.900000000000002 24.22 24.349999999999998 35-39 25.035 25.650000000000002 24.33 24.985 40-44 26.275 25.019999999999996 24.169999999999998 24.535 45-49 25.285000000000004 25.795 24.37 24.55 50-54 25.51127556377819 25.481274063703186 24.361218060903045 24.64623231161558 55-59 25.476273813690685 25.226261313065653 24.501225061253063 24.7962398119906 60-64 25.85 25.27 24.315 24.565 65-69 25.825 25.21 24.759999999999998 24.205 70-74 25.580000000000002 25.46 24.72 24.240000000000002 75-79 25.619999999999997 25.22 24.98 24.18 80-84 25.661283064153206 25.971298564928247 24.311215560778038 24.056202810140505 85-89 26.340000000000003 25.085 24.325 24.25 90-94 25.629999999999995 25.97 24.34 24.060000000000002 95-99 25.71 26.11 24.12 24.060000000000002 100-104 26.07 25.31 24.705 23.915 105-109 25.75 26.015 24.875 23.36 110-114 26.055 26.064999999999998 24.075 23.805 115-119 26.540000000000003 25.3 24.560000000000002 23.599999999999998 120-124 26.96 25.900000000000002 23.705000000000002 23.435 125-129 26.064999999999998 25.729999999999997 24.610000000000003 23.595 130-134 26.165 25.919999999999998 24.235 23.68 135-139 26.06 26.040000000000003 24.635 23.265 140-144 26.61 25.569999999999997 24.79 23.03 145-149 26.8 26.39 24.315 22.495 150-151 26.264396594892336 24.924887330996494 25.187781672508763 23.622934401602404 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 5.0 28 6.0 29 7.0 30 7.5 31 8.0 32 12.5 33 22.5 34 29.5 35 33.5 36 45.0 37 56.5 38 72.5 39 87.5 40 107.0 41 132.5 42 157.0 43 185.5 44 187.0 45 169.5 46 170.0 47 177.5 48 172.0 49 181.0 50 178.5 51 143.0 52 130.0 53 133.0 54 120.5 55 108.5 56 97.5 57 98.5 58 95.0 59 80.0 60 81.0 61 77.0 62 68.0 63 68.5 64 66.0 65 60.5 66 60.5 67 52.5 68 47.5 69 51.5 70 44.0 71 28.0 72 18.5 73 15.0 74 12.5 75 8.5 76 4.5 77 4.0 78 5.0 79 2.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34293656810715 98.275 2 0.530705079605762 1.05 3 0.025271670457417232 0.075 4 0.0 0.0 5 0.025271670457417232 0.125 6 0.050543340914834464 0.3 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 6 0.15 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.9124999999999996 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028055 spots for SRR6958196.sra Written 1028055 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra Read 1028051 spots for SRR6958196.sra Written 1028051 spots for SRR6958196.sra SRR ids: ['SRR6958196.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z07b1yfy SRR6958196.sra spots: 20561024 blocks: [[1, 1028051], [1028052, 2056102], [2056103, 3084153], [3084154, 4112204], [4112205, 5140255], [5140256, 6168306], [6168307, 7196357], [7196358, 8224408], [8224409, 9252459], [9252460, 10280510], [10280511, 11308561], [11308562, 12336612], [12336613, 13364663], [13364664, 14392714], [14392715, 15420765], [15420766, 16448816], [16448817, 17476867], [17476868, 18504918], [18504919, 19532969], [19532970, 20561024]] SRR6958196 file size 6945756 SRR6958196 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958196 SRR6958196_1.fastq SRR6958196_2.fastq Input file: SRR6958196_1.fastq Paired file: SRR6958196_2.fastq trimmed: SRR6958196-trimmed-pair1.fastq, SRR6958196-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:49:45 2024 >> started Fri Dec 6 15:50:06 2024 >> done (20.507s) 20561024 read pairs processed; of these: 9626 ( 0.05%) short read pairs filtered out after trimming by size control 8265 ( 0.04%) empty read pairs filtered out after trimming by size control 20543133 (99.91%) read pairs available; of these: 6965459 (33.91%) trimmed read pairs available after processing 13577674 (66.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 13 0.00% 21 3 0.00% 22 6 0.00% 23 7 0.00% 24 8 0.00% 25 11 0.00% 26 11 0.00% 27 10 0.00% 28 12 0.00% 29 12 0.00% 30 11 0.00% 31 10 0.00% 32 10 0.00% 33 15 0.00% 34 7 0.00% 35 14 0.00% 36 5 0.00% 37 15 0.00% 38 17 0.00% 39 19 0.00% 40 15 0.00% 41 18 0.00% 42 16 0.00% 43 19 0.00% 44 32 0.00% 45 25 0.00% 46 19 0.00% 47 35 0.00% 48 30 0.00% 49 32 0.00% 50 45 0.00% 51 39 0.00% 52 51 0.00% 53 46 0.00% 54 50 0.00% 55 64 0.00% 56 74 0.00% 57 99 0.00% 58 89 0.00% 59 106 0.00% 60 136 0.00% 61 137 0.00% 62 160 0.00% 63 214 0.00% 64 223 0.00% 65 198 0.00% 66 250 0.00% 67 300 0.00% 68 321 0.00% 69 335 0.00% 70 416 0.00% 71 457 0.00% 72 562 0.00% 73 618 0.00% 74 664 0.00% 75 756 0.00% 76 898 0.00% 77 970 0.00% 78 1095 0.01% 79 1153 0.01% 80 1338 0.01% 81 1470 0.01% 82 1732 0.01% 83 1961 0.01% 84 2557 0.01% 85 3079 0.01% 86 3330 0.02% 87 3601 0.02% 88 3858 0.02% 89 4146 0.02% 90 4465 0.02% 91 4912 0.02% 92 5234 0.03% 93 5710 0.03% 94 6142 0.03% 95 6533 0.03% 96 6960 0.03% 97 7392 0.04% 98 7927 0.04% 99 8558 0.04% 100 9281 0.05% 101 9865 0.05% 102 10449 0.05% 103 11390 0.06% 104 11792 0.06% 105 12477 0.06% 106 13555 0.07% 107 14023 0.07% 108 14775 0.07% 109 15767 0.08% 110 16447 0.08% 111 17656 0.09% 112 18252 0.09% 113 19114 0.09% 114 20391 0.10% 115 21477 0.10% 116 22247 0.11% 117 23459 0.11% 118 24102 0.12% 119 24891 0.12% 120 26270 0.13% 121 27408 0.13% 122 28588 0.14% 123 30044 0.15% 124 31135 0.15% 125 32764 0.16% 126 34239 0.17% 127 35162 0.17% 128 36217 0.18% 129 37621 0.18% 130 39443 0.19% 131 41224 0.20% 132 42718 0.21% 133 45207 0.22% 134 46844 0.23% 135 49219 0.24% 136 52034 0.25% 137 54192 0.26% 138 56471 0.27% 139 60292 0.29% 140 64429 0.31% 141 69182 0.34% 142 75148 0.37% 143 82957 0.40% 144 94157 0.46% 145 111338 0.54% 146 134530 0.65% 147 176560 0.86% 148 265955 1.29% 149 581502 2.83% 150 4069302 19.81% 151 13577674 66.09% 20543133 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=21 prefix-density=0.65 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=39.48 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=67.58 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=12.8 sequence=GCCGCCGCCGCC SRR6958196 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:50:45 Started mapping on | Dec 06 15:50:45 Finished on | Dec 06 15:52:06 Mapping speed, Million of reads per hour | 913.03 Number of input reads | 20543133 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20092224 Uniquely mapped reads % | 97.81% Average mapped length | 297.27 Number of splices: Total | 22451695 Number of splices: Annotated (sjdb) | 21099757 Number of splices: GT/AG | 22159068 Number of splices: GC/AG | 263748 Number of splices: AT/AC | 8966 Number of splices: Non-canonical | 19913 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.01% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206476 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 23240 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 252289 252289 252289 N_multimapping 206476 206476 206476 N_noFeature 858044 19536301 1024737 N_ambiguous 470259 2736 82010 UnstrandedReadsAssigned:18763921 PositiveStrandReadsAssigned:553187 NegativeStrandReadsAssigned:18985477 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958196 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958196-trimmed-pair1.fastq SRR6958196-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,543,133 reads, 19,054,275 reads pseudoaligned [quant] estimated average fragment length: 272.237 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958196.ke.tsv 35125 SRR6958196.se.tsv 88098 total ==> SRR6958196.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.351 0 0 PNS24247 1044 772.763 73.4487 7.26618 PNS24249 1928 1656.76 44.712 2.06316 PNS24246 1044 772.763 73.4487 7.26618 PNS24248 1044 772.763 73.4487 7.26618 PNS24244 1471 1199.76 56.9418 3.62831 PNS24243 293 84.8962 1 0.900493 KQK14069 1603 1331.76 2903.17 166.653 KQK14071 474 222.64 90.2724 30.997 ==> SRR6958196.se.tsv <== BRADI_1g14170v3 3514 BRADI_1g53295v3 433 BRADI_1g59795v3 602 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 337 BRADI_1g74790v3 131 BRADI_1g09890v3 1 BRADI_1g77505v3 288 BRADI_1g48960v3 0 SRR6958196 completed mapping pipeline successfully