Starting /dee2/code/volunteer_pipeline.sh SRR6958202 current disk space = 1550510858240 free memory = 1604041200 SRR6958202 SRAfilesize 94a34c55548a9c2682461aee7075f09e SRR6958202.sra SRR6958202.sra file validated SRR6958202 is paired end SRR6958202 is conventional basespace SRR6958202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.7665 31.0 18.0 33.0 18.0 34.0 2 31.03375 33.0 29.0 33.0 27.0 34.0 3 32.18225 33.0 31.0 34.0 29.0 34.0 4 32.445 33.0 33.0 33.0 31.0 34.0 5 32.90575 33.0 33.0 34.0 31.0 34.0 6 36.99825 38.0 37.0 38.0 36.0 38.0 7 37.457 38.0 38.0 38.0 37.0 38.0 8 37.57375 38.0 38.0 38.0 37.0 38.0 9 37.615 38.0 38.0 38.0 38.0 38.0 10-14 37.6327 38.0 38.0 38.0 38.0 38.0 15-19 37.67125 38.0 38.0 38.0 38.0 38.0 20-24 37.587399999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.4077 38.0 38.0 38.0 37.4 38.0 30-34 37.63805 38.0 38.0 38.0 38.0 38.0 35-39 37.5494 38.0 38.0 38.0 37.8 38.0 40-44 37.35375 38.0 38.0 38.0 37.2 38.0 45-49 37.474900000000005 38.0 38.0 38.0 37.6 38.0 50-54 37.3976 38.0 38.0 38.0 37.0 38.0 55-59 37.30475 38.0 38.0 38.0 36.6 38.0 60-64 37.3376 38.0 38.0 38.0 37.0 38.0 65-69 37.33395 38.0 38.0 38.0 37.0 38.0 70-74 37.1033 38.0 38.0 38.0 36.0 38.0 75-79 37.20695 38.0 38.0 38.0 36.2 38.0 80-84 37.066700000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.025800000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.83655 38.0 38.0 38.0 35.0 38.0 95-99 36.8926 38.0 38.0 38.0 35.0 38.0 100-104 36.681450000000005 38.0 38.0 38.0 34.4 38.0 105-109 36.55555 38.0 38.0 38.0 34.0 38.0 110-114 36.3596 38.0 37.8 38.0 34.0 38.0 115-119 36.2144 38.0 37.0 38.0 33.6 38.0 120-124 36.1152 38.0 37.2 38.0 33.2 38.0 125-129 35.845400000000005 38.0 36.8 38.0 32.4 38.0 130-134 35.5758 38.0 35.8 38.0 31.0 38.0 135-139 35.431850000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.92655 38.0 35.2 38.0 29.2 38.0 145-149 33.8562 38.0 33.0 38.0 24.2 38.0 150-151 29.58625 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 4.0 21 1.0 22 4.0 23 4.0 24 1.0 25 4.0 26 8.0 27 17.0 28 17.0 29 28.0 30 36.0 31 37.0 32 79.0 33 92.0 34 155.0 35 297.0 36 776.0 37 2435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.906639004149376 13.381742738589212 9.439834024896266 42.27178423236514 2 21.655413853463365 13.328332083020754 37.009252313078264 28.00700175043761 3 19.775000000000002 15.85 24.474999999999998 39.900000000000006 4 23.35 26.35 22.6 27.700000000000003 5 23.95 29.225 25.825 21.0 6 21.875 34.225 24.325 19.575 7 17.45 24.425 39.6 18.525 8 19.45 24.224999999999998 30.925000000000004 25.4 9 19.2 22.875 34.425 23.5 10-14 21.805 27.16 26.645000000000003 24.39 15-19 21.865000000000002 26.575 27.125 24.435000000000002 20-24 21.711085554277716 26.181309065453274 27.211360568028404 24.89624481224061 25-29 22.009999999999998 26.200000000000003 27.139999999999997 24.65 30-34 22.1 26.455000000000002 26.52 24.925 35-39 21.834999999999997 26.889999999999997 26.5 24.775 40-44 22.085 26.83 26.71 24.375 45-49 21.88 26.5 26.595000000000002 25.025 50-54 21.884999999999998 26.395000000000003 26.515 25.205 55-59 21.975 26.39 27.105 24.529999999999998 60-64 21.91609580479024 26.89134456722836 26.70133506675334 24.491224561228062 65-69 21.512151215121513 26.31763176317632 27.29272927292729 24.877487748774875 70-74 21.895473868467118 26.451612903225808 27.186796699174792 24.466116529132282 75-79 21.935 26.525 26.729999999999997 24.81 80-84 21.82 26.674999999999997 26.615 24.89 85-89 22.435 26.665 26.645000000000003 24.255 90-94 22.655 26.724999999999998 26.224999999999998 24.395 95-99 21.98 26.205000000000002 27.08 24.735 100-104 21.88875550220088 26.775710284113647 26.72569027611044 24.60984393757503 105-109 22.27 25.924999999999997 27.495000000000005 24.310000000000002 110-114 22.07629455110532 26.402325931124366 26.998847060003005 24.52253245776731 115-119 23.117338003502628 26.449837378033525 26.389792344258193 24.043032274205654 120-124 22.606303151575787 26.413206603301653 26.008004002001 24.972486243121562 125-129 22.7776385058912 26.30734519929807 26.21709701679619 24.697919278014542 130-134 22.39627646263951 26.169861368299884 26.600270256743908 24.833591912316702 135-139 22.465 26.240000000000002 26.384999999999998 24.91 140-144 22.75 26.045 26.38 24.825 145-149 23.1 26.040000000000003 25.81 25.05 150-151 22.25 26.125 26.400000000000002 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 2.0 26 4.5 27 4.0 28 3.5 29 7.0 30 9.5 31 14.0 32 19.5 33 23.5 34 33.5 35 43.5 36 60.5 37 79.5 38 92.5 39 118.0 40 157.0 41 191.0 42 200.0 43 218.5 44 249.5 45 243.0 46 234.5 47 232.5 48 202.0 49 184.0 50 176.0 51 162.0 52 136.0 53 119.5 54 113.0 55 92.0 56 80.0 57 68.5 58 61.5 59 54.0 60 46.0 61 38.0 62 27.5 63 26.0 64 29.0 65 26.5 66 19.5 67 21.0 68 21.0 69 12.5 70 8.5 71 8.0 72 6.0 73 6.0 74 4.5 75 3.0 76 3.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.01 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.255 115-119 0.075 120-124 0.05 125-129 0.27499999999999997 130-134 0.095 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.9749999999999996 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGACTC 10 0.0063298983 148.6923 1 GAAACCG 10 0.0068343505 144.975 8 TCCATAG 10 0.0068343505 144.975 2 >>END_MODULE SRR6958202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.095 33.0 33.0 34.0 32.0 34.0 2 33.27975 34.0 33.0 34.0 33.0 34.0 3 33.2755 34.0 33.0 34.0 33.0 34.0 4 33.32275 34.0 33.0 34.0 33.0 34.0 5 33.0615 34.0 33.0 34.0 32.0 34.0 6 37.401 38.0 38.0 38.0 37.0 38.0 7 37.573 38.0 38.0 38.0 38.0 38.0 8 37.53325 38.0 38.0 38.0 38.0 38.0 9 37.4585 38.0 38.0 38.0 38.0 38.0 10-14 36.72265 38.0 36.6 38.0 33.6 38.0 15-19 37.08685 38.0 37.8 38.0 36.0 38.0 20-24 37.5035 38.0 38.0 38.0 38.0 38.0 25-29 37.53725 38.0 38.0 38.0 38.0 38.0 30-34 37.5322 38.0 38.0 38.0 38.0 38.0 35-39 37.496249999999996 38.0 38.0 38.0 38.0 38.0 40-44 36.792049999999996 38.0 37.8 38.0 34.4 38.0 45-49 37.10785 38.0 38.0 38.0 36.2 38.0 50-54 37.382999999999996 38.0 38.0 38.0 37.8 38.0 55-59 37.4251 38.0 38.0 38.0 37.8 38.0 60-64 37.42345 38.0 38.0 38.0 38.0 38.0 65-69 37.42425000000001 38.0 38.0 38.0 38.0 38.0 70-74 37.30075000000001 38.0 38.0 38.0 37.0 38.0 75-79 36.91815 38.0 38.0 38.0 35.2 38.0 80-84 36.455400000000004 38.0 37.4 38.0 31.2 38.0 85-89 36.1229 38.0 37.4 38.0 31.0 38.0 90-94 36.80714999999999 38.0 38.0 38.0 35.2 38.0 95-99 37.19155 38.0 38.0 38.0 36.8 38.0 100-104 37.03489999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.912 38.0 38.0 38.0 36.0 38.0 110-114 36.98695 38.0 38.0 38.0 35.8 38.0 115-119 36.891099999999994 38.0 38.0 38.0 35.2 38.0 120-124 36.841899999999995 38.0 38.0 38.0 35.2 38.0 125-129 36.730000000000004 38.0 38.0 38.0 35.0 38.0 130-134 36.5535 38.0 38.0 38.0 34.8 38.0 135-139 33.80649999999999 37.4 31.6 38.0 25.6 38.0 140-144 35.3666 38.0 36.4 38.0 30.4 38.0 145-149 34.7436 38.0 36.0 38.0 29.8 38.0 150-151 30.537625 35.5 28.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 3.0 18 0.0 19 2.0 20 2.0 21 3.0 22 6.0 23 4.0 24 3.0 25 7.0 26 4.0 27 13.0 28 15.0 29 29.0 30 25.0 31 39.0 32 41.0 33 87.0 34 109.0 35 235.0 36 660.0 37 2704.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.175 17.549999999999997 13.4 34.875 2 28.725 23.025000000000002 30.675 17.575 3 21.65 26.6 28.499999999999996 23.25 4 24.575 32.05 22.125 21.25 5 26.775 32.875 21.95 18.4 6 21.4 37.9 21.175 19.525000000000002 7 21.875 20.825 36.05 21.25 8 24.275 23.3 26.275 26.150000000000002 9 24.3 22.625 29.675 23.400000000000002 10-14 24.75 27.750000000000004 24.455 23.044999999999998 15-19 24.925 26.325 25.45 23.3 20-24 24.795 26.6 25.635 22.97 25-29 25.195 25.83 25.72 23.255 30-34 24.959999999999997 26.790000000000003 25.580000000000002 22.67 35-39 24.095 26.3 26.08 23.525 40-44 24.91 25.89 25.775 23.425 45-49 23.895 26.290000000000003 26.534999999999997 23.28 50-54 24.875 26.400000000000002 25.75 22.975 55-59 25.595000000000002 26.200000000000003 25.564999999999998 22.64 60-64 24.985 26.55 25.645 22.82 65-69 24.945 26.72 25.779999999999998 22.555 70-74 25.474999999999998 26.895000000000003 25.81 21.82 75-79 25.22 26.605 26.119999999999997 22.055 80-84 24.3 26.695 26.27 22.735 85-89 25.080000000000002 26.655 26.090000000000003 22.175 90-94 24.775 26.245 26.479999999999997 22.5 95-99 24.46 26.634999999999998 26.02 22.884999999999998 100-104 25.245 26.340000000000003 26.279999999999998 22.134999999999998 105-109 24.665 26.495 25.924999999999997 22.915 110-114 24.975 26.945000000000004 25.729999999999997 22.35 115-119 25.174999999999997 26.765 26.064999999999998 21.995 120-124 25.36 26.840000000000003 26.314999999999998 21.485000000000003 125-129 25.21 27.189999999999998 25.974999999999998 21.625 130-134 25.155 27.12 25.86 21.865000000000002 135-139 25.245 27.105 25.945 21.705 140-144 25.445 26.99 25.865 21.7 145-149 25.569999999999997 26.83 25.745 21.855 150-151 24.6875 27.6 25.95 21.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.5 27 4.0 28 6.5 29 9.0 30 10.5 31 10.0 32 17.5 33 25.5 34 32.0 35 46.5 36 59.0 37 73.5 38 91.0 39 113.5 40 151.0 41 171.5 42 188.0 43 211.5 44 222.5 45 224.5 46 213.0 47 200.5 48 202.0 49 195.0 50 163.5 51 143.0 52 139.0 53 130.0 54 109.5 55 92.5 56 86.0 57 79.0 58 73.5 59 64.0 60 55.5 61 58.5 62 50.0 63 40.5 64 37.5 65 36.0 66 35.0 67 28.0 68 23.0 69 18.0 70 14.5 71 14.0 72 9.5 73 6.5 74 6.0 75 2.5 76 1.0 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTCGC 10 0.006830828 145.0 2 GATTCTT 10 0.006830828 145.0 5 >>END_MODULE Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768378 spots for SRR6958202.sra Written 768378 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra Read 768376 spots for SRR6958202.sra Written 768376 spots for SRR6958202.sra SRR ids: ['SRR6958202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1gdm7l86 SRR6958202.sra spots: 15367522 blocks: [[1, 768376], [768377, 1536752], [1536753, 2305128], [2305129, 3073504], [3073505, 3841880], [3841881, 4610256], [4610257, 5378632], [5378633, 6147008], [6147009, 6915384], [6915385, 7683760], [7683761, 8452136], [8452137, 9220512], [9220513, 9988888], [9988889, 10757264], [10757265, 11525640], [11525641, 12294016], [12294017, 13062392], [13062393, 13830768], [13830769, 14599144], [14599145, 15367522]] SRR6958202 file size 5185848 SRR6958202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958202 SRR6958202_1.fastq SRR6958202_2.fastq Input file: SRR6958202_1.fastq Paired file: SRR6958202_2.fastq trimmed: SRR6958202-trimmed-pair1.fastq, SRR6958202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 15:59:14 2024 >> started Fri Dec 6 15:59:29 2024 >> done (15.164s) 15367522 read pairs processed; of these: 8375 ( 0.05%) short read pairs filtered out after trimming by size control 6699 ( 0.04%) empty read pairs filtered out after trimming by size control 15352448 (99.90%) read pairs available; of these: 4928642 (32.10%) trimmed read pairs available after processing 10423806 (67.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 5 0.00% 25 0 0.00% 26 3 0.00% 27 0 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 1 0.00% 32 3 0.00% 33 2 0.00% 34 5 0.00% 35 2 0.00% 36 2 0.00% 37 4 0.00% 38 3 0.00% 39 5 0.00% 40 1 0.00% 41 4 0.00% 42 5 0.00% 43 10 0.00% 44 6 0.00% 45 9 0.00% 46 5 0.00% 47 13 0.00% 48 6 0.00% 49 10 0.00% 50 14 0.00% 51 13 0.00% 52 9 0.00% 53 28 0.00% 54 11 0.00% 55 17 0.00% 56 20 0.00% 57 27 0.00% 58 30 0.00% 59 34 0.00% 60 36 0.00% 61 45 0.00% 62 42 0.00% 63 47 0.00% 64 62 0.00% 65 67 0.00% 66 75 0.00% 67 75 0.00% 68 89 0.00% 69 103 0.00% 70 117 0.00% 71 125 0.00% 72 167 0.00% 73 162 0.00% 74 206 0.00% 75 248 0.00% 76 294 0.00% 77 346 0.00% 78 339 0.00% 79 433 0.00% 80 479 0.00% 81 509 0.00% 82 573 0.00% 83 654 0.00% 84 986 0.01% 85 1197 0.01% 86 1224 0.01% 87 1367 0.01% 88 1458 0.01% 89 1481 0.01% 90 1657 0.01% 91 1827 0.01% 92 2027 0.01% 93 2114 0.01% 94 2337 0.02% 95 2583 0.02% 96 2730 0.02% 97 2959 0.02% 98 3123 0.02% 99 3486 0.02% 100 3740 0.02% 101 4036 0.03% 102 4396 0.03% 103 4487 0.03% 104 5002 0.03% 105 5247 0.03% 106 5664 0.04% 107 6013 0.04% 108 6432 0.04% 109 6700 0.04% 110 7103 0.05% 111 7390 0.05% 112 8003 0.05% 113 8640 0.06% 114 9109 0.06% 115 9614 0.06% 116 10186 0.07% 117 10830 0.07% 118 11363 0.07% 119 11716 0.08% 120 12408 0.08% 121 13055 0.09% 122 13778 0.09% 123 14722 0.10% 124 15329 0.10% 125 16501 0.11% 126 17269 0.11% 127 17872 0.12% 128 18646 0.12% 129 19852 0.13% 130 21151 0.14% 131 21903 0.14% 132 22749 0.15% 133 24591 0.16% 134 25653 0.17% 135 27419 0.18% 136 29737 0.19% 137 31605 0.21% 138 33064 0.22% 139 36186 0.24% 140 38920 0.25% 141 42547 0.28% 142 47430 0.31% 143 53011 0.35% 144 61946 0.40% 145 74403 0.48% 146 93626 0.61% 147 127906 0.83% 148 202004 1.32% 149 433014 2.82% 150 3136494 20.43% 151 10423806 67.90% 15352448 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=5.57 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=3.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=151.69 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=22.1 sequence=CTTCTTCAGCTTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=24 prefix-density=0.30 prefix-fanout=3.2 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=68.43 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.9 sequence=TCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGAAGAGGCTAACTGGGGACTCGACATTGTAACTACCCGGCAATCAGTAGCAGCTGCACGGTCCAAGGGGATGACTGTTCGAGCAATGGTGATTATTAATCCTGGAAACCCCACTGGCCAATGCCTAAGTGAAGCAAATATCAGGGAACTTCTGAATTTTTGTTATCAGGAAAACTTAGTTCTGCTTGCAGA SRR6958202 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:00:18 Started mapping on | Dec 06 16:00:19 Finished on | Dec 06 16:01:34 Mapping speed, Million of reads per hour | 736.92 Number of input reads | 15352448 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15130322 Uniquely mapped reads % | 98.55% Average mapped length | 298.64 Number of splices: Total | 18539314 Number of splices: Annotated (sjdb) | 17536376 Number of splices: GT/AG | 18308137 Number of splices: GC/AG | 209524 Number of splices: AT/AC | 7613 Number of splices: Non-canonical | 14040 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 116924 % of reads mapped to multiple loci | 0.76% Number of reads mapped to too many loci | 4026 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 108522 108522 108522 N_multimapping 116924 116924 116924 N_noFeature 616692 14752206 723423 N_ambiguous 321640 1574 51149 UnstrandedReadsAssigned:14191990 PositiveStrandReadsAssigned:376542 NegativeStrandReadsAssigned:14355750 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958202-trimmed-pair1.fastq SRR6958202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,352,448 reads, 14,388,848 reads pseudoaligned [quant] estimated average fragment length: 257.749 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6958202.ke.tsv 35125 SRR6958202.se.tsv 88098 total ==> SRR6958202.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.679 0 0 PNS24247 1044 787.251 45.7094 6.27597 PNS24249 1928 1671.25 24.1527 1.56211 PNS24246 1044 787.251 45.7094 6.27597 PNS24248 1044 787.251 45.7094 6.27597 PNS24244 1471 1214.25 13.7191 1.22126 PNS24243 293 78.9025 0 0 KQK14069 1603 1346.25 1781.56 143.042 KQK14071 474 224.553 42.8659 20.6339 ==> SRR6958202.se.tsv <== BRADI_1g14170v3 2123 BRADI_1g53295v3 387 BRADI_1g59795v3 341 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 324 BRADI_1g74790v3 116 BRADI_1g09890v3 0 BRADI_1g77505v3 243 BRADI_1g48960v3 0 SRR6958202 completed mapping pipeline successfully