Starting /dee2/code/volunteer_pipeline.sh SRR6958198 current disk space = 1550409768960 free memory = 1600895184 SRR6958198 SRAfilesize 5c908ffe897e30964034aa87f162c4a6 SRR6958198.sra SRR6958198.sra file validated SRR6958198 is paired end SRR6958198 is conventional basespace SRR6958198 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958198_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.51325 33.0 32.0 33.0 25.0 33.0 2 29.61075 31.0 29.0 33.0 25.0 33.0 3 31.252 33.0 31.0 33.0 29.0 33.0 4 31.524 33.0 32.0 33.0 30.0 33.0 5 32.4845 33.0 33.0 33.0 32.0 33.0 6 36.765 38.0 37.0 38.0 35.0 38.0 7 37.39975 38.0 38.0 38.0 37.0 38.0 8 37.4235 38.0 38.0 38.0 37.0 38.0 9 37.22175 38.0 38.0 38.0 36.0 38.0 10-14 37.42525 38.0 38.0 38.0 37.2 38.0 15-19 37.46055 38.0 38.0 38.0 37.4 38.0 20-24 37.339099999999995 38.0 38.0 38.0 37.0 38.0 25-29 36.8526 38.0 38.0 38.0 35.6 38.0 30-34 36.90245 38.0 37.8 38.0 35.0 38.0 35-39 37.24435 38.0 38.0 38.0 36.6 38.0 40-44 37.52075 38.0 38.0 38.0 38.0 38.0 45-49 37.602250000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.550650000000005 38.0 38.0 38.0 37.8 38.0 55-59 37.092200000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.98025 38.0 37.8 38.0 35.2 38.0 65-69 37.480650000000004 38.0 38.0 38.0 37.4 38.0 70-74 37.44449999999999 38.0 38.0 38.0 37.2 38.0 75-79 36.28415 38.0 37.2 38.0 32.6 38.0 80-84 36.693799999999996 38.0 37.4 38.0 34.0 38.0 85-89 37.27085 38.0 38.0 38.0 36.6 38.0 90-94 37.343849999999996 38.0 38.0 38.0 37.0 38.0 95-99 37.23525 38.0 38.0 38.0 36.2 38.0 100-104 37.0946 38.0 38.0 38.0 36.0 38.0 105-109 36.990899999999996 38.0 38.0 38.0 35.4 38.0 110-114 37.10685 38.0 38.0 38.0 36.0 38.0 115-119 36.9687 38.0 38.0 38.0 35.4 38.0 120-124 36.6186 38.0 38.0 38.0 34.4 38.0 125-129 36.65515 38.0 38.0 38.0 34.6 38.0 130-134 35.9429 38.0 37.0 38.0 31.4 38.0 135-139 34.7677 38.0 35.2 38.0 25.4 38.0 140-144 35.6932 38.0 36.6 38.0 30.8 38.0 145-149 35.80405 38.0 37.2 38.0 32.8 38.0 150-151 32.286 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 4.0 25 6.0 26 8.0 27 8.0 28 25.0 29 20.0 30 29.0 31 43.0 32 53.0 33 89.0 34 125.0 35 224.0 36 724.0 37 2634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.4529262086514 9.338422391857506 6.3867684478371505 39.82188295165394 2 24.95 12.775 34.25 28.025 3 23.175 14.149999999999999 24.85 37.824999999999996 4 27.825 22.3 21.25 28.625 5 26.325 27.425 24.3 21.95 6 22.400000000000002 31.125000000000004 22.775000000000002 23.7 7 19.075 22.95 38.725 19.25 8 21.65 23.125 29.275000000000002 25.95 9 19.1 22.7 32.875 25.324999999999996 10-14 23.64 26.265 25.474999999999998 24.62 15-19 23.119999999999997 24.775 26.43 25.674999999999997 20-24 23.330000000000002 25.374999999999996 25.69 25.605 25-29 23.1 25.19 25.590000000000003 26.119999999999997 30-34 23.54 25.295 25.53 25.635 35-39 23.51 24.98 25.825 25.685000000000002 40-44 23.59 24.545 25.674999999999997 26.19 45-49 23.46 25.25 25.814999999999998 25.474999999999998 50-54 23.435 25.230000000000004 25.840000000000003 25.495 55-59 24.11 25.019999999999996 25.705 25.165 60-64 23.655 24.65 25.374999999999996 26.32 65-69 23.796189809490475 25.281264063203164 25.896294814740738 25.026251312565627 70-74 23.925 24.335 25.81 25.929999999999996 75-79 23.544999999999998 24.865000000000002 25.71 25.88 80-84 24.15 24.855 25.6 25.395 85-89 24.154999999999998 24.645 25.174999999999997 26.025 90-94 24.395 24.759999999999998 25.09 25.755 95-99 24.095 24.515 25.61 25.779999999999998 100-104 23.965 24.9 25.415 25.72 105-109 23.995 24.595 25.740000000000002 25.669999999999998 110-114 24.295 25.069999999999997 25.47 25.165 115-119 24.474999999999998 25.135 24.82 25.569999999999997 120-124 24.19 24.69 25.1 26.02 125-129 24.21 24.89 25.4 25.5 130-134 24.455 25.155 25.245 25.145 135-139 23.45 25.445 25.224999999999998 25.88 140-144 24.54 25.44 24.52 25.5 145-149 23.845 25.180000000000003 25.365 25.61 150-151 24.3875 24.462500000000002 25.1875 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 4.5 30 6.0 31 7.0 32 11.0 33 12.0 34 15.5 35 30.0 36 44.5 37 58.5 38 70.0 39 91.5 40 119.5 41 139.5 42 176.5 43 189.5 44 189.0 45 213.5 46 209.0 47 190.0 48 188.5 49 177.0 50 157.0 51 142.5 52 138.5 53 137.0 54 116.0 55 110.0 56 106.0 57 85.5 58 74.0 59 79.0 60 90.5 61 85.0 62 62.0 63 59.0 64 66.5 65 66.5 66 55.5 67 45.0 68 45.0 69 33.0 70 26.0 71 21.0 72 16.0 73 11.5 74 7.5 75 8.0 76 4.0 77 1.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98862199747155 97.875 2 0.8849557522123894 1.7500000000000002 3 0.12642225031605564 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.925 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138-139 7.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958198 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958198_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0795 33.0 33.0 34.0 32.0 34.0 2 33.22875 34.0 33.0 34.0 33.0 34.0 3 33.26025 34.0 33.0 34.0 33.0 34.0 4 33.226 34.0 33.0 34.0 33.0 34.0 5 33.12575 34.0 33.0 34.0 33.0 34.0 6 37.3835 38.0 38.0 38.0 37.0 38.0 7 37.3875 38.0 38.0 38.0 37.0 38.0 8 37.44225 38.0 38.0 38.0 38.0 38.0 9 37.43925 38.0 38.0 38.0 37.0 38.0 10-14 37.362199999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.416250000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.40625 38.0 38.0 38.0 37.8 38.0 25-29 37.36855 38.0 38.0 38.0 37.6 38.0 30-34 37.4252 38.0 38.0 38.0 38.0 38.0 35-39 37.2915 38.0 38.0 38.0 37.2 38.0 40-44 36.917449999999995 38.0 38.0 38.0 36.2 38.0 45-49 36.9589 38.0 38.0 38.0 36.2 38.0 50-54 37.1297 38.0 38.0 38.0 36.8 38.0 55-59 37.321250000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.27745 38.0 38.0 38.0 37.0 38.0 65-69 37.2344 38.0 38.0 38.0 37.0 38.0 70-74 37.24165 38.0 38.0 38.0 37.0 38.0 75-79 37.2226 38.0 38.0 38.0 37.0 38.0 80-84 37.060100000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.8919 38.0 38.0 38.0 35.8 38.0 90-94 36.82225 38.0 38.0 38.0 35.2 38.0 95-99 36.68735 38.0 38.0 38.0 35.0 38.0 100-104 36.67445 38.0 38.0 38.0 34.8 38.0 105-109 36.801300000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.550200000000004 38.0 38.0 38.0 34.4 38.0 115-119 36.4806 38.0 38.0 38.0 34.2 38.0 120-124 36.306400000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.1749 38.0 38.0 38.0 33.6 38.0 130-134 36.02045 38.0 38.0 38.0 33.2 38.0 135-139 35.769850000000005 38.0 37.2 38.0 32.6 38.0 140-144 35.372049999999994 38.0 36.0 38.0 31.0 38.0 145-149 34.9015 38.0 36.0 38.0 30.6 38.0 150-151 30.446125000000002 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 0.0 20 3.0 21 6.0 22 4.0 23 8.0 24 8.0 25 12.0 26 13.0 27 19.0 28 23.0 29 26.0 30 34.0 31 60.0 32 52.0 33 87.0 34 137.0 35 172.0 36 404.0 37 2920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.425 17.675 9.875 33.025 2 29.125 24.9 27.175 18.8 3 22.1 25.8 26.900000000000002 25.2 4 26.75 30.7 19.875 22.675 5 28.275 32.6 18.625 20.5 6 23.35 35.475 20.375 20.8 7 21.9 19.675 34.475 23.95 8 23.025000000000002 22.35 25.825 28.799999999999997 9 22.925 22.400000000000002 28.249999999999996 26.424999999999997 10-14 25.985000000000003 26.075 23.125 24.815 15-19 25.73757375737574 25.942594259425945 24.032403240324033 24.287428742874287 20-24 25.53 25.445 24.185000000000002 24.84 25-29 25.665 25.72 24.075 24.54 30-34 25.480000000000004 25.305 24.595 24.62 35-39 25.495 25.555 24.610000000000003 24.34 40-44 25.919999999999998 25.259999999999998 24.154999999999998 24.665 45-49 25.7 25.045 24.6 24.654999999999998 50-54 25.525 25.845000000000002 24.610000000000003 24.02 55-59 25.490000000000002 24.83 24.8 24.88 60-64 26.26 24.95 24.145 24.645 65-69 25.424999999999997 25.729999999999997 24.025 24.82 70-74 25.88 25.045 24.275 24.8 75-79 25.374999999999996 25.259999999999998 24.560000000000002 24.805 80-84 26.029999999999998 25.729999999999997 24.05 24.19 85-89 26.169999999999998 25.345000000000002 24.485 24.0 90-94 25.430000000000003 25.765 24.725 24.08 95-99 25.89 25.224999999999998 24.69 24.195 100-104 26.005 24.975 24.455 24.565 105-109 26.31 25.259999999999998 24.195 24.235 110-114 26.135 25.905 24.055 23.905 115-119 26.192619261926193 25.88758875887589 24.04240424042404 23.877387738773876 120-124 27.134999999999998 25.955000000000002 23.805 23.105 125-129 26.32 25.929999999999996 23.96 23.79 130-134 26.97 26.11 23.919999999999998 23.0 135-139 26.950000000000003 25.765 24.275 23.01 140-144 27.12 26.27 24.6 22.009999999999998 145-149 27.155 25.69 24.59 22.564999999999998 150-151 27.140892611576444 26.56582072759095 23.990498812351543 22.30278784848106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 0.0 25 0.5 26 1.5 27 3.0 28 4.0 29 4.5 30 6.0 31 8.0 32 11.0 33 14.0 34 21.0 35 28.0 36 41.0 37 56.0 38 72.0 39 87.5 40 108.0 41 131.0 42 148.0 43 178.5 44 188.0 45 178.5 46 190.0 47 189.0 48 165.0 49 161.0 50 168.0 51 148.5 52 122.5 53 111.0 54 114.5 55 119.5 56 116.0 57 117.5 58 110.0 59 96.0 60 103.0 61 89.5 62 70.0 63 73.0 64 65.0 65 57.0 66 53.5 67 57.0 68 51.0 69 38.0 70 31.0 71 23.0 72 18.5 73 15.5 74 11.0 75 7.5 76 5.0 77 3.5 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.46977811782709 96.525 2 1.224177505738332 2.4 3 0.204029584289722 0.6 4 0.02550369803621525 0.1 5 0.07651109410864575 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.9625 0.0 0.0 0.0 0.0 128-129 5.3875 0.0 0.0 0.0 0.0 130-131 5.887499999999999 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.925000000000001 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107765 spots for SRR6958198.sra Written 1107765 spots for SRR6958198.sra Read 1107769 spots for SRR6958198.sra Written 1107769 spots for SRR6958198.sra SRR ids: ['SRR6958198.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gvd2nbnp SRR6958198.sra spots: 22155304 blocks: [[1, 1107765], [1107766, 2215530], [2215531, 3323295], [3323296, 4431060], [4431061, 5538825], [5538826, 6646590], [6646591, 7754355], [7754356, 8862120], [8862121, 9969885], [9969886, 11077650], [11077651, 12185415], [12185416, 13293180], [13293181, 14400945], [14400946, 15508710], [15508711, 16616475], [16616476, 17724240], [17724241, 18832005], [18832006, 19939770], [19939771, 21047535], [21047536, 22155304]] SRR6958198 file size 7486005 SRR6958198 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958198 SRR6958198_1.fastq SRR6958198_2.fastq Input file: SRR6958198_1.fastq Paired file: SRR6958198_2.fastq trimmed: SRR6958198-trimmed-pair1.fastq, SRR6958198-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:51:11 2024 >> started Fri Dec 6 15:51:39 2024 >> done (28.059s) 22155304 read pairs processed; of these: 12344 ( 0.06%) short read pairs filtered out after trimming by size control 11266 ( 0.05%) empty read pairs filtered out after trimming by size control 22131694 (99.89%) read pairs available; of these: 8327963 (37.63%) trimmed read pairs available after processing 13803731 (62.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 13 0.00% 21 9 0.00% 22 12 0.00% 23 12 0.00% 24 9 0.00% 25 8 0.00% 26 13 0.00% 27 19 0.00% 28 18 0.00% 29 16 0.00% 30 11 0.00% 31 16 0.00% 32 20 0.00% 33 21 0.00% 34 22 0.00% 35 25 0.00% 36 24 0.00% 37 39 0.00% 38 37 0.00% 39 38 0.00% 40 34 0.00% 41 50 0.00% 42 40 0.00% 43 41 0.00% 44 26 0.00% 45 50 0.00% 46 57 0.00% 47 75 0.00% 48 65 0.00% 49 80 0.00% 50 90 0.00% 51 95 0.00% 52 117 0.00% 53 110 0.00% 54 132 0.00% 55 144 0.00% 56 125 0.00% 57 186 0.00% 58 215 0.00% 59 229 0.00% 60 245 0.00% 61 309 0.00% 62 345 0.00% 63 386 0.00% 64 449 0.00% 65 452 0.00% 66 490 0.00% 67 598 0.00% 68 640 0.00% 69 763 0.00% 70 907 0.00% 71 955 0.00% 72 1128 0.01% 73 1261 0.01% 74 1312 0.01% 75 1555 0.01% 76 1759 0.01% 77 1988 0.01% 78 2243 0.01% 79 2506 0.01% 80 2781 0.01% 81 3004 0.01% 82 3589 0.02% 83 3920 0.02% 84 4855 0.02% 85 5620 0.03% 86 5986 0.03% 87 6703 0.03% 88 7366 0.03% 89 7793 0.04% 90 8684 0.04% 91 9443 0.04% 92 10106 0.05% 93 10977 0.05% 94 11787 0.05% 95 12919 0.06% 96 13661 0.06% 97 14713 0.07% 98 15800 0.07% 99 17073 0.08% 100 18444 0.08% 101 19241 0.09% 102 20750 0.09% 103 22248 0.10% 104 23422 0.11% 105 24510 0.11% 106 26475 0.12% 107 27727 0.13% 108 28992 0.13% 109 30414 0.14% 110 31843 0.14% 111 33677 0.15% 112 35385 0.16% 113 36970 0.17% 114 38898 0.18% 115 40924 0.18% 116 42757 0.19% 117 44174 0.20% 118 45308 0.20% 119 46875 0.21% 120 48261 0.22% 121 49862 0.23% 122 52154 0.24% 123 53414 0.24% 124 56095 0.25% 125 57978 0.26% 126 59801 0.27% 127 61647 0.28% 128 63327 0.29% 129 64691 0.29% 130 67745 0.31% 131 69562 0.31% 132 72152 0.33% 133 74340 0.34% 134 77135 0.35% 135 79946 0.36% 136 82216 0.37% 137 85098 0.38% 138 87316 0.39% 139 93102 0.42% 140 96734 0.44% 141 100515 0.45% 142 111328 0.50% 143 126952 0.57% 144 127671 0.58% 145 146302 0.66% 146 175009 0.79% 147 228757 1.03% 148 332101 1.50% 149 597160 2.70% 150 4091124 18.49% 151 13803731 62.37% 22131694 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=20 prefix-density=1.06 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=43.71 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=84.07 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958198 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:52:47 Started mapping on | Dec 06 15:52:48 Finished on | Dec 06 15:55:44 Mapping speed, Million of reads per hour | 452.69 Number of input reads | 22131694 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21479836 Uniquely mapped reads % | 97.05% Average mapped length | 294.09 Number of splices: Total | 24516814 Number of splices: Annotated (sjdb) | 23027009 Number of splices: GT/AG | 24181780 Number of splices: GC/AG | 279909 Number of splices: AT/AC | 8237 Number of splices: Non-canonical | 46888 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245338 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 9663 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415768 415768 415768 N_multimapping 245338 245338 245338 N_noFeature 735254 20785055 936436 N_ambiguous 572526 2660 80118 UnstrandedReadsAssigned:20172056 PositiveStrandReadsAssigned:692121 NegativeStrandReadsAssigned:20463282 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958198 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958198-trimmed-pair1.fastq SRR6958198-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,131,694 reads, 20,471,586 reads pseudoaligned [quant] estimated average fragment length: 249.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR6958198.ke.tsv 35125 SRR6958198.se.tsv 88098 total ==> SRR6958198.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.789 0 0 PNS24247 1044 795.225 52.9643 4.84075 PNS24249 1928 1679.23 32.8303 1.42097 PNS24246 1044 795.225 52.9643 4.84075 PNS24248 1044 795.225 52.9643 4.84075 PNS24244 1471 1222.23 47.2768 2.81136 PNS24243 293 96.3356 0 0 KQK14069 1603 1354.23 6321.02 339.247 KQK14071 474 241.836 141.985 42.6717 ==> SRR6958198.se.tsv <== BRADI_1g14170v3 7333 BRADI_1g53295v3 972 BRADI_1g59795v3 99 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 323 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 0 SRR6958198 completed mapping pipeline successfully