Starting /dee2/code/volunteer_pipeline.sh SRR6958199 current disk space = 1550414024704 free memory = 1318187456 SRR6958199 SRAfilesize 699a41bfc6143224570999f119ed2c5e SRR6958199.sra SRR6958199.sra file validated SRR6958199 is paired end SRR6958199 is conventional basespace SRR6958199 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958199_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.092 32.0 18.0 33.0 18.0 33.0 2 29.44825 31.0 27.0 33.0 25.0 33.0 3 30.86375 33.0 29.0 33.0 27.0 33.0 4 31.9725 33.0 32.0 33.0 31.0 33.0 5 32.53325 33.0 33.0 33.0 32.0 34.0 6 36.70675 38.0 37.0 38.0 34.0 38.0 7 36.9695 38.0 38.0 38.0 35.0 38.0 8 37.23175 38.0 38.0 38.0 36.0 38.0 9 37.30975 38.0 38.0 38.0 37.0 38.0 10-14 36.0083 38.0 35.6 38.0 31.2 38.0 15-19 37.49730000000001 38.0 38.0 38.0 37.6 38.0 20-24 37.5473 38.0 38.0 38.0 38.0 38.0 25-29 37.494749999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.22705 38.0 38.0 38.0 37.0 38.0 35-39 37.342650000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.20565 38.0 38.0 38.0 36.8 38.0 45-49 36.63205 38.0 37.2 38.0 32.4 38.0 50-54 37.27685 38.0 38.0 38.0 36.8 38.0 55-59 37.24635 38.0 38.0 38.0 36.8 38.0 60-64 37.220150000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.187850000000005 38.0 38.0 38.0 36.6 38.0 70-74 37.20504999999999 38.0 38.0 38.0 36.6 38.0 75-79 36.670849999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.561749999999996 38.0 38.0 38.0 36.0 38.0 85-89 35.3037 38.0 36.0 38.0 29.4 38.0 90-94 34.310649999999995 37.8 34.0 38.0 25.0 38.0 95-99 36.10755 38.0 37.8 38.0 34.0 38.0 100-104 36.23545 38.0 38.0 38.0 34.4 38.0 105-109 36.13395 38.0 38.0 38.0 34.2 38.0 110-114 36.0173 38.0 38.0 38.0 34.0 38.0 115-119 35.8457 38.0 38.0 38.0 33.6 38.0 120-124 35.62134999999999 38.0 38.0 38.0 32.6 38.0 125-129 35.4833 38.0 37.6 38.0 31.6 38.0 130-134 35.362399999999994 38.0 37.0 38.0 31.0 38.0 135-139 35.28725 38.0 36.4 38.0 31.4 38.0 140-144 34.78515 38.0 36.0 38.0 29.0 38.0 145-149 32.98715 38.0 32.4 38.0 22.0 38.0 150-151 30.50725 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 0.0 17 7.0 18 18.0 19 44.0 20 8.0 21 7.0 22 6.0 23 5.0 24 8.0 25 7.0 26 8.0 27 15.0 28 21.0 29 29.0 30 31.0 31 45.0 32 71.0 33 107.0 34 130.0 35 264.0 36 920.0 37 2240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.757416644788655 9.556313993174061 13.415594644263587 41.270674717773694 2 24.925 14.124999999999998 28.875 32.074999999999996 3 25.424999999999997 17.224999999999998 22.525000000000002 34.825 4 28.199999999999996 21.975 20.150000000000002 29.675 5 27.05 27.1 23.0 22.85 6 25.374999999999996 31.275 22.05 21.3 7 19.35 24.275 36.3 20.075000000000003 8 23.225 24.625 27.650000000000002 24.5 9 22.45 21.65 32.074999999999996 23.825 10-14 23.605 25.985000000000003 25.055 25.355 15-19 23.205000000000002 24.759999999999998 25.745 26.290000000000003 20-24 24.044999999999998 25.605 24.884999999999998 25.465 25-29 24.19 24.4 25.245 26.165 30-34 23.43 24.94 25.405 26.224999999999998 35-39 24.0 24.505 25.535000000000004 25.96 40-44 23.755000000000003 24.98 25.619999999999997 25.645 45-49 24.25 24.65 25.509999999999998 25.590000000000003 50-54 24.93 23.74 25.064999999999998 26.265 55-59 23.825 24.21 26.05 25.915 60-64 24.310000000000002 23.765 26.11 25.814999999999998 65-69 23.78 26.25 24.654999999999998 25.314999999999998 70-74 24.36 25.314999999999998 24.895 25.430000000000003 75-79 24.2 25.474999999999998 24.759999999999998 25.564999999999998 80-84 24.165 25.215 24.825 25.795 85-89 24.47 24.08 25.509999999999998 25.94 90-94 24.005000000000003 25.445 24.825 25.724999999999998 95-99 24.355 25.045 24.525 26.075 100-104 24.404999999999998 25.14 24.94 25.515 105-109 24.125 24.685000000000002 24.845 26.345000000000002 110-114 24.395 25.130000000000003 24.404999999999998 26.07 115-119 24.375 25.34 24.490000000000002 25.795 120-124 24.435000000000002 25.36 24.255 25.95 125-129 24.18 25.740000000000002 24.310000000000002 25.77 130-134 24.474999999999998 25.095 24.73 25.7 135-139 24.7 25.590000000000003 23.945 25.765 140-144 24.55 25.035 24.43 25.985000000000003 145-149 24.779999999999998 25.4 24.515 25.305 150-151 24.8 25.1 23.6875 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 3.0 27 3.5 28 5.5 29 7.5 30 6.5 31 10.5 32 13.5 33 16.5 34 25.5 35 36.5 36 49.5 37 60.0 38 80.0 39 99.5 40 115.0 41 139.5 42 163.0 43 165.5 44 170.5 45 185.5 46 191.0 47 183.0 48 174.5 49 177.0 50 167.0 51 154.0 52 133.5 53 116.5 54 106.5 55 97.0 56 95.0 57 87.0 58 75.0 59 69.5 60 70.0 61 73.5 62 69.5 63 57.0 64 59.0 65 62.0 66 54.5 67 45.5 68 44.0 69 55.0 70 52.5 71 39.0 72 32.5 73 27.5 74 23.0 75 15.0 76 7.0 77 6.0 78 6.5 79 5.0 80 2.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54034729315629 97.45 2 0.3830439223697651 0.75 3 0.02553626149131767 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02553626149131767 0.375 >50 0.02553626149131767 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGCTGTATCTCGTAT 54 1.35 TruSeq Adapter, Index 12 (97% over 37bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGCTGTATCTCGTA 15 0.375 TruSeq Adapter, Index 12 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.475 0.0 0.0 0.0 0.0 2 0.475 0.0 0.0 0.0 0.0 3 0.475 0.0 0.0 0.0 0.0 4 0.475 0.0 0.0 0.0 0.0 5 0.475 0.0 0.0 0.0 0.0 6 0.5 0.0 0.0 0.0 0.0 7 0.5 0.0 0.0 0.0 0.0 8 0.5 0.0 0.0 0.0 0.0 9 0.5 0.0 0.0 0.0 0.0 10-11 0.525 0.0 0.0 0.0 0.0 12-13 0.55 0.0 0.0 0.0 0.0 14-15 0.55 0.0 0.0 0.0 0.0 16-17 0.55 0.0 0.0 0.0 0.0 18-19 0.55 0.0 0.0 0.0 0.0 20-21 0.55 0.0 0.0 0.0 0.0 22-23 0.55 0.0 0.0 0.0 0.0 24-25 0.55 0.0 0.0 0.0 0.0 26-27 0.55 0.0 0.0 0.0 0.0 28-29 0.55 0.0 0.0 0.0 0.0 30-31 0.55 0.0 0.0 0.0 0.0 32-33 0.55 0.0 0.0 0.0 0.0 34-35 0.55 0.0 0.0 0.0 0.0 36-37 0.55 0.0 0.0 0.0 0.0 38-39 0.5625 0.0 0.0 0.0 0.0 40-41 0.575 0.0 0.0 0.0 0.0 42-43 0.575 0.0 0.0 0.0 0.0 44-45 0.6 0.0 0.0 0.0 0.0 46-47 0.6125 0.0 0.0 0.0 0.0 48-49 0.625 0.0 0.0 0.0 0.0 50-51 0.6375 0.0 0.0 0.0 0.0 52-53 0.65 0.0 0.0 0.0 0.0 54-55 0.65 0.0 0.0 0.0 0.0 56-57 0.65 0.0 0.0 0.0 0.0 58-59 0.65 0.0 0.0 0.0 0.0 60-61 0.6625000000000001 0.0 0.0 0.0 0.0 62-63 0.675 0.0 0.0 0.0 0.0 64-65 0.675 0.0 0.0 0.0 0.0 66-67 0.675 0.0 0.0 0.0 0.0 68-69 0.7375 0.0 0.0 0.0 0.0 70-71 0.775 0.0 0.0 0.0 0.0 72-73 0.775 0.0 0.0 0.0 0.0 74-75 0.775 0.0 0.0 0.0 0.0 76-77 0.875 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 0.9874999999999999 0.0 0.0 0.0 0.0 84-85 1.0625 0.0 0.0 0.0 0.0 86-87 1.1375 0.0 0.0 0.0 0.0 88-89 1.2374999999999998 0.0 0.0 0.0 0.0 90-91 1.3624999999999998 0.0 0.0 0.0 0.0 92-93 1.55 0.0 0.0 0.0 0.0 94-95 1.7375 0.0 0.0 0.0 0.0 96-97 1.9749999999999999 0.0 0.0 0.0 0.0 98-99 2.225 0.0 0.0 0.0 0.0 100-101 2.3125 0.0 0.0 0.0 0.0 102-103 2.4749999999999996 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.4125 0.0 0.0 0.0 0.0 110-111 3.7125 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.449999999999999 0.0 0.0 0.0 0.0 116-117 4.9125 0.0 0.0 0.0 0.0 118-119 5.3625 0.0 0.0 0.0 0.0 120-121 5.762499999999999 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.425000000000001 0.0 0.0 0.0 0.0 126-127 6.975 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 8.0 0.0 0.0 0.0 0.0 132-133 8.5 0.0 0.0 0.0 0.0 134-135 9.0 0.0 0.0 0.0 0.0 136-137 9.5625 0.0 0.0 0.0 0.0 138-139 10.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGGAA 10 0.0068343505 144.975 3 AAAAAAA 225 1.6124068E-7 9.665 65-69 >>END_MODULE SRR6958199 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958199_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4775 33.0 33.0 34.0 32.0 34.0 2 32.7935 33.0 33.0 34.0 32.0 34.0 3 32.8275 34.0 33.0 34.0 32.0 34.0 4 32.28275 34.0 33.0 34.0 31.0 34.0 5 32.687 34.0 33.0 34.0 32.0 34.0 6 36.9225 38.0 38.0 38.0 36.0 38.0 7 36.82 38.0 38.0 38.0 36.0 38.0 8 36.93725 38.0 38.0 38.0 37.0 38.0 9 36.86925 38.0 38.0 38.0 36.0 38.0 10-14 36.5242 38.0 37.8 38.0 34.8 38.0 15-19 36.726800000000004 38.0 38.0 38.0 35.6 38.0 20-24 36.79335 38.0 38.0 38.0 36.0 38.0 25-29 36.7144 38.0 38.0 38.0 36.2 38.0 30-34 36.68405 38.0 38.0 38.0 36.0 38.0 35-39 36.225350000000006 38.0 38.0 38.0 34.0 38.0 40-44 35.88115 38.0 37.8 38.0 31.6 38.0 45-49 36.1708 38.0 38.0 38.0 34.2 38.0 50-54 36.07835 38.0 38.0 38.0 33.4 38.0 55-59 35.76825 38.0 37.8 38.0 31.4 38.0 60-64 35.85755 38.0 38.0 38.0 32.4 38.0 65-69 35.732000000000006 38.0 37.8 38.0 31.2 38.0 70-74 35.73175 38.0 37.6 38.0 30.2 38.0 75-79 36.304050000000004 38.0 38.0 38.0 35.0 38.0 80-84 35.873000000000005 38.0 38.0 38.0 34.0 38.0 85-89 35.6053 38.0 38.0 38.0 33.6 38.0 90-94 33.68245 37.8 33.6 38.0 22.4 38.0 95-99 35.14370000000001 38.0 37.4 38.0 30.4 38.0 100-104 35.3452 38.0 38.0 38.0 32.6 38.0 105-109 34.62475 38.0 36.6 38.0 27.2 38.0 110-114 35.13175 38.0 38.0 38.0 31.0 38.0 115-119 35.013 38.0 37.6 38.0 30.2 38.0 120-124 34.725 38.0 36.0 38.0 28.2 38.0 125-129 34.29105 38.0 35.6 38.0 24.0 38.0 130-134 34.04260000000001 38.0 35.6 38.0 23.2 38.0 135-139 33.839150000000004 38.0 35.2 38.0 22.6 38.0 140-144 33.2139 38.0 33.6 38.0 15.4 38.0 145-149 31.03105 37.6 29.4 38.0 6.0 38.0 150-151 25.671 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 7.0 4 5.0 5 7.0 6 1.0 7 8.0 8 9.0 9 5.0 10 5.0 11 4.0 12 5.0 13 4.0 14 10.0 15 15.0 16 20.0 17 10.0 18 9.0 19 8.0 20 7.0 21 8.0 22 8.0 23 5.0 24 16.0 25 17.0 26 20.0 27 18.0 28 37.0 29 44.0 30 46.0 31 68.0 32 103.0 33 108.0 34 157.0 35 300.0 36 714.0 37 2166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.725 15.9 18.025 35.35 2 29.975 21.775 25.074999999999996 23.175 3 23.474999999999998 25.0 25.650000000000002 25.874999999999996 4 26.674999999999997 28.275 19.75 25.3 5 28.050000000000004 29.9 19.25 22.8 6 24.9 34.325 19.575 21.2 7 22.875 19.675 32.7 24.75 8 24.15 24.099999999999998 21.55 30.2 9 23.9 23.375 26.55 26.174999999999997 10-14 26.685 24.990000000000002 22.54 25.785000000000004 15-19 26.045 23.715 24.37 25.869999999999997 20-24 26.745 25.145 23.294999999999998 24.815 25-29 26.14 25.775 22.96 25.124999999999996 30-34 25.5 24.62 24.295 25.585 35-39 26.63 23.765 24.065 25.540000000000003 40-44 26.575 23.97 24.310000000000002 25.145 45-49 25.650000000000002 25.014999999999997 23.825 25.509999999999998 50-54 26.634999999999998 24.345 23.46 25.56 55-59 26.855 23.835 23.74 25.569999999999997 60-64 26.584999999999997 23.865 23.474999999999998 26.075 65-69 25.255 24.21 25.185000000000002 25.35 70-74 26.015 25.56 23.44 24.985 75-79 25.46 26.540000000000003 22.93 25.069999999999997 80-84 25.874999999999996 26.32 23.43 24.375 85-89 26.435 25.305 24.025 24.235 90-94 25.4 25.515 23.855 25.230000000000004 95-99 26.245 25.195 23.919999999999998 24.64 100-104 26.3 25.465 23.41 24.825 105-109 27.04 24.795 23.68 24.485 110-114 26.745 25.580000000000002 23.39 24.285 115-119 26.87 25.025 24.035 24.07 120-124 26.584999999999997 25.365 23.98 24.07 125-129 27.26 25.135 23.525 24.08 130-134 27.605 25.665 23.68 23.05 135-139 27.66 25.31 23.805 23.225 140-144 27.73 25.259999999999998 23.830000000000002 23.18 145-149 27.639999999999997 25.115 24.349999999999998 22.895 150-151 28.075 25.174999999999997 23.875 22.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.5 26 3.0 27 2.5 28 4.0 29 6.5 30 8.5 31 12.5 32 14.5 33 16.5 34 26.0 35 30.0 36 36.5 37 54.5 38 70.0 39 93.5 40 112.0 41 123.5 42 143.0 43 157.5 44 166.0 45 188.0 46 182.5 47 153.5 48 146.0 49 156.0 50 144.5 51 130.0 52 123.5 53 105.5 54 105.0 55 96.5 56 86.5 57 93.0 58 96.0 59 84.0 60 74.0 61 75.5 62 81.5 63 90.0 64 86.0 65 78.0 66 68.5 67 61.5 68 63.5 69 61.5 70 58.5 71 56.0 72 45.0 73 29.0 74 25.0 75 21.5 76 16.5 77 12.5 78 7.5 79 3.5 80 2.0 81 1.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16009162636803 97.39999999999999 2 0.5853906846525834 1.15 3 0.12725884448969205 0.375 4 0.050903537795876815 0.2 5 0.025451768897938407 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050903537795876815 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTGCTGTGTGTAGATCT 15 0.375 Illumina Single End PCR Primer 1 (96% over 32bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTGCTGTGTGTAGATC 15 0.375 Illumina Single End PCR Primer 1 (96% over 33bp) CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.525 0.0 0.0 0.0 0.0 2 0.525 0.0 0.0 0.0 0.0 3 0.525 0.0 0.0 0.0 0.0 4 0.525 0.0 0.0 0.0 0.0 5 0.525 0.0 0.0 0.0 0.0 6 0.55 0.0 0.0 0.0 0.0 7 0.55 0.0 0.0 0.0 0.0 8 0.55 0.0 0.0 0.0 0.0 9 0.55 0.0 0.0 0.0 0.0 10-11 0.575 0.0 0.0 0.0 0.0 12-13 0.6 0.0 0.0 0.0 0.0 14-15 0.6 0.0 0.0 0.0 0.0 16-17 0.6 0.0 0.0 0.0 0.0 18-19 0.6 0.0 0.0 0.0 0.0 20-21 0.6 0.0 0.0 0.0 0.0 22-23 0.6 0.0 0.0 0.0 0.0 24-25 0.6 0.0 0.0 0.0 0.0 26-27 0.6 0.0 0.0 0.0 0.0 28-29 0.6 0.0 0.0 0.0 0.0 30-31 0.6 0.0 0.0 0.0 0.0 32-33 0.6 0.0 0.0 0.0 0.0 34-35 0.6 0.0 0.0 0.0 0.0 36-37 0.6 0.0 0.0 0.0 0.0 38-39 0.6125 0.0 0.0 0.0 0.0 40-41 0.625 0.0 0.0 0.0 0.0 42-43 0.625 0.0 0.0 0.0 0.0 44-45 0.65 0.0 0.0 0.0 0.0 46-47 0.6625000000000001 0.0 0.0 0.0 0.0 48-49 0.675 0.0 0.0 0.0 0.0 50-51 0.6875 0.0 0.0 0.0 0.0 52-53 0.7 0.0 0.0 0.0 0.0 54-55 0.7 0.0 0.0 0.0 0.0 56-57 0.7 0.0 0.0 0.0 0.0 58-59 0.7 0.0 0.0 0.0 0.0 60-61 0.7124999999999999 0.0 0.0 0.0 0.0 62-63 0.75 0.0 0.0 0.0 0.0 64-65 0.75 0.0 0.0 0.0 0.0 66-67 0.75 0.0 0.0 0.0 0.0 68-69 0.8125 0.0 0.0 0.0 0.0 70-71 0.85 0.0 0.0 0.0 0.0 72-73 0.85 0.0 0.0 0.0 0.0 74-75 0.85 0.0 0.0 0.0 0.0 76-77 0.925 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 0.975 0.0 0.0 0.0 0.0 82-83 1.025 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.2375 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.675 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.0999999999999996 0.0 0.0 0.0 0.0 98-99 2.35 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.5999999999999996 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.2125 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.6 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.4875 0.0 0.0 0.0 0.0 120-121 5.887499999999999 0.0 0.0 0.0 0.0 122-123 6.125 0.0 0.0 0.0 0.0 124-125 6.5875 0.0 0.0 0.0 0.0 126-127 7.137499999999999 0.0 0.0 0.0 0.0 128-129 7.6125 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.1 0.0 0.0 0.0 0.0 136-137 9.6875 0.0 0.0 0.0 0.0 138-139 10.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGACTC 10 0.006830828 145.0 7 AAAAAAA 220 0.0 13.181818 75-79 >>END_MODULE Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149264 spots for SRR6958199.sra Written 1149264 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra Read 1149245 spots for SRR6958199.sra Written 1149245 spots for SRR6958199.sra SRR ids: ['SRR6958199.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmkhh5ay SRR6958199.sra spots: 22984919 blocks: [[1, 1149245], [1149246, 2298490], [2298491, 3447735], [3447736, 4596980], [4596981, 5746225], [5746226, 6895470], [6895471, 8044715], [8044716, 9193960], [9193961, 10343205], [10343206, 11492450], [11492451, 12641695], [12641696, 13790940], [13790941, 14940185], [14940186, 16089430], [16089431, 17238675], [17238676, 18387920], [18387921, 19537165], [19537166, 20686410], [20686411, 21835655], [21835656, 22984919]] SRR6958199 file size 7767134 SRR6958199 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958199 SRR6958199_1.fastq SRR6958199_2.fastq Input file: SRR6958199_1.fastq Paired file: SRR6958199_2.fastq trimmed: SRR6958199-trimmed-pair1.fastq, SRR6958199-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:51:22 2024 >> started Fri Dec 6 15:51:49 2024 >> done (27.839s) 22984919 read pairs processed; of these: 65304 ( 0.28%) short read pairs filtered out after trimming by size control 589866 ( 2.57%) empty read pairs filtered out after trimming by size control 22329749 (97.15%) read pairs available; of these: 9285931 (41.59%) trimmed read pairs available after processing 13043818 (58.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 29 0.00% 20 21 0.00% 21 26 0.00% 22 33 0.00% 23 24 0.00% 24 31 0.00% 25 32 0.00% 26 31 0.00% 27 32 0.00% 28 41 0.00% 29 52 0.00% 30 48 0.00% 31 72 0.00% 32 57 0.00% 33 49 0.00% 34 69 0.00% 35 99 0.00% 36 92 0.00% 37 109 0.00% 38 135 0.00% 39 137 0.00% 40 182 0.00% 41 157 0.00% 42 155 0.00% 43 155 0.00% 44 189 0.00% 45 288 0.00% 46 335 0.00% 47 372 0.00% 48 441 0.00% 49 491 0.00% 50 451 0.00% 51 529 0.00% 52 552 0.00% 53 634 0.00% 54 649 0.00% 55 685 0.00% 56 730 0.00% 57 813 0.00% 58 1088 0.00% 59 1076 0.00% 60 1438 0.01% 61 1316 0.01% 62 1340 0.01% 63 1643 0.01% 64 1551 0.01% 65 1612 0.01% 66 1592 0.01% 67 1806 0.01% 68 2047 0.01% 69 2357 0.01% 70 2410 0.01% 71 2790 0.01% 72 3355 0.02% 73 3458 0.02% 74 3805 0.02% 75 4648 0.02% 76 8735 0.04% 77 8276 0.04% 78 5573 0.02% 79 6038 0.03% 80 6566 0.03% 81 7018 0.03% 82 7639 0.03% 83 8789 0.04% 84 11526 0.05% 85 13715 0.06% 86 14247 0.06% 87 15057 0.07% 88 15785 0.07% 89 16382 0.07% 90 17237 0.08% 91 18271 0.08% 92 19462 0.09% 93 20315 0.09% 94 21711 0.10% 95 23064 0.10% 96 24200 0.11% 97 25440 0.11% 98 26765 0.12% 99 27708 0.12% 100 29407 0.13% 101 30314 0.14% 102 31748 0.14% 103 33864 0.15% 104 35289 0.16% 105 36533 0.16% 106 38449 0.17% 107 39865 0.18% 108 41238 0.18% 109 42726 0.19% 110 44321 0.20% 111 45729 0.20% 112 47067 0.21% 113 48388 0.22% 114 50684 0.23% 115 52605 0.24% 116 54122 0.24% 117 55233 0.25% 118 56759 0.25% 119 57337 0.26% 120 59445 0.27% 121 60457 0.27% 122 61651 0.28% 123 63433 0.28% 124 65197 0.29% 125 66778 0.30% 126 69160 0.31% 127 70067 0.31% 128 71150 0.32% 129 72742 0.33% 130 74492 0.33% 131 76172 0.34% 132 77762 0.35% 133 80532 0.36% 134 81941 0.37% 135 84441 0.38% 136 87338 0.39% 137 90678 0.41% 138 92426 0.41% 139 96710 0.43% 140 101092 0.45% 141 105702 0.47% 142 113810 0.51% 143 121958 0.55% 144 134605 0.60% 145 153814 0.69% 146 182747 0.82% 147 232708 1.04% 148 333250 1.49% 149 636998 2.85% 150 4377092 19.60% 151 13043818 58.41% 22329749 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=29 prefix-density=0.44 prefix-fanout=2.9 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=41.72 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=3.1 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=95.69 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958199 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:52:59 Started mapping on | Dec 06 15:53:00 Finished on | Dec 06 15:54:34 Mapping speed, Million of reads per hour | 855.18 Number of input reads | 22329749 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21788107 Uniquely mapped reads % | 97.57% Average mapped length | 292.34 Number of splices: Total | 22969186 Number of splices: Annotated (sjdb) | 21478879 Number of splices: GT/AG | 22663334 Number of splices: GC/AG | 272011 Number of splices: AT/AC | 10394 Number of splices: Non-canonical | 23447 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196908 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 20805 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 380320 380320 380320 N_multimapping 196908 196908 196908 N_noFeature 815844 21179095 994553 N_ambiguous 511890 3140 81649 UnstrandedReadsAssigned:20460373 PositiveStrandReadsAssigned:605872 NegativeStrandReadsAssigned:20711905 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958199 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958199-trimmed-pair1.fastq SRR6958199-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,329,749 reads, 20,762,878 reads pseudoaligned [quant] estimated average fragment length: 249.458 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958199.ke.tsv 35125 SRR6958199.se.tsv 88098 total ==> SRR6958199.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.056 0 0 PNS24247 1044 795.542 48.1099 4.16618 PNS24249 1928 1679.54 110.896 4.54876 PNS24246 1044 795.542 48.1099 4.16618 PNS24248 1044 795.542 48.1099 4.16618 PNS24244 1471 1222.54 48.7738 2.74846 PNS24243 293 99.3988 0 0 KQK14069 1603 1354.54 3349.78 170.369 KQK14071 474 242.631 52.9013 15.0206 ==> SRR6958199.se.tsv <== BRADI_1g14170v3 3605 BRADI_1g53295v3 209 BRADI_1g59795v3 446 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 411 BRADI_1g74790v3 114 BRADI_1g09890v3 0 BRADI_1g77505v3 348 BRADI_1g48960v3 0 SRR6958199 completed mapping pipeline successfully