Starting /dee2/code/volunteer_pipeline.sh SRR6958201 current disk space = 1550492532736 free memory = 1601631832 SRR6958201 SRAfilesize 3b7f4aed4856422dc1299b4acc4191bd SRR6958201.sra SRR6958201.sra file validated SRR6958201 is paired end SRR6958201 is conventional basespace SRR6958201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.4865 25.0 18.0 32.0 18.0 33.0 2 23.0935 18.0 18.0 27.0 18.0 33.0 3 24.49475 27.0 18.0 29.0 18.0 31.0 4 25.25475 27.0 15.0 31.0 15.0 33.0 5 28.12075 29.0 27.0 31.0 15.0 33.0 6 35.3035 37.0 35.0 38.0 29.0 38.0 7 36.97575 38.0 37.0 38.0 35.0 38.0 8 37.327 38.0 38.0 38.0 36.0 38.0 9 37.477 38.0 38.0 38.0 37.0 38.0 10-14 37.487049999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.59905 38.0 38.0 38.0 38.0 38.0 20-24 37.571600000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.34115 38.0 38.0 38.0 37.2 38.0 30-34 37.60915 38.0 38.0 38.0 38.0 38.0 35-39 37.5439 38.0 38.0 38.0 37.8 38.0 40-44 37.2538 38.0 38.0 38.0 36.4 38.0 45-49 37.4174 38.0 38.0 38.0 37.4 38.0 50-54 37.315400000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.1702 38.0 38.0 38.0 36.4 38.0 60-64 37.29845 38.0 38.0 38.0 36.8 38.0 65-69 37.27575 38.0 38.0 38.0 36.4 38.0 70-74 37.0225 38.0 38.0 38.0 35.6 38.0 75-79 37.16315000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0652 38.0 38.0 38.0 36.0 38.0 85-89 36.94995 38.0 38.0 38.0 35.2 38.0 90-94 36.761 38.0 38.0 38.0 34.6 38.0 95-99 36.777849999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.6053 38.0 38.0 38.0 34.2 38.0 105-109 36.531400000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.3355 38.0 38.0 38.0 33.8 38.0 115-119 36.15350000000001 38.0 37.0 38.0 33.2 38.0 120-124 36.00945 38.0 37.0 38.0 33.2 38.0 125-129 35.77655 38.0 36.4 38.0 32.0 38.0 130-134 35.496599999999994 38.0 36.0 38.0 30.6 38.0 135-139 35.232749999999996 38.0 35.8 38.0 30.6 38.0 140-144 34.82305 38.0 34.4 38.0 29.0 38.0 145-149 33.812850000000005 38.0 33.0 38.0 24.2 38.0 150-151 29.62075 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 1.0 20 2.0 21 3.0 22 6.0 23 7.0 24 7.0 25 7.0 26 10.0 27 13.0 28 11.0 29 18.0 30 40.0 31 59.0 32 79.0 33 112.0 34 198.0 35 337.0 36 1137.0 37 1947.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.922918807810895 8.042137718396711 8.067831449126412 33.96711202466598 2 25.081270317579396 11.02775693923481 39.934983745936485 23.95598899724931 3 20.5 14.399999999999999 27.500000000000004 37.6 4 27.35 21.65 22.875 28.125 5 27.950000000000003 26.224999999999998 23.599999999999998 22.225 6 23.925 31.8 23.025000000000002 21.25 7 18.95 26.275 36.425000000000004 18.35 8 19.650000000000002 24.925 32.225 23.200000000000003 9 19.325 21.575 34.150000000000006 24.95 10-14 22.900000000000002 27.185 26.284999999999997 23.630000000000003 15-19 22.79 25.69 26.68 24.84 20-24 23.105 26.095000000000002 25.919999999999998 24.88 25-29 23.31 26.06 26.009999999999998 24.62 30-34 23.705000000000002 25.96 26.05 24.285 35-39 23.505000000000003 25.415 26.445 24.635 40-44 22.455 25.55 26.415 25.580000000000002 45-49 22.66 26.08 26.009999999999998 25.25 50-54 22.68 25.995 26.38 24.945 55-59 23.13 25.845000000000002 25.7 25.324999999999996 60-64 22.80614030701535 25.806290314515728 26.236311815590778 25.151257562878143 65-69 22.71113555677784 26.311315565778287 26.021301065053255 24.956247812390618 70-74 23.101155057752887 25.43627181359068 26.176308815440773 25.28626431321566 75-79 23.244999999999997 25.86 25.765 25.130000000000003 80-84 22.96 25.71 25.965 25.365 85-89 23.015 25.419999999999998 26.565 25.0 90-94 22.8 25.88 26.484999999999996 24.834999999999997 95-99 23.11 25.145 26.455000000000002 25.290000000000003 100-104 23.36116805840292 25.93629681484074 25.781289064453222 24.921246062303116 105-109 23.785 25.165 26.284999999999997 24.765 110-114 23.24835979365954 25.617268493013473 26.433615465518105 24.700756247808886 115-119 23.913369679387785 26.324213474716153 25.34387035462412 24.418546491271943 120-124 23.113089581353474 25.578952633421697 25.668984144450558 25.63897364077427 125-129 23.028359555065638 25.904399238400643 25.73905200921936 25.32818919731436 130-134 23.555021768503227 25.416604113496472 26.107191112445577 24.921183005554724 135-139 23.84 25.419999999999998 25.555 25.185000000000002 140-144 23.59 26.055 25.419999999999998 24.935 145-149 23.525 25.89 25.345000000000002 25.240000000000002 150-151 22.8875 26.6 25.0375 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 0.5 26 0.5 27 0.5 28 1.5 29 2.5 30 6.0 31 13.5 32 17.0 33 19.5 34 25.0 35 35.5 36 54.0 37 72.0 38 91.0 39 108.5 40 137.5 41 173.0 42 181.0 43 195.5 44 222.0 45 232.5 46 222.5 47 215.0 48 207.5 49 188.0 50 170.5 51 149.0 52 129.5 53 109.5 54 93.0 55 82.5 56 84.0 57 80.5 58 81.0 59 87.5 60 71.5 61 62.5 62 57.0 63 47.5 64 44.5 65 39.5 66 33.5 67 27.5 68 21.0 69 18.0 70 22.0 71 18.0 72 12.5 73 13.5 74 8.0 75 4.0 76 3.0 77 1.5 78 1.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.005 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.165 115-119 0.034999999999999996 120-124 0.034999999999999996 125-129 0.21 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATAT 10 0.006832588 144.9875 9 ATACATA 10 0.006832588 144.9875 8 >>END_MODULE SRR6958201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.123 33.0 33.0 34.0 32.0 34.0 2 33.27725 34.0 33.0 34.0 33.0 34.0 3 33.30575 34.0 33.0 34.0 33.0 34.0 4 33.35825 34.0 33.0 34.0 33.0 34.0 5 32.9105 34.0 33.0 34.0 32.0 34.0 6 37.4195 38.0 38.0 38.0 37.0 38.0 7 37.5485 38.0 38.0 38.0 38.0 38.0 8 37.5785 38.0 38.0 38.0 38.0 38.0 9 37.449 38.0 38.0 38.0 38.0 38.0 10-14 36.668400000000005 38.0 36.6 38.0 33.6 38.0 15-19 37.1571 38.0 37.8 38.0 36.0 38.0 20-24 37.55655 38.0 38.0 38.0 38.0 38.0 25-29 37.568400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.58755 38.0 38.0 38.0 38.0 38.0 35-39 37.5497 38.0 38.0 38.0 38.0 38.0 40-44 36.82665 38.0 37.8 38.0 34.2 38.0 45-49 37.1131 38.0 38.0 38.0 35.8 38.0 50-54 37.366699999999994 38.0 38.0 38.0 37.6 38.0 55-59 37.460699999999996 38.0 38.0 38.0 37.6 38.0 60-64 37.48225 38.0 38.0 38.0 38.0 38.0 65-69 37.4414 38.0 38.0 38.0 37.8 38.0 70-74 37.347899999999996 38.0 38.0 38.0 37.2 38.0 75-79 37.0049 38.0 38.0 38.0 36.0 38.0 80-84 36.47735 38.0 37.4 38.0 31.2 38.0 85-89 36.121300000000005 38.0 37.4 38.0 31.4 38.0 90-94 36.8635 38.0 37.8 38.0 35.6 38.0 95-99 37.144 38.0 38.0 38.0 36.0 38.0 100-104 37.09734999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.955799999999996 38.0 38.0 38.0 35.6 38.0 110-114 36.92445 38.0 38.0 38.0 35.6 38.0 115-119 36.832 38.0 38.0 38.0 35.0 38.0 120-124 36.8449 38.0 38.0 38.0 35.0 38.0 125-129 36.6907 38.0 38.0 38.0 34.6 38.0 130-134 36.505399999999995 38.0 38.0 38.0 34.2 38.0 135-139 33.38645 37.0 29.2 38.0 24.6 38.0 140-144 35.20995 38.0 35.8 38.0 30.4 38.0 145-149 34.4602 38.0 35.4 38.0 28.0 38.0 150-151 29.744625 35.5 18.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 3.0 19 0.0 20 1.0 21 0.0 22 2.0 23 7.0 24 2.0 25 7.0 26 6.0 27 12.0 28 17.0 29 22.0 30 33.0 31 40.0 32 41.0 33 73.0 34 125.0 35 268.0 36 764.0 37 2567.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.65 18.85 11.475 35.025 2 28.575 25.224999999999998 29.075 17.125 3 22.225 25.4 29.625 22.75 4 25.374999999999996 29.049999999999997 21.95 23.625 5 26.900000000000002 33.050000000000004 21.099999999999998 18.95 6 21.925 36.475 20.275000000000002 21.325 7 22.7 19.900000000000002 35.275 22.125 8 22.900000000000002 23.9 25.4 27.800000000000004 9 22.875 23.75 29.275000000000002 24.099999999999998 10-14 25.365 26.669999999999998 23.66 24.305 15-19 24.795 26.295 24.685000000000002 24.224999999999998 20-24 25.290000000000003 25.96 24.785 23.965 25-29 24.455 26.575 25.314999999999998 23.655 30-34 24.959999999999997 26.590000000000003 24.665 23.785 35-39 25.41 26.63 24.4 23.56 40-44 25.585 26.265 24.43 23.72 45-49 25.115 26.035000000000004 25.259999999999998 23.59 50-54 24.884999999999998 26.02 24.87 24.224999999999998 55-59 25.795 25.525 24.915000000000003 23.765 60-64 25.27 25.86 25.165 23.705000000000002 65-69 25.230000000000004 26.284999999999997 25.355 23.13 70-74 25.465 25.545 25.155 23.835 75-79 25.61 25.415 25.540000000000003 23.435 80-84 25.6 26.035000000000004 25.545 22.82 85-89 25.035 26.369999999999997 24.905 23.69 90-94 24.935 26.345000000000002 24.88 23.84 95-99 24.955 26.08 25.845000000000002 23.119999999999997 100-104 24.925 26.155 25.490000000000002 23.43 105-109 24.834999999999997 26.075 25.929999999999996 23.16 110-114 25.814999999999998 26.185000000000002 25.215 22.785 115-119 25.4 26.435 25.0 23.165 120-124 25.385 26.619999999999997 24.91 23.085 125-129 25.55 26.665 24.535 23.25 130-134 25.535000000000004 26.784999999999997 24.635 23.044999999999998 135-139 25.085 26.605 25.169999999999998 23.14 140-144 26.31 26.790000000000003 24.91 21.990000000000002 145-149 26.44 26.875 24.4 22.285 150-151 26.1625 27.125 24.825 21.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.0 25 1.5 26 1.0 27 2.5 28 3.5 29 3.0 30 5.5 31 8.0 32 13.0 33 20.0 34 25.5 35 28.5 36 41.5 37 70.0 38 86.0 39 107.0 40 131.0 41 143.0 42 176.5 43 206.5 44 207.5 45 202.5 46 201.5 47 208.5 48 204.0 49 177.5 50 154.0 51 135.0 52 134.0 53 127.5 54 102.5 55 101.0 56 93.0 57 89.5 58 93.0 59 92.0 60 91.5 61 75.5 62 73.0 63 70.0 64 48.5 65 39.0 66 39.0 67 32.0 68 31.5 69 30.0 70 20.5 71 15.0 72 12.5 73 7.0 74 4.5 75 4.0 76 1.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93724696356276 97.75 2 0.9109311740890688 1.7999999999999998 3 0.15182186234817813 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.3375 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGCG 10 0.006830828 145.0 8 GATATAT 10 0.006830828 145.0 5 ATGGATA 10 0.006830828 145.0 2 TGTGGCA 10 0.006830828 145.0 8 >>END_MODULE Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845824 spots for SRR6958201.sra Written 845824 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra Read 845818 spots for SRR6958201.sra Written 845818 spots for SRR6958201.sra SRR ids: ['SRR6958201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0htt3xf4 SRR6958201.sra spots: 16916366 blocks: [[1, 845818], [845819, 1691636], [1691637, 2537454], [2537455, 3383272], [3383273, 4229090], [4229091, 5074908], [5074909, 5920726], [5920727, 6766544], [6766545, 7612362], [7612363, 8458180], [8458181, 9303998], [9303999, 10149816], [10149817, 10995634], [10995635, 11841452], [11841453, 12687270], [12687271, 13533088], [13533089, 14378906], [14378907, 15224724], [15224725, 16070542], [16070543, 16916366]] SRR6958201 file size 5710700 SRR6958201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958201 SRR6958201_1.fastq SRR6958201_2.fastq Input file: SRR6958201_1.fastq Paired file: SRR6958201_2.fastq trimmed: SRR6958201-trimmed-pair1.fastq, SRR6958201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:59:40 2024 >> started Fri Dec 6 15:59:58 2024 >> done (17.883s) 16916366 read pairs processed; of these: 7508 ( 0.04%) short read pairs filtered out after trimming by size control 5816 ( 0.03%) empty read pairs filtered out after trimming by size control 16903042 (99.92%) read pairs available; of these: 6184444 (36.59%) trimmed read pairs available after processing 10718598 (63.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 8 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 1 0.00% 36 10 0.00% 37 4 0.00% 38 9 0.00% 39 8 0.00% 40 10 0.00% 41 16 0.00% 42 10 0.00% 43 18 0.00% 44 10 0.00% 45 12 0.00% 46 16 0.00% 47 13 0.00% 48 26 0.00% 49 30 0.00% 50 31 0.00% 51 32 0.00% 52 30 0.00% 53 36 0.00% 54 48 0.00% 55 45 0.00% 56 53 0.00% 57 47 0.00% 58 64 0.00% 59 79 0.00% 60 82 0.00% 61 114 0.00% 62 122 0.00% 63 126 0.00% 64 130 0.00% 65 175 0.00% 66 172 0.00% 67 157 0.00% 68 229 0.00% 69 242 0.00% 70 273 0.00% 71 337 0.00% 72 362 0.00% 73 407 0.00% 74 501 0.00% 75 575 0.00% 76 645 0.00% 77 747 0.00% 78 797 0.00% 79 910 0.01% 80 961 0.01% 81 1127 0.01% 82 1294 0.01% 83 1485 0.01% 84 1827 0.01% 85 2139 0.01% 86 2442 0.01% 87 2685 0.02% 88 2915 0.02% 89 3091 0.02% 90 3398 0.02% 91 3636 0.02% 92 3856 0.02% 93 4352 0.03% 94 4622 0.03% 95 5181 0.03% 96 5588 0.03% 97 6048 0.04% 98 6227 0.04% 99 6726 0.04% 100 7357 0.04% 101 7757 0.05% 102 8314 0.05% 103 8892 0.05% 104 9340 0.06% 105 9850 0.06% 106 10825 0.06% 107 11499 0.07% 108 12286 0.07% 109 12972 0.08% 110 13508 0.08% 111 14363 0.08% 112 15070 0.09% 113 15598 0.09% 114 16732 0.10% 115 17893 0.11% 116 18640 0.11% 117 19683 0.12% 118 20575 0.12% 119 21297 0.13% 120 22151 0.13% 121 23201 0.14% 122 24099 0.14% 123 25451 0.15% 124 26273 0.16% 125 28224 0.17% 126 29343 0.17% 127 30346 0.18% 128 31728 0.19% 129 33674 0.20% 130 35725 0.21% 131 36788 0.22% 132 38363 0.23% 133 40903 0.24% 134 42577 0.25% 135 44765 0.26% 136 47083 0.28% 137 50235 0.30% 138 52039 0.31% 139 56288 0.33% 140 59948 0.35% 141 65236 0.39% 142 71371 0.42% 143 78945 0.47% 144 89656 0.53% 145 105130 0.62% 146 128932 0.76% 147 174378 1.03% 148 265298 1.57% 149 545658 3.23% 150 3530757 20.89% 151 10718598 63.41% 16903042 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=0.73 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=52.24 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=20 prefix-density=0.78 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=25.31 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958201 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:00:47 Started mapping on | Dec 06 16:00:47 Finished on | Dec 06 16:02:17 Mapping speed, Million of reads per hour | 676.12 Number of input reads | 16903042 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16614501 Uniquely mapped reads % | 98.29% Average mapped length | 297.06 Number of splices: Total | 19033599 Number of splices: Annotated (sjdb) | 17955035 Number of splices: GT/AG | 18797613 Number of splices: GC/AG | 217248 Number of splices: AT/AC | 6841 Number of splices: Non-canonical | 11897 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 93809 % of reads mapped to multiple loci | 0.55% Number of reads mapped to too many loci | 7240 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 197988 197988 197988 N_multimapping 93809 93809 93809 N_noFeature 539054 16104511 687010 N_ambiguous 420718 2060 59891 UnstrandedReadsAssigned:15654729 PositiveStrandReadsAssigned:507930 NegativeStrandReadsAssigned:15867600 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958201-trimmed-pair1.fastq SRR6958201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,903,042 reads, 15,866,952 reads pseudoaligned [quant] estimated average fragment length: 237.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6958201.ke.tsv 35125 SRR6958201.se.tsv 88098 total ==> SRR6958201.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.785 0 0 PNS24247 1044 807.518 49.4807 5.73704 PNS24249 1928 1691.52 23.1655 1.28224 PNS24246 1044 807.518 49.4807 5.73704 PNS24248 1044 807.518 49.4807 5.73704 PNS24244 1471 1234.52 32.3923 2.45668 PNS24243 293 88.8318 0 0 KQK14069 1603 1366.52 6000.77 411.146 KQK14071 474 243.216 67.7521 26.0816 ==> SRR6958201.se.tsv <== BRADI_1g14170v3 6693 BRADI_1g53295v3 185 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 226 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 188 BRADI_1g48960v3 0 SRR6958201 completed mapping pipeline successfully