Starting /dee2/code/volunteer_pipeline.sh SRR6958200 current disk space = 1550421508096 free memory = 1321764936 SRR6958200 SRAfilesize 4d9778fae3e0b3ff3821c6b9253ca7b2 SRR6958200.sra SRR6958200.sra file validated SRR6958200 is paired end SRR6958200 is conventional basespace SRR6958200 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958200_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.25825 18.0 18.0 32.0 18.0 33.0 2 28.0185 28.0 27.0 33.0 18.0 33.0 3 29.992 31.0 29.0 33.0 25.0 33.0 4 31.77275 33.0 31.0 33.0 29.0 33.0 5 32.33725 33.0 32.0 33.0 32.0 33.0 6 36.50625 38.0 36.0 38.0 34.0 38.0 7 37.33575 38.0 38.0 38.0 36.0 38.0 8 37.523 38.0 38.0 38.0 37.0 38.0 9 37.605 38.0 38.0 38.0 38.0 38.0 10-14 37.6277 38.0 38.0 38.0 38.0 38.0 15-19 37.6048 38.0 38.0 38.0 37.8 38.0 20-24 37.5182 38.0 38.0 38.0 37.6 38.0 25-29 37.599399999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5664 38.0 38.0 38.0 37.8 38.0 35-39 37.6523 38.0 38.0 38.0 38.0 38.0 40-44 37.652550000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.57305000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.4908 38.0 38.0 38.0 37.6 38.0 55-59 37.435050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.412 38.0 38.0 38.0 37.0 38.0 65-69 37.3323 38.0 38.0 38.0 37.0 38.0 70-74 37.2953 38.0 38.0 38.0 36.8 38.0 75-79 37.10205 38.0 38.0 38.0 36.0 38.0 80-84 35.6519 38.0 35.6 38.0 29.8 38.0 85-89 37.0747 38.0 38.0 38.0 35.8 38.0 90-94 37.059400000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.91415 38.0 38.0 38.0 35.4 38.0 100-104 36.7201 38.0 38.0 38.0 34.6 38.0 105-109 36.6566 38.0 38.0 38.0 34.4 38.0 110-114 36.53060000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.3009 38.0 37.6 38.0 33.8 38.0 120-124 36.09755 38.0 37.2 38.0 33.2 38.0 125-129 35.98905 38.0 36.8 38.0 32.6 38.0 130-134 35.77445 38.0 36.0 38.0 32.2 38.0 135-139 35.69754999999999 38.0 36.0 38.0 32.0 38.0 140-144 35.16865 38.0 35.8 38.0 30.4 38.0 145-149 34.653200000000005 38.0 35.6 38.0 29.0 38.0 150-151 30.157625000000003 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 1.0 20 1.0 21 2.0 22 3.0 23 4.0 24 5.0 25 10.0 26 9.0 27 9.0 28 17.0 29 22.0 30 33.0 31 36.0 32 53.0 33 91.0 34 153.0 35 304.0 36 825.0 37 2416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.566534914361 26.56126482213439 6.824769433465086 36.047430830039524 2 23.549999999999997 12.85 33.6 30.0 3 20.25 17.525 25.2 37.025000000000006 4 25.025 27.400000000000002 21.6 25.974999999999998 5 24.775 31.674999999999997 23.275000000000002 20.275000000000002 6 22.25 32.800000000000004 24.05 20.9 7 17.299999999999997 25.124999999999996 39.45 18.125 8 19.675 25.25 30.099999999999998 24.975 9 19.825 21.775 34.825 23.575 10-14 22.45 27.38 26.185000000000002 23.985 15-19 22.400000000000002 26.32 26.950000000000003 24.33 20-24 22.446122306115306 25.696284814240713 27.31136556827841 24.546227311365566 25-29 22.08 26.6 27.134999999999998 24.185000000000002 30-34 22.36 26.674999999999997 26.63 24.335 35-39 22.53 26.729999999999997 26.450000000000003 24.29 40-44 22.564999999999998 26.179999999999996 26.765 24.490000000000002 45-49 22.28 26.384999999999998 26.674999999999997 24.66 50-54 22.15 26.700000000000003 26.700000000000003 24.45 55-59 22.13 26.525 26.655 24.69 60-64 22.650000000000002 26.33 26.39 24.63 65-69 22.35 25.96 26.755000000000003 24.935 70-74 22.415 26.279999999999998 26.619999999999997 24.685000000000002 75-79 22.73 26.195 26.540000000000003 24.535 80-84 22.634999999999998 25.735000000000003 26.810000000000002 24.82 85-89 22.38 26.69 26.415 24.515 90-94 23.14 25.845000000000002 26.3 24.715 95-99 22.62 25.845000000000002 26.615 24.92 100-104 22.890722680670166 26.12653163290823 26.486621655413856 24.496124031007753 105-109 22.035 26.82 26.575 24.57 110-114 23.36 26.365 25.729999999999997 24.545 115-119 22.90114505725286 26.681334066703332 26.54632731636582 23.871193559677984 120-124 22.765 27.02 25.615 24.6 125-129 23.080000000000002 26.435 25.705 24.779999999999998 130-134 22.935 26.784999999999997 25.245 25.035 135-139 22.875 26.215 25.924999999999997 24.985 140-144 23.105 26.584999999999997 25.46 24.85 145-149 22.830000000000002 27.029999999999998 25.275 24.865000000000002 150-151 22.525000000000002 26.887499999999996 25.0125 25.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 2.5 28 5.5 29 9.0 30 8.5 31 10.5 32 15.5 33 26.0 34 40.0 35 47.5 36 62.5 37 88.5 38 102.5 39 118.0 40 151.5 41 174.0 42 196.0 43 222.0 44 237.0 45 239.5 46 236.5 47 231.0 48 210.0 49 185.0 50 160.5 51 138.5 52 119.0 53 106.5 54 92.5 55 88.5 56 86.5 57 68.0 58 62.0 59 65.0 60 71.0 61 61.5 62 43.5 63 35.5 64 30.0 65 29.5 66 24.5 67 17.5 68 15.5 69 12.0 70 9.0 71 10.0 72 8.5 73 6.0 74 5.0 75 3.0 76 2.0 77 2.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.4375 0.0 0.0 0.0 0.0 112-113 3.8875 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.362500000000001 0.0 0.0 0.0 0.0 120-121 5.9125 0.0 0.0 0.0 0.0 122-123 6.625 0.0 0.0 0.0 0.0 124-125 7.449999999999999 0.0 0.0 0.0 0.0 126-127 8.075 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.4375 0.0 0.0 0.0 0.0 132-133 10.1875 0.0 0.0 0.0 0.0 134-135 10.95 0.0 0.0 0.0 0.0 136-137 11.6125 0.0 0.0 0.0 0.0 138-139 12.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGCT 10 0.0068396386 144.9375 7 AATTTAA 10 0.0068396386 144.9375 5 >>END_MODULE SRR6958200 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958200_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.193 33.0 33.0 34.0 33.0 34.0 2 33.28625 34.0 33.0 34.0 33.0 34.0 3 33.32225 34.0 33.0 34.0 33.0 34.0 4 33.2865 34.0 33.0 34.0 33.0 34.0 5 33.29375 34.0 33.0 34.0 33.0 34.0 6 37.558 38.0 38.0 38.0 38.0 38.0 7 37.472 38.0 38.0 38.0 38.0 38.0 8 37.4545 38.0 38.0 38.0 38.0 38.0 9 37.54875 38.0 38.0 38.0 38.0 38.0 10-14 37.4799 38.0 38.0 38.0 38.0 38.0 15-19 36.463800000000006 38.0 37.4 38.0 33.6 38.0 20-24 36.2062 38.0 36.8 38.0 30.2 38.0 25-29 37.3497 38.0 38.0 38.0 37.4 38.0 30-34 37.4581 38.0 38.0 38.0 38.0 38.0 35-39 37.379149999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.446600000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.4594 38.0 38.0 38.0 38.0 38.0 50-54 37.239999999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.25575 38.0 38.0 38.0 37.8 38.0 60-64 37.23855 38.0 38.0 38.0 37.2 38.0 65-69 37.23745 38.0 38.0 38.0 37.2 38.0 70-74 37.10915 38.0 38.0 38.0 37.2 38.0 75-79 37.05545 38.0 38.0 38.0 37.0 38.0 80-84 36.943799999999996 38.0 38.0 38.0 36.6 38.0 85-89 36.98035 38.0 38.0 38.0 36.8 38.0 90-94 35.762800000000006 38.0 36.6 38.0 30.0 38.0 95-99 34.53375 38.0 34.2 38.0 24.6 38.0 100-104 34.44010000000001 37.8 33.2 38.0 26.6 38.0 105-109 36.4354 38.0 37.8 38.0 34.4 38.0 110-114 36.23885 38.0 37.8 38.0 33.0 38.0 115-119 35.87735 38.0 37.4 38.0 31.8 38.0 120-124 35.38590000000001 38.0 36.6 38.0 30.0 38.0 125-129 35.386449999999996 38.0 36.2 38.0 29.8 38.0 130-134 33.1121 37.0 29.4 38.0 24.4 38.0 135-139 34.423899999999996 38.0 35.0 38.0 24.8 38.0 140-144 33.62345 38.0 34.0 38.0 21.2 38.0 145-149 33.8789 38.0 34.2 38.0 24.6 38.0 150-151 29.261875000000003 35.5 18.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 1.0 12 4.0 13 8.0 14 3.0 15 0.0 16 4.0 17 5.0 18 2.0 19 2.0 20 5.0 21 6.0 22 4.0 23 4.0 24 7.0 25 8.0 26 17.0 27 17.0 28 23.0 29 33.0 30 39.0 31 48.0 32 70.0 33 97.0 34 148.0 35 366.0 36 1074.0 37 1995.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.0 20.375 9.9 27.725 2 29.975 23.575 27.975 18.475 3 22.8 25.7 30.075000000000003 21.425 4 26.224999999999998 32.375 20.65 20.75 5 25.825 34.55 20.549999999999997 19.075 6 21.224999999999998 38.95 21.65 18.175 7 22.05 20.175 36.1 21.675 8 23.05 23.825 26.5 26.625 9 23.65 24.099999999999998 27.975 24.275 10-14 24.875 27.405 24.465 23.255 15-19 24.845 26.77 25.665 22.720000000000002 20-24 24.68 26.85 25.3 23.169999999999998 25-29 24.845 27.075 25.040000000000003 23.04 30-34 24.575 26.229999999999997 26.035000000000004 23.16 35-39 24.48 26.740000000000002 25.665 23.115 40-44 24.48 26.755000000000003 25.169999999999998 23.595 45-49 24.965 26.305 25.745 22.985 50-54 25.01502704868764 26.34241634942897 25.42075736325386 23.221799238629533 55-59 24.601423844379823 27.10819211872055 25.45873859420435 22.83164544269528 60-64 24.4887730553328 26.774258219727347 26.19286287089014 22.54410585404972 65-69 24.681895601643124 26.375112714156902 25.854122833383432 23.088868850816553 70-74 24.654100661720474 26.458792861439743 26.112893523160217 22.77421295367957 75-79 25.25186707433211 26.379630093729638 26.11397924916044 22.254523582777804 80-84 24.61360899237254 26.686069851465277 25.79787234042553 22.90244881573665 85-89 24.86833525605658 26.493454381301095 25.610673621909015 23.02753674073331 90-94 24.735761158142562 26.67935681009868 26.088263287081098 22.496618744677654 95-99 24.82471955128205 27.1484375 25.470753205128204 22.556089743589745 100-104 25.00626283881958 26.96527882158425 25.702690515556892 22.325767824039282 105-109 24.81214307183649 26.911131149183447 25.498447049393846 22.778278729586212 110-114 25.06260643093259 27.692076530101172 25.413202444155065 21.832114594811177 115-119 25.6187994789057 27.342419080068144 25.202926144904296 21.835855296121856 120-124 25.622027534418024 27.479349186483105 25.341677096370464 21.55694618272841 125-129 26.220641995092393 26.971806299764634 25.14397315839551 21.66357854674746 130-134 26.175940752602084 27.75220176140913 24.71477181745396 21.35708566853483 135-139 27.0230996642782 26.94793806684371 25.39960915969334 20.62935310918475 140-144 27.336073791858833 27.200721876879886 25.095247643874075 20.367956687387206 145-149 26.79197994987469 27.538847117794486 25.19298245614035 20.476190476190474 150-151 28.05015673981191 26.420062695924766 25.391849529780565 20.137931034482758 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 2.0 21 2.0 22 1.5 23 2.0 24 1.0 25 1.0 26 3.0 27 6.0 28 7.5 29 9.0 30 12.0 31 9.0 32 10.0 33 20.5 34 31.5 35 38.0 36 52.0 37 68.5 38 97.0 39 126.0 40 145.0 41 174.0 42 199.0 43 202.5 44 216.0 45 239.5 46 236.0 47 213.0 48 193.5 49 181.5 50 163.0 51 153.5 52 132.5 53 101.5 54 94.5 55 90.0 56 79.0 57 80.5 58 76.0 59 75.0 60 70.5 61 52.5 62 45.0 63 39.5 64 37.5 65 39.5 66 34.0 67 27.5 68 24.5 69 16.5 70 12.5 71 14.0 72 11.5 73 6.5 74 4.0 75 4.0 76 5.0 77 3.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.18 55-59 0.27 60-64 0.24 65-69 0.19 70-74 0.26 75-79 0.245 80-84 0.36 85-89 0.315 90-94 0.185 95-99 0.16 100-104 0.20500000000000002 105-109 0.19 110-114 0.16999999999999998 115-119 0.21 120-124 0.125 125-129 0.155 130-134 0.08 135-139 0.215 140-144 0.26 145-149 0.25 150-151 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47116595316041 98.75 2 0.3777386048854193 0.75 3 0.12591286829513976 0.375 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.4375 0.0 0.0 0.0 0.0 118-119 4.800000000000001 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.8125 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.675 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 10.0625 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862773 spots for SRR6958200.sra Written 862773 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra Read 862764 spots for SRR6958200.sra Written 862764 spots for SRR6958200.sra SRR ids: ['SRR6958200.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_roinh4jp SRR6958200.sra spots: 17255289 blocks: [[1, 862764], [862765, 1725528], [1725529, 2588292], [2588293, 3451056], [3451057, 4313820], [4313821, 5176584], [5176585, 6039348], [6039349, 6902112], [6902113, 7764876], [7764877, 8627640], [8627641, 9490404], [9490405, 10353168], [10353169, 11215932], [11215933, 12078696], [12078697, 12941460], [12941461, 13804224], [13804225, 14666988], [14666989, 15529752], [15529753, 16392516], [16392517, 17255289]] SRR6958200 file size 5825550 SRR6958200 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958200 SRR6958200_1.fastq SRR6958200_2.fastq Input file: SRR6958200_1.fastq Paired file: SRR6958200_2.fastq trimmed: SRR6958200-trimmed-pair1.fastq, SRR6958200-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:51:29 2024 >> started Fri Dec 6 15:51:49 2024 >> done (20.392s) 17255289 read pairs processed; of these: 6581 ( 0.04%) short read pairs filtered out after trimming by size control 11816 ( 0.07%) empty read pairs filtered out after trimming by size control 17236892 (99.89%) read pairs available; of these: 10287881 (59.69%) trimmed read pairs available after processing 6949011 (40.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 6 0.00% 21 9 0.00% 22 8 0.00% 23 12 0.00% 24 8 0.00% 25 11 0.00% 26 5 0.00% 27 13 0.00% 28 15 0.00% 29 12 0.00% 30 18 0.00% 31 21 0.00% 32 25 0.00% 33 13 0.00% 34 14 0.00% 35 19 0.00% 36 12 0.00% 37 23 0.00% 38 33 0.00% 39 40 0.00% 40 51 0.00% 41 34 0.00% 42 35 0.00% 43 37 0.00% 44 44 0.00% 45 39 0.00% 46 58 0.00% 47 66 0.00% 48 87 0.00% 49 100 0.00% 50 107 0.00% 51 124 0.00% 52 125 0.00% 53 157 0.00% 54 167 0.00% 55 220 0.00% 56 200 0.00% 57 240 0.00% 58 282 0.00% 59 326 0.00% 60 382 0.00% 61 415 0.00% 62 490 0.00% 63 541 0.00% 64 560 0.00% 65 657 0.00% 66 742 0.00% 67 858 0.00% 68 911 0.01% 69 1111 0.01% 70 1223 0.01% 71 1440 0.01% 72 1751 0.01% 73 1926 0.01% 74 2240 0.01% 75 2604 0.02% 76 2910 0.02% 77 3209 0.02% 78 3268 0.02% 79 3904 0.02% 80 4455 0.03% 81 4659 0.03% 82 5170 0.03% 83 5801 0.03% 84 6754 0.04% 85 7428 0.04% 86 8221 0.05% 87 8918 0.05% 88 9867 0.06% 89 10442 0.06% 90 11109 0.06% 91 12091 0.07% 92 13562 0.08% 93 14542 0.08% 94 15941 0.09% 95 17179 0.10% 96 18451 0.11% 97 19795 0.11% 98 21481 0.12% 99 23638 0.14% 100 28897 0.17% 101 30542 0.18% 102 24983 0.14% 103 26580 0.15% 104 28022 0.16% 105 29660 0.17% 106 31719 0.18% 107 32406 0.19% 108 34192 0.20% 109 35575 0.21% 110 36832 0.21% 111 38467 0.22% 112 40245 0.23% 113 41616 0.24% 114 44276 0.26% 115 46584 0.27% 116 48132 0.28% 117 49547 0.29% 118 50726 0.29% 119 52027 0.30% 120 54125 0.31% 121 55627 0.32% 122 58002 0.34% 123 60425 0.35% 124 62812 0.36% 125 65205 0.38% 126 67126 0.39% 127 69824 0.41% 128 71347 0.41% 129 74011 0.43% 130 77071 0.45% 131 78646 0.46% 132 82028 0.48% 133 85132 0.49% 134 88199 0.51% 135 93059 0.54% 136 97789 0.57% 137 101782 0.59% 138 106033 0.62% 139 113440 0.66% 140 120253 0.70% 141 130961 0.76% 142 142685 0.83% 143 157395 0.91% 144 179862 1.04% 145 215093 1.25% 146 263557 1.53% 147 353334 2.05% 148 514133 2.98% 149 989580 5.74% 150 4634840 26.89% 151 6949011 40.31% 17236892 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=26 prefix-density=0.38 prefix-fanout=2.6 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=57.90 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=35.06 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958200 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 15:52:58 Started mapping on | Dec 06 15:52:58 Finished on | Dec 06 15:54:30 Mapping speed, Million of reads per hour | 674.49 Number of input reads | 17236892 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16571387 Uniquely mapped reads % | 96.14% Average mapped length | 290.43 Number of splices: Total | 18086864 Number of splices: Annotated (sjdb) | 16971558 Number of splices: GT/AG | 17840865 Number of splices: GC/AG | 210937 Number of splices: AT/AC | 7663 Number of splices: Non-canonical | 27399 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257805 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 40142 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 1.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412835 412835 412835 N_multimapping 257805 257805 257805 N_noFeature 788784 16076576 982818 N_ambiguous 362397 2133 62773 UnstrandedReadsAssigned:15420206 PositiveStrandReadsAssigned:492678 NegativeStrandReadsAssigned:15525796 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958200 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958200-trimmed-pair1.fastq SRR6958200-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,236,892 reads, 15,601,951 reads pseudoaligned [quant] estimated average fragment length: 221.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR6958200.ke.tsv 35125 SRR6958200.se.tsv 88098 total ==> SRR6958200.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.238 0 0 PNS24247 1044 823.799 56.2336 6.85028 PNS24249 1928 1707.8 42.732 2.51102 PNS24246 1044 823.799 56.2336 6.85028 PNS24248 1044 823.799 56.2336 6.85028 PNS24244 1471 1250.8 20.5672 1.65014 PNS24243 293 103.827 0 0 KQK14069 1603 1382.8 2242.75 162.763 KQK14071 474 259.465 99.5737 38.5123 ==> SRR6958200.se.tsv <== BRADI_1g14170v3 2955 BRADI_1g53295v3 286 BRADI_1g59795v3 451 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 282 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 250 BRADI_1g48960v3 0 SRR6958200 completed mapping pipeline successfully