Starting /dee2/code/volunteer_pipeline.sh SRR6958203 current disk space = 1550495424512 free memory = 1603375748 SRR6958203 SRAfilesize 6bb1c5618d4fd7a14ecfc7ebd04a184d SRR6958203.sra SRR6958203.sra file validated SRR6958203 is paired end SRR6958203 is conventional basespace SRR6958203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.965 18.0 18.0 18.0 18.0 32.0 2 20.73175 18.0 18.0 25.0 18.0 30.0 3 26.42575 27.0 25.0 29.0 18.0 31.0 4 28.838 32.0 27.0 32.0 25.0 33.0 5 30.3095 32.0 31.0 33.0 25.0 33.0 6 33.217 37.0 31.0 38.0 16.0 38.0 7 36.3495 38.0 36.0 38.0 31.0 38.0 8 36.8245 38.0 37.0 38.0 35.0 38.0 9 37.37825 38.0 38.0 38.0 37.0 38.0 10-14 37.411750000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.39275 38.0 38.0 38.0 37.2 38.0 20-24 37.30499999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.147149999999996 38.0 38.0 38.0 36.4 38.0 30-34 37.13955 38.0 38.0 38.0 36.0 38.0 35-39 37.1357 38.0 38.0 38.0 36.0 38.0 40-44 37.4724 38.0 38.0 38.0 37.4 38.0 45-49 37.453250000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.27759999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.22255 38.0 38.0 38.0 36.6 38.0 60-64 37.325450000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.66135 38.0 37.4 38.0 34.0 38.0 70-74 37.244099999999996 38.0 38.0 38.0 36.4 38.0 75-79 37.2001 38.0 38.0 38.0 36.4 38.0 80-84 37.1881 38.0 38.0 38.0 36.2 38.0 85-89 36.950100000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.52165 38.0 38.0 38.0 34.0 38.0 95-99 34.87075 38.0 35.2 38.0 25.0 38.0 100-104 36.03125 38.0 37.2 38.0 32.2 38.0 105-109 35.9277 38.0 37.2 38.0 31.8 38.0 110-114 35.9222 38.0 37.0 38.0 32.2 38.0 115-119 36.3442 38.0 37.8 38.0 33.8 38.0 120-124 36.4904 38.0 38.0 38.0 34.0 38.0 125-129 36.429950000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.1977 38.0 37.6 38.0 33.4 38.0 135-139 35.74685000000001 38.0 36.0 38.0 32.2 38.0 140-144 35.4667 38.0 36.0 38.0 31.4 38.0 145-149 32.03995 36.2 27.8 38.0 21.8 38.0 150-151 29.484125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 0.0 19 1.0 20 4.0 21 1.0 22 2.0 23 0.0 24 2.0 25 9.0 26 14.0 27 24.0 28 25.0 29 40.0 30 47.0 31 67.0 32 98.0 33 148.0 34 218.0 35 392.0 36 1079.0 37 1826.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.51185344827586 18.80387931034483 8.432112068965516 47.252155172413794 2 16.85 19.25 28.775000000000002 35.125 3 22.35 16.875 23.45 37.325 4 27.525 25.224999999999998 21.375 25.874999999999996 5 27.325 27.400000000000002 22.875 22.400000000000002 6 20.925 32.324999999999996 22.7 24.05 7 16.675 25.3 39.7 18.325 8 19.650000000000002 23.775 30.225 26.35 9 19.8 22.15 33.25 24.8 10-14 21.955 27.845 25.655 24.545 15-19 22.985 25.650000000000002 26.005 25.36 20-24 22.884999999999998 25.19 26.284999999999997 25.64 25-29 22.025 26.735 25.485000000000003 25.755 30-34 22.75 26.07 26.185000000000002 24.995 35-39 22.525000000000002 25.965 25.94 25.569999999999997 40-44 22.869999999999997 25.655 26.125 25.35 45-49 22.869999999999997 25.525 26.119999999999997 25.485000000000003 50-54 22.665 25.535000000000004 25.990000000000002 25.81 55-59 22.64 25.345000000000002 25.924999999999997 26.090000000000003 60-64 23.195 25.569999999999997 25.979999999999997 25.255 65-69 23.185 25.074999999999996 26.135 25.605 70-74 23.255 25.314999999999998 26.045 25.385 75-79 23.105 25.485000000000003 25.865 25.545 80-84 22.770000000000003 25.395 25.724999999999998 26.11 85-89 23.74 25.28 25.580000000000002 25.4 90-94 23.21 25.36 25.915 25.515 95-99 22.89 25.569999999999997 25.779999999999998 25.759999999999998 100-104 23.35 25.41 25.174999999999997 26.064999999999998 105-109 22.41 25.624999999999996 25.759999999999998 26.205000000000002 110-114 23.275000000000002 25.485000000000003 25.45 25.790000000000003 115-119 23.494999999999997 25.779999999999998 25.669999999999998 25.055 120-124 23.455000000000002 25.619999999999997 25.22 25.705 125-129 23.23 25.295 25.395 26.08 130-134 23.735 25.525 25.005 25.735000000000003 135-139 23.685000000000002 24.795 25.85 25.669999999999998 140-144 23.044999999999998 25.419999999999998 25.455 26.08 145-149 23.25 25.255 25.745 25.75 150-151 24.05 25.7125 25.362499999999997 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.5 28 2.5 29 2.5 30 7.0 31 8.5 32 12.0 33 17.0 34 20.0 35 32.0 36 48.5 37 57.5 38 73.0 39 105.0 40 139.0 41 167.5 42 183.0 43 191.0 44 216.0 45 234.0 46 231.0 47 213.5 48 198.0 49 189.5 50 172.0 51 163.0 52 144.5 53 118.5 54 97.0 55 92.0 56 89.5 57 87.5 58 88.0 59 71.5 60 69.0 61 66.0 62 51.0 63 45.0 64 42.0 65 46.0 66 43.5 67 32.5 68 29.5 69 25.5 70 19.0 71 13.5 72 12.5 73 10.5 74 6.0 75 5.0 76 4.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.199999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93805309734513 97.82499999999999 2 0.9860935524652339 1.95 3 0.07585335018963338 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.775 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.2625 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82925 33.0 33.0 34.0 32.0 34.0 2 33.012 34.0 33.0 34.0 32.0 34.0 3 32.94875 34.0 33.0 34.0 32.0 34.0 4 32.79425 34.0 33.0 34.0 32.0 34.0 5 32.88425 34.0 33.0 34.0 32.0 34.0 6 37.0835 38.0 38.0 38.0 36.0 38.0 7 37.01175 38.0 38.0 38.0 36.0 38.0 8 37.031 38.0 38.0 38.0 36.0 38.0 9 36.974 38.0 38.0 38.0 36.0 38.0 10-14 36.840149999999994 38.0 38.0 38.0 35.6 38.0 15-19 36.55715 38.0 38.0 38.0 34.6 38.0 20-24 36.697500000000005 38.0 38.0 38.0 35.0 38.0 25-29 36.912099999999995 38.0 38.0 38.0 36.2 38.0 30-34 37.02675000000001 38.0 38.0 38.0 36.4 38.0 35-39 37.11130000000001 38.0 38.0 38.0 37.0 38.0 40-44 35.418150000000004 38.0 35.4 38.0 29.6 38.0 45-49 36.761199999999995 38.0 38.0 38.0 35.4 38.0 50-54 36.3328 38.0 38.0 38.0 33.2 38.0 55-59 36.66355 38.0 38.0 38.0 34.8 38.0 60-64 36.6267 38.0 38.0 38.0 34.8 38.0 65-69 36.58825 38.0 38.0 38.0 34.6 38.0 70-74 36.396100000000004 38.0 38.0 38.0 33.8 38.0 75-79 36.1486 38.0 38.0 38.0 32.8 38.0 80-84 36.2147 38.0 38.0 38.0 33.6 38.0 85-89 35.9496 38.0 38.0 38.0 32.6 38.0 90-94 36.239599999999996 38.0 38.0 38.0 33.8 38.0 95-99 36.35415 38.0 38.0 38.0 34.0 38.0 100-104 36.21465 38.0 38.0 38.0 33.8 38.0 105-109 36.3663 38.0 38.0 38.0 34.0 38.0 110-114 36.1151 38.0 38.0 38.0 33.6 38.0 115-119 35.7844 38.0 37.4 38.0 32.2 38.0 120-124 34.69845 38.0 35.6 38.0 25.0 38.0 125-129 33.150999999999996 37.2 31.8 38.0 20.8 38.0 130-134 32.01675 36.2 28.8 38.0 19.0 38.0 135-139 34.7333 38.0 35.2 38.0 28.2 38.0 140-144 34.1153 38.0 34.2 38.0 24.2 38.0 145-149 33.867399999999996 38.0 34.6 38.0 23.4 38.0 150-151 28.823625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 1.0 6 2.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 3.0 14 1.0 15 2.0 16 1.0 17 5.0 18 4.0 19 4.0 20 6.0 21 9.0 22 7.0 23 12.0 24 17.0 25 28.0 26 29.0 27 22.0 28 40.0 29 62.0 30 58.0 31 77.0 32 119.0 33 118.0 34 174.0 35 323.0 36 740.0 37 2121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 18.7 13.0 31.974999999999998 2 29.15 24.349999999999998 25.775 20.724999999999998 3 22.725 26.75 27.700000000000003 22.825 4 26.474999999999998 30.85 20.075000000000003 22.6 5 28.925 30.4 20.1 20.575 6 23.9 35.8 19.625 20.674999999999997 7 22.725 19.45 35.4 22.425 8 25.324999999999996 23.625 23.025000000000002 28.025 9 23.05 23.925 27.525 25.5 10-14 26.490000000000002 26.035000000000004 23.1 24.375 15-19 25.330000000000002 25.795 24.295 24.58 20-24 26.02 25.445 25.014999999999997 23.52 25-29 25.580000000000002 25.81 24.755 23.855 30-34 25.619999999999997 25.790000000000003 24.595 23.995 35-39 25.629999999999995 25.369999999999997 24.945 24.055 40-44 26.395000000000003 25.095 24.445 24.065 45-49 25.814999999999998 25.424999999999997 24.94 23.82 50-54 25.31 25.72 24.815 24.154999999999998 55-59 26.0 25.369999999999997 24.525 24.104999999999997 60-64 26.015 25.224999999999998 24.84 23.919999999999998 65-69 26.174999999999997 25.745 24.15 23.93 70-74 26.224999999999998 25.115 25.055 23.605 75-79 25.91 24.925 24.95 24.215 80-84 25.580000000000002 25.835 24.765 23.82 85-89 26.015 25.765 24.91 23.31 90-94 26.07 25.45 25.22 23.26 95-99 25.94 25.505 25.0 23.555 100-104 26.26 25.41 24.925 23.405 105-109 25.990000000000002 25.525 25.165 23.32 110-114 26.055 26.155 24.91 22.88 115-119 26.055 25.605 24.665 23.674999999999997 120-124 26.36 26.33 24.255 23.055 125-129 25.629999999999995 25.69 25.330000000000002 23.35 130-134 26.095000000000002 26.105 24.715 23.085 135-139 26.46 25.96 24.775 22.805 140-144 26.235000000000003 26.265 24.66 22.84 145-149 26.479999999999997 26.115 24.825 22.58 150-151 26.3 26.650000000000002 25.4625 21.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 3.0 29 4.0 30 5.0 31 4.0 32 8.5 33 13.5 34 15.5 35 16.5 36 27.0 37 46.5 38 73.0 39 103.0 40 115.0 41 135.0 42 159.0 43 194.0 44 208.5 45 201.0 46 204.5 47 204.0 48 200.5 49 190.5 50 163.5 51 155.5 52 145.0 53 117.5 54 104.5 55 100.5 56 102.5 57 96.0 58 95.0 59 86.5 60 77.0 61 80.5 62 79.5 63 63.0 64 57.5 65 55.0 66 43.0 67 38.0 68 42.0 69 41.0 70 31.5 71 26.5 72 18.5 73 13.5 74 11.5 75 5.5 76 5.0 77 3.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96333754740834 97.85000000000001 2 0.9608091024020228 1.9 3 0.05056890012642225 0.15 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 3.0125 0.0 0.0 0.0 0.0 132-133 3.275 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTGA 10 0.006830828 145.0 5 >>END_MODULE Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128749 spots for SRR6958203.sra Written 1128749 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra Read 1128736 spots for SRR6958203.sra Written 1128736 spots for SRR6958203.sra SRR ids: ['SRR6958203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xg447bil SRR6958203.sra spots: 22574733 blocks: [[1, 1128736], [1128737, 2257472], [2257473, 3386208], [3386209, 4514944], [4514945, 5643680], [5643681, 6772416], [6772417, 7901152], [7901153, 9029888], [9029889, 10158624], [10158625, 11287360], [11287361, 12416096], [12416097, 13544832], [13544833, 14673568], [14673569, 15802304], [15802305, 16931040], [16931041, 18059776], [18059777, 19188512], [19188513, 20317248], [20317249, 21445984], [21445985, 22574733]] SRR6958203 file size 7628135 SRR6958203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958203 SRR6958203_1.fastq SRR6958203_2.fastq Input file: SRR6958203_1.fastq Paired file: SRR6958203_2.fastq trimmed: SRR6958203-trimmed-pair1.fastq, SRR6958203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:04:47 2024 >> started Fri Dec 6 16:05:12 2024 >> done (24.421s) 22574733 read pairs processed; of these: 25086 ( 0.11%) short read pairs filtered out after trimming by size control 25797 ( 0.11%) empty read pairs filtered out after trimming by size control 22523850 (99.77%) read pairs available; of these: 7555639 (33.55%) trimmed read pairs available after processing 14968211 (66.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 8 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 10 0.00% 27 3 0.00% 28 7 0.00% 29 9 0.00% 30 6 0.00% 31 12 0.00% 32 6 0.00% 33 5 0.00% 34 5 0.00% 35 7 0.00% 36 12 0.00% 37 7 0.00% 38 8 0.00% 39 14 0.00% 40 18 0.00% 41 15 0.00% 42 12 0.00% 43 16 0.00% 44 16 0.00% 45 17 0.00% 46 18 0.00% 47 15 0.00% 48 22 0.00% 49 38 0.00% 50 50 0.00% 51 35 0.00% 52 39 0.00% 53 44 0.00% 54 40 0.00% 55 63 0.00% 56 69 0.00% 57 85 0.00% 58 105 0.00% 59 104 0.00% 60 123 0.00% 61 151 0.00% 62 161 0.00% 63 181 0.00% 64 214 0.00% 65 242 0.00% 66 287 0.00% 67 295 0.00% 68 339 0.00% 69 399 0.00% 70 440 0.00% 71 518 0.00% 72 634 0.00% 73 729 0.00% 74 784 0.00% 75 931 0.00% 76 966 0.00% 77 1141 0.01% 78 1276 0.01% 79 1489 0.01% 80 1613 0.01% 81 1883 0.01% 82 2117 0.01% 83 2350 0.01% 84 3666 0.02% 85 4516 0.02% 86 4782 0.02% 87 5054 0.02% 88 5360 0.02% 89 5472 0.02% 90 5876 0.03% 91 6204 0.03% 92 6630 0.03% 93 7200 0.03% 94 7680 0.03% 95 7916 0.04% 96 8876 0.04% 97 9436 0.04% 98 9905 0.04% 99 10531 0.05% 100 11130 0.05% 101 12051 0.05% 102 12873 0.06% 103 13435 0.06% 104 14319 0.06% 105 15166 0.07% 106 15960 0.07% 107 16749 0.07% 108 17665 0.08% 109 18616 0.08% 110 19534 0.09% 111 20433 0.09% 112 21946 0.10% 113 22616 0.10% 114 23845 0.11% 115 25375 0.11% 116 26515 0.12% 117 27335 0.12% 118 28739 0.13% 119 29594 0.13% 120 30804 0.14% 121 32461 0.14% 122 33658 0.15% 123 35676 0.16% 124 37213 0.17% 125 38790 0.17% 126 40645 0.18% 127 42317 0.19% 128 43428 0.19% 129 45518 0.20% 130 47162 0.21% 131 49051 0.22% 132 51733 0.23% 133 54140 0.24% 134 56500 0.25% 135 60394 0.27% 136 62375 0.28% 137 65950 0.29% 138 68638 0.30% 139 73548 0.33% 140 77679 0.34% 141 84109 0.37% 142 91438 0.41% 143 101406 0.45% 144 113324 0.50% 145 132187 0.59% 146 157963 0.70% 147 205001 0.91% 148 299333 1.33% 149 587338 2.61% 150 4212639 18.70% 151 14968211 66.45% 22523850 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.64 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=36.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=14 prefix-density=0.80 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=24.82 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958203 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:05:53 Started mapping on | Dec 06 16:05:53 Finished on | Dec 06 16:07:57 Mapping speed, Million of reads per hour | 653.92 Number of input reads | 22523850 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22014039 Uniquely mapped reads % | 97.74% Average mapped length | 296.58 Number of splices: Total | 25218008 Number of splices: Annotated (sjdb) | 23799800 Number of splices: GT/AG | 24887591 Number of splices: GC/AG | 293502 Number of splices: AT/AC | 8589 Number of splices: Non-canonical | 28326 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169503 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 11828 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 355150 355150 355150 N_multimapping 169503 169503 169503 N_noFeature 622810 21337810 807072 N_ambiguous 581862 2882 92103 UnstrandedReadsAssigned:20809367 PositiveStrandReadsAssigned:673347 NegativeStrandReadsAssigned:21114864 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958203-trimmed-pair1.fastq SRR6958203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,523,850 reads, 21,101,789 reads pseudoaligned [quant] estimated average fragment length: 257.223 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958203.ke.tsv 35125 SRR6958203.se.tsv 88098 total ==> SRR6958203.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.229 38.2408 3.83015 PNS24247 1044 787.777 56.6857 4.90246 PNS24249 1928 1671.78 36.5244 1.4885 PNS24246 1044 787.777 56.6857 4.90246 PNS24248 1044 787.777 56.6857 4.90246 PNS24244 1471 1214.78 66.1776 3.71157 PNS24243 293 87.7132 0 0 KQK14069 1603 1346.78 6271.48 317.262 KQK14071 474 231.564 83.1857 24.4749 ==> SRR6958203.se.tsv <== BRADI_1g14170v3 6921 BRADI_1g53295v3 258 BRADI_1g59795v3 216 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 269 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR6958203 completed mapping pipeline successfully