Starting /dee2/code/volunteer_pipeline.sh SRR6958197 current disk space = 1550410649600 free memory = 1600070316 SRR6958197 SRAfilesize e8fce69e20ca735cb8b7f5164282f95c SRR6958197.sra SRR6958197.sra file validated SRR6958197 is paired end SRR6958197 is conventional basespace SRR6958197 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958197_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.089 33.0 32.0 33.0 2.0 34.0 2 30.8075 33.0 29.0 33.0 27.0 34.0 3 31.602 33.0 31.0 33.0 27.0 34.0 4 32.7215 33.0 33.0 34.0 32.0 34.0 5 33.0975 33.0 33.0 34.0 32.0 34.0 6 34.47175 38.0 35.0 38.0 26.0 38.0 7 36.6565 38.0 37.0 38.0 34.0 38.0 8 37.29825 38.0 38.0 38.0 36.0 38.0 9 37.52575 38.0 38.0 38.0 37.0 38.0 10-14 37.452149999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.4045 38.0 38.0 38.0 37.4 38.0 20-24 37.29105 38.0 38.0 38.0 37.2 38.0 25-29 37.0722 38.0 38.0 38.0 36.2 38.0 30-34 37.0059 38.0 37.8 38.0 35.6 38.0 35-39 37.03155 38.0 38.0 38.0 35.6 38.0 40-44 37.45505 38.0 38.0 38.0 37.2 38.0 45-49 37.3545 38.0 38.0 38.0 37.0 38.0 50-54 37.21925 38.0 38.0 38.0 36.8 38.0 55-59 37.1755 38.0 38.0 38.0 36.4 38.0 60-64 37.32385 38.0 38.0 38.0 37.0 38.0 65-69 36.628750000000004 38.0 37.4 38.0 33.8 38.0 70-74 37.17975 38.0 38.0 38.0 36.2 38.0 75-79 37.22285000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.14755 38.0 38.0 38.0 36.4 38.0 85-89 36.830499999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.3018 38.0 38.0 38.0 33.6 38.0 95-99 34.37820000000001 38.0 34.6 38.0 22.6 38.0 100-104 35.706849999999996 38.0 37.0 38.0 31.0 38.0 105-109 35.6879 38.0 37.2 38.0 30.6 38.0 110-114 35.788199999999996 38.0 37.0 38.0 30.8 38.0 115-119 36.2712 38.0 37.8 38.0 33.8 38.0 120-124 36.419599999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.43979999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.1633 38.0 37.6 38.0 33.6 38.0 135-139 35.7022 38.0 36.0 38.0 32.2 38.0 140-144 35.37885 38.0 36.0 38.0 31.2 38.0 145-149 32.556200000000004 37.0 30.8 38.0 20.6 38.0 150-151 29.362875000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 3.0 18 2.0 19 4.0 20 1.0 21 0.0 22 4.0 23 4.0 24 6.0 25 9.0 26 13.0 27 14.0 28 26.0 29 50.0 30 45.0 31 69.0 32 99.0 33 102.0 34 191.0 35 310.0 36 800.0 37 2242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.647531572904704 11.16532721010333 8.869115958668198 38.318025258323765 2 25.424999999999997 14.85 33.675 26.05 3 21.975 21.125 23.35 33.550000000000004 4 25.15 27.175 21.3 26.375 5 24.625 30.175 24.325 20.875 6 20.974999999999998 34.325 23.525 21.175 7 15.575 25.25 40.9 18.275 8 18.95 23.875 29.849999999999998 27.325 9 18.7 21.224999999999998 34.025 26.05 10-14 21.8 27.74 25.935000000000002 24.525 15-19 21.81 26.115 26.705000000000002 25.369999999999997 20-24 22.225 26.1 26.76 24.915000000000003 25-29 22.264999999999997 26.895000000000003 25.729999999999997 25.11 30-34 21.72 27.0 26.41 24.87 35-39 22.155 26.3 26.235000000000003 25.31 40-44 22.13 26.26 26.16 25.45 45-49 22.495 26.52 26.02 24.965 50-54 22.470000000000002 26.729999999999997 26.490000000000002 24.310000000000002 55-59 21.945 26.445 26.39 25.22 60-64 21.865000000000002 26.179999999999996 26.424999999999997 25.53 65-69 21.740000000000002 26.584999999999997 26.150000000000002 25.525 70-74 21.98 26.68 26.21 25.130000000000003 75-79 22.264999999999997 26.855 25.814999999999998 25.064999999999998 80-84 22.1 26.334999999999997 26.490000000000002 25.074999999999996 85-89 22.535 25.83 26.015 25.619999999999997 90-94 22.845 26.41 25.745 25.0 95-99 22.335 26.005 26.045 25.615 100-104 22.314999999999998 26.479999999999997 25.72 25.485000000000003 105-109 21.959999999999997 26.490000000000002 25.990000000000002 25.56 110-114 22.52 26.325 25.635 25.52 115-119 22.7 26.790000000000003 25.365 25.145 120-124 22.855 26.340000000000003 25.685000000000002 25.119999999999997 125-129 23.07 26.255 25.935000000000002 24.740000000000002 130-134 22.5 26.86 25.14 25.5 135-139 22.501125056252814 26.616330816540827 25.686284314215712 25.19625981299065 140-144 23.225 26.52 25.485000000000003 24.77 145-149 22.275 26.06 25.580000000000002 26.085 150-151 22.643160790197552 25.831457864466117 25.531382845711427 25.993998499624904 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 2.5 28 6.0 29 7.5 30 8.5 31 14.0 32 20.5 33 26.5 34 34.0 35 49.5 36 64.0 37 79.5 38 93.5 39 105.5 40 148.0 41 182.0 42 211.5 43 233.5 44 223.0 45 225.0 46 221.5 47 228.0 48 219.5 49 191.0 50 175.0 51 151.5 52 123.5 53 101.5 54 94.0 55 85.0 56 73.5 57 57.5 58 47.5 59 52.0 60 46.5 61 42.0 62 47.0 63 42.5 64 36.5 65 32.0 66 28.0 67 26.5 68 24.5 69 24.0 70 21.0 71 13.0 72 13.0 73 15.0 74 10.0 75 7.0 76 6.0 77 4.0 78 1.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.9625000000000004 0.0 0.0 0.0 0.0 128-129 3.2249999999999996 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTGGAT 10 0.0047684857 163.25352 1 ATATGGT 10 0.006846698 144.88751 6 >>END_MODULE SRR6958197 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958197_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92475 33.0 33.0 34.0 32.0 34.0 2 33.10825 34.0 33.0 34.0 32.0 34.0 3 33.137 34.0 33.0 34.0 33.0 34.0 4 32.9475 34.0 33.0 34.0 32.0 34.0 5 32.99925 34.0 33.0 34.0 32.0 34.0 6 37.19975 38.0 38.0 38.0 37.0 38.0 7 37.22 38.0 38.0 38.0 37.0 38.0 8 37.03925 38.0 38.0 38.0 36.0 38.0 9 37.046 38.0 38.0 38.0 36.0 38.0 10-14 37.04175 38.0 38.0 38.0 36.0 38.0 15-19 36.636900000000004 38.0 38.0 38.0 34.8 38.0 20-24 36.86194999999999 38.0 38.0 38.0 35.6 38.0 25-29 37.04325000000001 38.0 38.0 38.0 36.4 38.0 30-34 37.1952 38.0 38.0 38.0 36.8 38.0 35-39 37.28295 38.0 38.0 38.0 37.0 38.0 40-44 35.57745 38.0 35.2 38.0 30.0 38.0 45-49 36.947050000000004 38.0 38.0 38.0 35.8 38.0 50-54 36.52135 38.0 38.0 38.0 34.4 38.0 55-59 36.751050000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.7495 38.0 38.0 38.0 35.0 38.0 65-69 36.717800000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.42915000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.192099999999996 38.0 38.0 38.0 32.6 38.0 80-84 36.287400000000005 38.0 38.0 38.0 33.4 38.0 85-89 36.04475 38.0 37.8 38.0 32.6 38.0 90-94 36.4327 38.0 38.0 38.0 34.0 38.0 95-99 36.59395 38.0 38.0 38.0 34.4 38.0 100-104 36.54085 38.0 38.0 38.0 34.2 38.0 105-109 36.50695 38.0 38.0 38.0 34.2 38.0 110-114 36.194399999999995 38.0 38.0 38.0 33.8 38.0 115-119 35.8039 38.0 37.2 38.0 31.8 38.0 120-124 34.968500000000006 38.0 35.8 38.0 26.6 38.0 125-129 33.182300000000005 37.2 30.8 38.0 21.2 38.0 130-134 30.839299999999998 35.2 25.6 38.0 18.6 38.0 135-139 34.8645 38.0 35.2 38.0 28.8 38.0 140-144 34.44735 38.0 34.4 38.0 26.4 38.0 145-149 34.3059 38.0 35.4 38.0 27.2 38.0 150-151 29.022125000000003 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 1.0 16 5.0 17 2.0 18 3.0 19 5.0 20 12.0 21 15.0 22 3.0 23 11.0 24 15.0 25 21.0 26 27.0 27 30.0 28 45.0 29 49.0 30 51.0 31 77.0 32 104.0 33 120.0 34 170.0 35 315.0 36 815.0 37 2096.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 18.55 12.875 31.0 2 31.3 22.900000000000002 28.549999999999997 17.25 3 21.725 26.525 28.825 22.925 4 24.4 33.550000000000004 21.5 20.549999999999997 5 28.325 33.15 20.4 18.125 6 22.225 35.575 21.224999999999998 20.974999999999998 7 22.675 18.525 36.975 21.825 8 24.8 24.25 23.825 27.125 9 24.325 23.150000000000002 26.625 25.900000000000002 10-14 25.380000000000003 26.6 24.275 23.745 15-19 25.005 26.47 25.2 23.325000000000003 20-24 25.205 26.07 25.15 23.575 25-29 25.47 25.685000000000002 25.740000000000002 23.105 30-34 25.174999999999997 26.63 25.380000000000003 22.814999999999998 35-39 25.1 25.75 25.619999999999997 23.53 40-44 25.919999999999998 25.845000000000002 25.455 22.78 45-49 25.435000000000002 26.064999999999998 25.7 22.8 50-54 25.635 25.825 25.590000000000003 22.95 55-59 25.345000000000002 26.200000000000003 25.924999999999997 22.53 60-64 25.85 26.395000000000003 25.629999999999995 22.125 65-69 25.564999999999998 26.400000000000002 25.805 22.23 70-74 25.53 25.75 26.19 22.53 75-79 25.8 25.790000000000003 25.740000000000002 22.67 80-84 25.81 26.61 25.4 22.18 85-89 25.580000000000002 26.235000000000003 25.865 22.32 90-94 25.174999999999997 26.834999999999997 25.745 22.245 95-99 25.509999999999998 26.195 25.575 22.720000000000002 100-104 25.195 26.064999999999998 26.064999999999998 22.675 105-109 25.03 25.900000000000002 26.534999999999997 22.535 110-114 25.395 26.834999999999997 25.779999999999998 21.990000000000002 115-119 26.16 26.83 24.685000000000002 22.325 120-124 25.355 26.47 25.895000000000003 22.28 125-129 26.169999999999998 26.174999999999997 25.69 21.965 130-134 26.1 26.619999999999997 26.029999999999998 21.25 135-139 25.785000000000004 26.290000000000003 25.919999999999998 22.005 140-144 25.94 26.845000000000002 25.124999999999996 22.09 145-149 26.56 26.035000000000004 25.724999999999998 21.68 150-151 25.974999999999998 26.387500000000003 26.375 21.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 3.5 28 5.5 29 8.0 30 10.5 31 13.0 32 18.0 33 21.0 34 26.0 35 35.0 36 49.5 37 69.0 38 102.0 39 123.5 40 148.5 41 166.5 42 179.5 43 208.0 44 210.0 45 226.5 46 235.0 47 214.0 48 187.5 49 160.5 50 145.5 51 145.0 52 136.5 53 122.5 54 106.5 55 84.5 56 79.0 57 78.5 58 66.0 59 58.5 60 60.5 61 56.0 62 51.5 63 52.0 64 42.0 65 34.5 66 40.0 67 36.5 68 31.0 69 33.0 70 30.5 71 23.5 72 21.5 73 14.0 74 7.0 75 6.0 76 5.5 77 4.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2375 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.5999999999999996 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.00593511 29.0 125-129 >>END_MODULE Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345230 spots for SRR6958197.sra Written 1345230 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra Read 1345217 spots for SRR6958197.sra Written 1345217 spots for SRR6958197.sra SRR ids: ['SRR6958197.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ybhiji5p SRR6958197.sra spots: 26904353 blocks: [[1, 1345217], [1345218, 2690434], [2690435, 4035651], [4035652, 5380868], [5380869, 6726085], [6726086, 8071302], [8071303, 9416519], [9416520, 10761736], [10761737, 12106953], [12106954, 13452170], [13452171, 14797387], [14797388, 16142604], [16142605, 17487821], [17487822, 18833038], [18833039, 20178255], [20178256, 21523472], [21523473, 22868689], [22868690, 24213906], [24213907, 25559123], [25559124, 26904353]] SRR6958197 file size 9095302 SRR6958197 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958197 SRR6958197_1.fastq SRR6958197_2.fastq Input file: SRR6958197_1.fastq Paired file: SRR6958197_2.fastq trimmed: SRR6958197-trimmed-pair1.fastq, SRR6958197-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:51:46 2024 >> started Fri Dec 6 15:52:16 2024 >> done (30.321s) 26904353 read pairs processed; of these: 11954 ( 0.04%) short read pairs filtered out after trimming by size control 7559 ( 0.03%) empty read pairs filtered out after trimming by size control 26884840 (99.93%) read pairs available; of these: 8992359 (33.45%) trimmed read pairs available after processing 17892481 (66.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 8 0.00% 21 2 0.00% 22 9 0.00% 23 7 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 7 0.00% 28 6 0.00% 29 7 0.00% 30 9 0.00% 31 10 0.00% 32 12 0.00% 33 13 0.00% 34 10 0.00% 35 10 0.00% 36 12 0.00% 37 9 0.00% 38 9 0.00% 39 10 0.00% 40 14 0.00% 41 16 0.00% 42 21 0.00% 43 23 0.00% 44 23 0.00% 45 36 0.00% 46 20 0.00% 47 16 0.00% 48 32 0.00% 49 50 0.00% 50 42 0.00% 51 52 0.00% 52 64 0.00% 53 70 0.00% 54 65 0.00% 55 77 0.00% 56 98 0.00% 57 132 0.00% 58 116 0.00% 59 126 0.00% 60 171 0.00% 61 189 0.00% 62 199 0.00% 63 262 0.00% 64 246 0.00% 65 300 0.00% 66 298 0.00% 67 374 0.00% 68 398 0.00% 69 463 0.00% 70 585 0.00% 71 647 0.00% 72 726 0.00% 73 873 0.00% 74 981 0.00% 75 1109 0.00% 76 1167 0.00% 77 1324 0.00% 78 1404 0.01% 79 1704 0.01% 80 1912 0.01% 81 2247 0.01% 82 2680 0.01% 83 2960 0.01% 84 3763 0.01% 85 4540 0.02% 86 4688 0.02% 87 4986 0.02% 88 5370 0.02% 89 5688 0.02% 90 6134 0.02% 91 6908 0.03% 92 7650 0.03% 93 8434 0.03% 94 9305 0.03% 95 9677 0.04% 96 10545 0.04% 97 11022 0.04% 98 11478 0.04% 99 12179 0.05% 100 13131 0.05% 101 14191 0.05% 102 15377 0.06% 103 16903 0.06% 104 17956 0.07% 105 18718 0.07% 106 19633 0.07% 107 20433 0.08% 108 20594 0.08% 109 21998 0.08% 110 22747 0.08% 111 24067 0.09% 112 26140 0.10% 113 27344 0.10% 114 29621 0.11% 115 31429 0.12% 116 32615 0.12% 117 32867 0.12% 118 34241 0.13% 119 34580 0.13% 120 36795 0.14% 121 38433 0.14% 122 40978 0.15% 123 42808 0.16% 124 45965 0.17% 125 47613 0.18% 126 49183 0.18% 127 50866 0.19% 128 51467 0.19% 129 53322 0.20% 130 54891 0.20% 131 56408 0.21% 132 60017 0.22% 133 63071 0.23% 134 67129 0.25% 135 71595 0.27% 136 74633 0.28% 137 78012 0.29% 138 81739 0.30% 139 85621 0.32% 140 90619 0.34% 141 96852 0.36% 142 106620 0.40% 143 118377 0.44% 144 134080 0.50% 145 154782 0.58% 146 187553 0.70% 147 242446 0.90% 148 354302 1.32% 149 695344 2.59% 150 5039396 18.74% 151 17892481 66.55% 26884840 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=30 prefix-density=0.36 prefix-fanout=2.3 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=126.42 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=6.8 sequence=CTTCTCCTTCTCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=21.22 fanout-score-rank=5 prefix-density=1.18 prefix-fanout=5.8 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTGAATCGTGAATCGTATATGTATGTTCACATGTACACTGTGTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=49.09 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=12.0 sequence=GGAGAAGATCAAGGA SRR6958197 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:53:04 Started mapping on | Dec 06 15:53:04 Finished on | Dec 06 15:55:12 Mapping speed, Million of reads per hour | 756.14 Number of input reads | 26884840 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 26247047 Uniquely mapped reads % | 97.63% Average mapped length | 296.63 Number of splices: Total | 28741745 Number of splices: Annotated (sjdb) | 27111855 Number of splices: GT/AG | 28385019 Number of splices: GC/AG | 297427 Number of splices: AT/AC | 12131 Number of splices: Non-canonical | 47168 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198347 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 19379 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448130 448130 448130 N_multimapping 198347 198347 198347 N_noFeature 1307089 25585073 1528355 N_ambiguous 519433 3810 80717 UnstrandedReadsAssigned:24420525 PositiveStrandReadsAssigned:658164 NegativeStrandReadsAssigned:24637975 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958197 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958197-trimmed-pair1.fastq SRR6958197-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,884,840 reads, 24,574,451 reads pseudoaligned [quant] estimated average fragment length: 264.762 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6958197.ke.tsv 35125 SRR6958197.se.tsv 88098 total ==> SRR6958197.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.61 26.1661 2.45414 PNS24247 1044 780.238 98.2744 7.9458 PNS24249 1928 1664.24 133.616 5.06484 PNS24246 1044 780.238 98.2744 7.9458 PNS24248 1044 780.238 98.2744 7.9458 PNS24244 1471 1207.24 78.3949 4.09656 PNS24243 293 87.1943 1 0.723495 KQK14069 1603 1339.24 430.222 20.2656 KQK14071 474 226.557 3.73597 1.04028 ==> SRR6958197.se.tsv <== BRADI_1g14170v3 470 BRADI_1g53295v3 604 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 824 BRADI_1g74790v3 1057 BRADI_1g09890v3 1 BRADI_1g77505v3 217 BRADI_1g48960v3 1 SRR6958197 completed mapping pipeline successfully