Starting /dee2/code/volunteer_pipeline.sh SRR6958204 current disk space = 1550466830336 free memory = 1601341496 SRR6958204 SRAfilesize 20413344b94010506bcedc8fadd96a8d SRR6958204.sra SRR6958204.sra file validated SRR6958204 is paired end SRR6958204 is conventional basespace SRR6958204 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.39025 28.0 18.0 32.0 18.0 33.0 2 29.35 31.0 27.0 33.0 25.0 33.0 3 30.88125 33.0 29.0 33.0 27.0 33.0 4 30.77925 33.0 31.0 33.0 28.0 33.0 5 30.81625 33.0 31.0 33.0 28.0 33.0 6 35.70325 37.0 36.0 38.0 31.0 38.0 7 36.6795 38.0 37.0 38.0 34.0 38.0 8 36.46275 38.0 37.0 38.0 34.0 38.0 9 36.9135 38.0 38.0 38.0 35.0 38.0 10-14 37.16374999999999 38.0 38.0 38.0 36.0 38.0 15-19 37.2017 38.0 38.0 38.0 36.2 38.0 20-24 37.37575 38.0 38.0 38.0 36.8 38.0 25-29 37.33165 38.0 38.0 38.0 37.0 38.0 30-34 37.13699999999999 38.0 38.0 38.0 36.0 38.0 35-39 37.11545 38.0 38.0 38.0 36.0 38.0 40-44 36.9972 38.0 38.0 38.0 35.8 38.0 45-49 37.25525 38.0 38.0 38.0 36.4 38.0 50-54 37.13119999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.56935 38.0 38.0 38.0 34.4 38.0 60-64 36.162 38.0 37.2 38.0 32.8 38.0 65-69 35.8928 38.0 37.0 38.0 31.0 38.0 70-74 35.9388 38.0 36.8 38.0 31.4 38.0 75-79 36.34815 38.0 37.0 38.0 33.6 38.0 80-84 36.3654 38.0 37.6 38.0 33.2 38.0 85-89 35.85645 38.0 36.6 38.0 31.2 38.0 90-94 36.11495 38.0 37.0 38.0 32.8 38.0 95-99 35.874449999999996 38.0 36.6 38.0 31.2 38.0 100-104 35.3605 38.0 36.0 38.0 29.2 38.0 105-109 35.019999999999996 38.0 35.0 38.0 27.8 38.0 110-114 34.3728 38.0 34.4 38.0 25.0 38.0 115-119 33.394099999999995 37.4 33.2 38.0 17.8 38.0 120-124 33.51485 37.6 33.6 38.0 19.4 38.0 125-129 34.07055 38.0 34.0 38.0 23.2 38.0 130-134 34.313900000000004 38.0 34.0 38.0 25.2 38.0 135-139 34.14905 38.0 34.2 38.0 24.4 38.0 140-144 33.1792 37.6 33.4 38.0 18.2 38.0 145-149 31.401850000000003 36.0 31.8 38.0 11.2 38.0 150-151 26.617125 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 3.0 20 3.0 21 5.0 22 6.0 23 3.0 24 7.0 25 13.0 26 27.0 27 23.0 28 39.0 29 56.0 30 78.0 31 118.0 32 172.0 33 234.0 34 379.0 35 592.0 36 1092.0 37 1142.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.15606775895585 9.69175229103027 11.830047209108582 40.3221327409053 2 25.900000000000002 12.775 32.1 29.225 3 24.85 16.575 23.400000000000002 35.175 4 25.924999999999997 23.0 22.0 29.075 5 26.107634543178975 27.359198998748436 24.430538172715895 22.102628285356694 6 23.9 31.7 22.275 22.125 7 17.025000000000002 24.2 39.175 19.6 8 19.650000000000002 24.075 29.175 27.1 9 19.425 20.5 34.599999999999994 25.474999999999998 10-14 22.185 25.865 26.810000000000002 25.14 15-19 22.29 24.66 27.1 25.95 20-24 22.16 25.35 26.55 25.94 25-29 22.945 25.39 26.3 25.365 30-34 22.675 25.255 25.990000000000002 26.08 35-39 22.965 25.3 26.325 25.41 40-44 22.759999999999998 25.41 26.355 25.474999999999998 45-49 22.99 25.89 25.83 25.290000000000003 50-54 23.064999999999998 25.509999999999998 25.845000000000002 25.580000000000002 55-59 23.119999999999997 25.395 26.415 25.069999999999997 60-64 22.97 25.045 26.14 25.845000000000002 65-69 23.24 25.080000000000002 25.525 26.155 70-74 23.044999999999998 25.11 26.44 25.405 75-79 23.474999999999998 24.54 26.68 25.305 80-84 23.205000000000002 25.230000000000004 25.735000000000003 25.83 85-89 23.080000000000002 24.955 26.200000000000003 25.765 90-94 23.195 25.05 26.150000000000002 25.605 95-99 23.235 24.875 26.44 25.45 100-104 23.195 25.169999999999998 25.619999999999997 26.015 105-109 23.3 24.72 26.295 25.685000000000002 110-114 23.150000000000002 24.84 25.729999999999997 26.279999999999998 115-119 23.405 24.77 25.845000000000002 25.979999999999997 120-124 23.085 25.28 26.369999999999997 25.264999999999997 125-129 23.905 24.560000000000002 25.605 25.929999999999996 130-134 23.39 24.945 25.929999999999996 25.735000000000003 135-139 23.05 25.14 26.229999999999997 25.580000000000002 140-144 23.825 24.84 25.650000000000002 25.685000000000002 145-149 24.125 24.615000000000002 25.224999999999998 26.035000000000004 150-151 23.825 24.8 26.200000000000003 25.174999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.0 29 3.0 30 4.0 31 9.0 32 12.0 33 13.0 34 24.0 35 41.5 36 51.0 37 58.0 38 84.5 39 107.5 40 123.5 41 161.0 42 172.0 43 181.0 44 195.5 45 198.0 46 218.5 47 230.0 48 211.5 49 194.5 50 185.0 51 160.5 52 138.0 53 125.0 54 122.0 55 107.5 56 94.0 57 90.5 58 75.0 59 63.5 60 64.0 61 71.0 62 60.0 63 43.0 64 45.0 65 47.0 66 38.0 67 30.5 68 30.5 69 28.0 70 20.5 71 12.5 72 13.0 73 12.0 74 9.5 75 7.5 76 3.5 77 1.5 78 1.0 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.975000000000001 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6297229219143577 1.25 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.7125000000000004 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCCT 10 0.0068449317 144.90001 6 GACCTGG 10 0.0068449317 144.90001 9 >>END_MODULE SRR6958204 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83025 33.0 33.0 34.0 32.0 34.0 2 32.87725 33.0 33.0 34.0 32.0 34.0 3 32.85325 34.0 33.0 34.0 32.0 34.0 4 32.80625 34.0 33.0 34.0 32.0 34.0 5 32.815 34.0 33.0 34.0 32.0 34.0 6 36.889 38.0 38.0 38.0 35.0 38.0 7 36.69 38.0 38.0 38.0 35.0 38.0 8 36.82925 38.0 38.0 38.0 35.0 38.0 9 36.68325 38.0 38.0 38.0 35.0 38.0 10-14 36.80120000000001 38.0 38.0 38.0 35.2 38.0 15-19 36.9242 38.0 38.0 38.0 36.0 38.0 20-24 37.02265 38.0 38.0 38.0 36.0 38.0 25-29 36.8837 38.0 38.0 38.0 35.8 38.0 30-34 36.71295 38.0 38.0 38.0 35.0 38.0 35-39 36.646699999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.5248 38.0 38.0 38.0 34.2 38.0 45-49 36.66645 38.0 38.0 38.0 34.8 38.0 50-54 36.456100000000006 38.0 38.0 38.0 34.2 38.0 55-59 36.539 38.0 38.0 38.0 34.4 38.0 60-64 36.46245 38.0 38.0 38.0 33.8 38.0 65-69 36.41855 38.0 38.0 38.0 33.8 38.0 70-74 36.415099999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.239200000000004 38.0 37.6 38.0 33.6 38.0 80-84 36.0305 38.0 37.2 38.0 32.6 38.0 85-89 36.02445 38.0 37.2 38.0 33.2 38.0 90-94 36.146950000000004 38.0 37.6 38.0 33.4 38.0 95-99 35.87155 38.0 37.2 38.0 32.4 38.0 100-104 35.291549999999994 38.0 36.2 38.0 29.2 38.0 105-109 34.827600000000004 38.0 35.0 38.0 26.6 38.0 110-114 34.3276 38.0 34.8 38.0 23.4 38.0 115-119 34.2922 38.0 34.4 38.0 24.4 38.0 120-124 33.9965 38.0 34.2 38.0 23.2 38.0 125-129 33.0681 38.0 33.4 38.0 16.2 38.0 130-134 32.335699999999996 36.6 32.0 38.0 14.2 38.0 135-139 31.3119 35.8 29.2 38.0 14.0 38.0 140-144 30.88195 35.2 28.8 38.0 13.4 38.0 145-149 30.66195 36.0 30.2 38.0 8.8 38.0 150-151 25.81975 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 3.0 6 0.0 7 0.0 8 2.0 9 1.0 10 2.0 11 3.0 12 2.0 13 2.0 14 3.0 15 1.0 16 5.0 17 2.0 18 3.0 19 14.0 20 8.0 21 8.0 22 14.0 23 16.0 24 18.0 25 30.0 26 28.0 27 38.0 28 42.0 29 56.0 30 55.0 31 113.0 32 147.0 33 221.0 34 297.0 35 460.0 36 926.0 37 1469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85 18.275 12.725 32.15 2 30.049999999999997 22.825 27.175 19.950000000000003 3 24.575 25.0 27.35 23.075000000000003 4 26.875 31.424999999999997 20.200000000000003 21.5 5 27.325 32.65 20.075000000000003 19.950000000000003 6 23.45 36.65 19.45 20.45 7 22.125 20.549999999999997 32.95 24.375 8 23.75 24.3 23.65 28.299999999999997 9 23.65 22.900000000000002 27.3 26.150000000000002 10-14 26.11 26.424999999999997 23.1 24.365000000000002 15-19 25.66 25.674999999999997 24.12 24.545 20-24 25.385 26.13 24.535 23.95 25-29 25.71 25.615 24.37 24.305 30-34 25.795 26.22 23.98 24.005000000000003 35-39 25.045 26.009999999999998 24.535 24.41 40-44 25.945 25.89 23.794999999999998 24.37 45-49 25.905 25.525 24.555 24.015 50-54 25.95 26.405 24.13 23.515 55-59 26.115 26.07 24.415 23.400000000000002 60-64 25.990000000000002 25.580000000000002 24.505 23.925 65-69 25.380000000000003 25.69 24.86 24.07 70-74 25.955000000000002 25.3 24.675 24.07 75-79 25.91 25.3 25.240000000000002 23.549999999999997 80-84 25.374999999999996 26.25 25.165 23.21 85-89 26.26 25.295 24.295 24.15 90-94 25.619999999999997 26.16 24.779999999999998 23.44 95-99 25.61 25.729999999999997 24.805 23.855 100-104 26.22 25.61 24.585 23.585 105-109 26.009999999999998 25.91 24.725 23.355 110-114 25.840000000000003 26.009999999999998 24.985 23.165 115-119 26.195 25.985000000000003 24.25 23.57 120-124 26.150000000000002 26.419999999999998 24.305 23.125 125-129 26.200000000000003 26.13 24.86 22.81 130-134 26.805 25.765 24.545 22.884999999999998 135-139 26.200000000000003 26.465 24.465 22.869999999999997 140-144 26.745 26.545 24.404999999999998 22.305 145-149 26.665 26.305 24.425 22.605 150-151 26.950000000000003 26.224999999999998 24.0625 22.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.5 28 2.5 29 1.5 30 3.0 31 6.0 32 7.5 33 9.5 34 17.5 35 31.0 36 40.0 37 55.5 38 78.5 39 97.5 40 118.0 41 128.5 42 150.5 43 182.5 44 187.5 45 198.5 46 223.5 47 213.0 48 189.0 49 173.0 50 166.0 51 160.5 52 135.0 53 126.5 54 131.0 55 124.5 56 102.5 57 90.0 58 94.0 59 90.0 60 80.0 61 65.0 62 62.0 63 66.0 64 58.0 65 45.0 66 39.0 67 38.0 68 36.0 69 36.5 70 30.0 71 23.5 72 21.0 73 15.5 74 13.5 75 10.5 76 7.0 77 4.0 78 2.5 79 1.0 80 1.0 81 1.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24280666330137 98.3 2 0.6562342251388188 1.3 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.05047955577990913 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0125 0.0 0.0 82-83 0.075 0.0 0.025 0.0 0.0 84-85 0.075 0.0 0.025 0.0 0.0 86-87 0.0875 0.0 0.025 0.0 0.0 88-89 0.1 0.0 0.025 0.0 0.0 90-91 0.125 0.0 0.025 0.0 0.0 92-93 0.125 0.0 0.025 0.0 0.0 94-95 0.16249999999999998 0.0 0.025 0.0 0.0 96-97 0.2 0.0 0.025 0.0 0.0 98-99 0.25 0.0 0.025 0.0 0.0 100-101 0.325 0.0 0.025 0.0 0.0 102-103 0.375 0.0 0.025 0.0 0.0 104-105 0.4 0.0 0.025 0.0 0.0 106-107 0.44999999999999996 0.0 0.025 0.0 0.0 108-109 0.475 0.0 0.025 0.0 0.0 110-111 0.5 0.0 0.025 0.0 0.0 112-113 0.5625 0.0 0.025 0.0 0.0 114-115 0.675 0.0 0.025 0.0 0.0 116-117 0.875 0.0 0.025 0.0 0.0 118-119 0.95 0.0 0.025 0.0 0.0 120-121 1.2125 0.0 0.025 0.0 0.0 122-123 1.45 0.0 0.025 0.0 0.0 124-125 1.6124999999999998 0.0 0.025 0.0 0.0 126-127 1.8625 0.0 0.025 0.0 0.0 128-129 1.9749999999999999 0.0 0.025 0.0 0.0 130-131 2.1625 0.0 0.025 0.0 0.0 132-133 2.4124999999999996 0.0 0.025 0.0 0.0 134-135 2.7375 0.0 0.025 0.0 0.0 136-137 3.075 0.0 0.025 0.0 0.0 138-139 3.3125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045907 spots for SRR6958204.sra Written 1045907 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra Read 1045897 spots for SRR6958204.sra Written 1045897 spots for SRR6958204.sra SRR ids: ['SRR6958204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_69vw8uvz SRR6958204.sra spots: 20917950 blocks: [[1, 1045897], [1045898, 2091794], [2091795, 3137691], [3137692, 4183588], [4183589, 5229485], [5229486, 6275382], [6275383, 7321279], [7321280, 8367176], [8367177, 9413073], [9413074, 10458970], [10458971, 11504867], [11504868, 12550764], [12550765, 13596661], [13596662, 14642558], [14642559, 15688455], [15688456, 16734352], [16734353, 17780249], [17780250, 18826146], [18826147, 19872043], [19872044, 20917950]] SRR6958204 file size 7066706 SRR6958204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958204 SRR6958204_1.fastq SRR6958204_2.fastq Input file: SRR6958204_1.fastq Paired file: SRR6958204_2.fastq trimmed: SRR6958204-trimmed-pair1.fastq, SRR6958204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:03:36 2024 >> started Fri Dec 6 16:03:58 2024 >> done (22.393s) 20917950 read pairs processed; of these: 19451 ( 0.09%) short read pairs filtered out after trimming by size control 13449 ( 0.06%) empty read pairs filtered out after trimming by size control 20885050 (99.84%) read pairs available; of these: 8759573 (41.94%) trimmed read pairs available after processing 12125477 (58.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 2 0.00% 28 6 0.00% 29 8 0.00% 30 4 0.00% 31 2 0.00% 32 8 0.00% 33 12 0.00% 34 6 0.00% 35 6 0.00% 36 9 0.00% 37 14 0.00% 38 7 0.00% 39 11 0.00% 40 15 0.00% 41 9 0.00% 42 23 0.00% 43 20 0.00% 44 23 0.00% 45 28 0.00% 46 21 0.00% 47 28 0.00% 48 22 0.00% 49 35 0.00% 50 32 0.00% 51 34 0.00% 52 36 0.00% 53 39 0.00% 54 65 0.00% 55 52 0.00% 56 82 0.00% 57 59 0.00% 58 83 0.00% 59 122 0.00% 60 97 0.00% 61 138 0.00% 62 133 0.00% 63 166 0.00% 64 168 0.00% 65 178 0.00% 66 209 0.00% 67 228 0.00% 68 228 0.00% 69 302 0.00% 70 297 0.00% 71 359 0.00% 72 406 0.00% 73 481 0.00% 74 522 0.00% 75 602 0.00% 76 640 0.00% 77 767 0.00% 78 832 0.00% 79 901 0.00% 80 979 0.00% 81 1211 0.01% 82 1395 0.01% 83 1726 0.01% 84 2598 0.01% 85 3145 0.02% 86 3314 0.02% 87 3523 0.02% 88 3637 0.02% 89 3798 0.02% 90 3973 0.02% 91 4217 0.02% 92 4667 0.02% 93 4992 0.02% 94 5279 0.03% 95 5727 0.03% 96 6077 0.03% 97 6368 0.03% 98 6834 0.03% 99 7408 0.04% 100 7915 0.04% 101 8355 0.04% 102 8929 0.04% 103 9644 0.05% 104 10356 0.05% 105 11094 0.05% 106 12070 0.06% 107 12641 0.06% 108 13053 0.06% 109 14080 0.07% 110 14904 0.07% 111 15565 0.07% 112 16863 0.08% 113 17595 0.08% 114 19003 0.09% 115 20458 0.10% 116 22074 0.11% 117 22953 0.11% 118 23922 0.11% 119 24714 0.12% 120 26488 0.13% 121 27819 0.13% 122 28641 0.14% 123 31236 0.15% 124 32938 0.16% 125 34847 0.17% 126 37227 0.18% 127 39551 0.19% 128 40781 0.20% 129 43534 0.21% 130 46398 0.22% 131 49253 0.24% 132 53441 0.26% 133 57511 0.28% 134 61763 0.30% 135 66889 0.32% 136 73031 0.35% 137 79835 0.38% 138 86483 0.41% 139 95883 0.46% 140 105454 0.50% 141 114949 0.55% 142 127683 0.61% 143 139026 0.67% 144 149702 0.72% 145 169803 0.81% 146 200955 0.96% 147 277843 1.33% 148 448519 2.15% 149 947081 4.53% 150 4669334 22.36% 151 12125477 58.06% 20885050 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=17 prefix-density=0.76 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=23.30 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=CACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=17 prefix-density=0.51 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=90.09 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958204 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:04:52 Started mapping on | Dec 06 16:04:52 Finished on | Dec 06 16:07:06 Mapping speed, Million of reads per hour | 561.09 Number of input reads | 20885050 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19721128 Uniquely mapped reads % | 94.43% Average mapped length | 296.49 Number of splices: Total | 22947113 Number of splices: Annotated (sjdb) | 21646284 Number of splices: GT/AG | 22643447 Number of splices: GC/AG | 268284 Number of splices: AT/AC | 8442 Number of splices: Non-canonical | 26940 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317277 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 60250 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 1.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 859605 859605 859605 N_multimapping 317277 317277 317277 N_noFeature 727614 19163962 891029 N_ambiguous 474605 2844 81883 UnstrandedReadsAssigned:18518909 PositiveStrandReadsAssigned:554322 NegativeStrandReadsAssigned:18748216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958204-trimmed-pair1.fastq SRR6958204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,885,050 reads, 18,823,236 reads pseudoaligned [quant] estimated average fragment length: 267.165 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52973 SRR6958204.ke.tsv 35125 SRR6958204.se.tsv 88098 total ==> SRR6958204.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.264 0 0 PNS24247 1044 777.835 68.9308 7.01664 PNS24249 1928 1661.84 56.6882 2.7009 PNS24246 1044 777.835 68.9308 7.01664 PNS24248 1044 777.835 68.9308 7.01664 PNS24244 1471 1204.84 28.5195 1.87421 PNS24243 293 81.6423 0 0 KQK14069 1603 1336.84 7030.38 416.394 KQK14071 474 221.962 83.3991 29.75 ==> SRR6958204.se.tsv <== BRADI_1g14170v3 7648 BRADI_1g53295v3 112 BRADI_1g59795v3 158 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 187 BRADI_1g74790v3 127 BRADI_1g09890v3 0 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR6958204 completed mapping pipeline successfully