Starting /dee2/code/volunteer_pipeline.sh SRR6958205 current disk space = 1550517207040 free memory = 1475682480 SRR6958205 SRAfilesize cde7a2df315cccd60486fb37993514c9 SRR6958205.sra SRR6958205.sra file validated SRR6958205 is paired end SRR6958205 is conventional basespace SRR6958205 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.5305 32.0 25.0 33.0 18.0 33.0 2 30.4015 31.0 29.0 33.0 27.0 33.0 3 31.114 33.0 30.0 33.0 27.0 33.0 4 32.30725 33.0 32.0 33.0 32.0 33.0 5 32.6055 33.0 33.0 33.0 32.0 34.0 6 36.71825 38.0 37.0 38.0 34.0 38.0 7 37.497 38.0 38.0 38.0 37.0 38.0 8 37.6385 38.0 38.0 38.0 38.0 38.0 9 36.894 38.0 38.0 38.0 36.0 38.0 10-14 37.37595 38.0 38.0 38.0 36.8 38.0 15-19 37.571400000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.59095 38.0 38.0 38.0 37.8 38.0 25-29 37.395500000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.703900000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5863 38.0 38.0 38.0 37.8 38.0 40-44 37.6343 38.0 38.0 38.0 38.0 38.0 45-49 37.58715 38.0 38.0 38.0 38.0 38.0 50-54 37.479299999999995 38.0 38.0 38.0 37.8 38.0 55-59 37.26315000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.0433 38.0 38.0 38.0 35.6 38.0 65-69 37.347449999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.248599999999996 38.0 38.0 38.0 36.8 38.0 75-79 37.34985 38.0 38.0 38.0 37.0 38.0 80-84 37.231399999999994 38.0 38.0 38.0 36.4 38.0 85-89 37.1833 38.0 38.0 38.0 36.2 38.0 90-94 37.18765 38.0 38.0 38.0 36.0 38.0 95-99 37.06895000000001 38.0 38.0 38.0 35.8 38.0 100-104 36.90604999999999 38.0 38.0 38.0 35.4 38.0 105-109 36.87975 38.0 38.0 38.0 35.0 38.0 110-114 36.6525 38.0 38.0 38.0 34.4 38.0 115-119 36.60510000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.508900000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.30365 38.0 38.0 38.0 33.8 38.0 130-134 36.0523 38.0 37.2 38.0 33.0 38.0 135-139 36.0298 38.0 37.0 38.0 33.0 38.0 140-144 35.536699999999996 38.0 36.0 38.0 31.2 38.0 145-149 35.03105 38.0 35.4 38.0 29.8 38.0 150-151 31.739250000000002 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 2.0 22 1.0 23 3.0 24 4.0 25 7.0 26 6.0 27 13.0 28 17.0 29 18.0 30 29.0 31 30.0 32 51.0 33 69.0 34 148.0 35 236.0 36 672.0 37 2691.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.95997934417764 10.147172734314484 7.952491608572167 46.94035631293571 2 20.474999999999998 13.350000000000001 38.2 27.975 3 19.2 14.875 25.624999999999996 40.300000000000004 4 23.5 24.125 21.325 31.05 5 25.1 28.125 24.95 21.825 6 21.55 34.949999999999996 25.0 18.5 7 17.125 25.674999999999997 39.025 18.175 8 20.075000000000003 26.150000000000002 31.8 21.975 9 19.325 24.025 33.975 22.675 10-14 21.375 28.134999999999998 27.02 23.47 15-19 21.965 26.875 27.195000000000004 23.965 20-24 22.235 27.310000000000002 26.87 23.585 25-29 21.305 27.46 27.255000000000003 23.98 30-34 21.9 27.139999999999997 26.745 24.215 35-39 21.61 27.115000000000002 26.91 24.365000000000002 40-44 22.14 27.205000000000002 26.779999999999998 23.875 45-49 21.695 26.740000000000002 26.895000000000003 24.67 50-54 22.093313997099564 26.904035605340802 26.739010851627743 24.263639545931888 55-59 21.51107555377769 27.31136556827841 27.13135656782839 24.046202310115504 60-64 21.576078803940195 26.906345317265863 27.556377818890944 23.961198059902994 65-69 22.005 26.605 27.46 23.93 70-74 21.465 27.13 27.04 24.365000000000002 75-79 21.425 26.69 27.485 24.4 80-84 21.715 26.939999999999998 26.755000000000003 24.59 85-89 21.425 26.834999999999997 26.915 24.825 90-94 21.685 26.83 27.060000000000002 24.425 95-99 22.255 26.505000000000003 27.21 24.03 100-104 21.896094804740237 26.96634831741587 26.50132506625331 24.636231811590577 105-109 21.65324798719808 26.19892983947592 27.829174376156423 24.318647797169575 110-114 22.005403782647853 27.434203942759932 26.518562994095866 24.041829280496348 115-119 22.649059623849542 26.795718287314923 26.91076430572229 23.644457783113246 120-124 22.02 26.669999999999998 26.645000000000003 24.665 125-129 21.997996995493242 26.54982473710566 26.930395593390084 24.521782674011018 130-134 22.247798238590875 26.286028823058448 27.07666132906325 24.38951160928743 135-139 22.065 27.18 26.805 23.95 140-144 22.17 26.275 26.240000000000002 25.314999999999998 145-149 22.485 26.21 26.474999999999998 24.83 150-151 22.8875 25.9625 26.450000000000003 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 1.5 27 2.0 28 5.0 29 7.0 30 14.0 31 19.0 32 25.0 33 34.0 34 48.5 35 63.0 36 69.5 37 83.0 38 103.0 39 137.0 40 163.5 41 168.5 42 197.5 43 229.5 44 245.0 45 248.5 46 243.0 47 234.5 48 208.0 49 193.5 50 177.5 51 149.5 52 131.5 53 113.0 54 96.0 55 84.0 56 74.0 57 63.0 58 51.0 59 46.5 60 42.0 61 38.5 62 35.5 63 29.5 64 27.5 65 22.5 66 15.0 67 11.5 68 10.5 69 8.5 70 9.0 71 7.0 72 2.0 73 0.5 74 1.5 75 2.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.015 110-114 0.06999999999999999 115-119 0.04 120-124 0.0 125-129 0.15 130-134 0.08 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACTA 10 0.006577216 146.82278 1 GACAACA 10 0.006832588 144.9875 6 TTGCTGG 10 0.006832588 144.9875 9 >>END_MODULE SRR6958205 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21725 34.0 33.0 34.0 33.0 34.0 2 33.3285 34.0 33.0 34.0 33.0 34.0 3 33.35525 34.0 33.0 34.0 33.0 34.0 4 33.3465 34.0 33.0 34.0 33.0 34.0 5 33.3725 34.0 33.0 34.0 33.0 34.0 6 37.55475 38.0 38.0 38.0 38.0 38.0 7 37.61125 38.0 38.0 38.0 38.0 38.0 8 37.543 38.0 38.0 38.0 38.0 38.0 9 33.7845 38.0 34.0 38.0 16.0 38.0 10-14 37.2854 38.0 37.8 38.0 36.0 38.0 15-19 35.99125 38.0 36.8 38.0 31.2 38.0 20-24 37.4968 38.0 38.0 38.0 37.8 38.0 25-29 37.5501 38.0 38.0 38.0 38.0 38.0 30-34 37.5893 38.0 38.0 38.0 38.0 38.0 35-39 37.58415 38.0 38.0 38.0 38.0 38.0 40-44 37.58785 38.0 38.0 38.0 38.0 38.0 45-49 37.536350000000006 38.0 38.0 38.0 38.0 38.0 50-54 36.834199999999996 38.0 38.0 38.0 34.8 38.0 55-59 37.46525 38.0 38.0 38.0 37.8 38.0 60-64 37.49345 38.0 38.0 38.0 38.0 38.0 65-69 37.4861 38.0 38.0 38.0 38.0 38.0 70-74 37.4605 38.0 38.0 38.0 38.0 38.0 75-79 37.3957 38.0 38.0 38.0 37.6 38.0 80-84 37.4222 38.0 38.0 38.0 38.0 38.0 85-89 37.3669 38.0 38.0 38.0 37.8 38.0 90-94 37.29715 38.0 38.0 38.0 37.4 38.0 95-99 37.247249999999994 38.0 38.0 38.0 37.0 38.0 100-104 36.27615 38.0 37.4 38.0 30.6 38.0 105-109 36.98975 38.0 38.0 38.0 35.8 38.0 110-114 34.60515 37.8 33.8 38.0 26.4 38.0 115-119 36.8751 38.0 38.0 38.0 35.4 38.0 120-124 35.25085 38.0 35.0 38.0 28.8 38.0 125-129 36.73685 38.0 38.0 38.0 34.8 38.0 130-134 33.72365 37.8 32.6 38.0 22.2 38.0 135-139 34.92485 38.0 35.8 38.0 27.2 38.0 140-144 35.360850000000006 38.0 36.6 38.0 30.4 38.0 145-149 35.5312 38.0 37.6 38.0 31.4 38.0 150-151 32.19775 36.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 3.0 12 0.0 13 2.0 14 0.0 15 0.0 16 0.0 17 3.0 18 1.0 19 2.0 20 1.0 21 3.0 22 4.0 23 5.0 24 7.0 25 11.0 26 11.0 27 17.0 28 14.0 29 19.0 30 24.0 31 26.0 32 51.0 33 55.0 34 114.0 35 261.0 36 842.0 37 2523.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.85 18.7 13.350000000000001 36.1 2 29.275000000000002 24.099999999999998 28.775000000000002 17.849999999999998 3 22.025 25.724999999999998 29.225 23.025000000000002 4 26.25 29.95 22.8 21.0 5 26.85 32.75 21.9 18.5 6 20.549999999999997 38.05 22.400000000000002 19.0 7 21.325 19.55 37.75 21.375 8 23.05 25.4 26.174999999999997 25.374999999999996 9 23.724999999999998 23.075000000000003 30.049999999999997 23.150000000000002 10-14 25.025 27.665 24.610000000000003 22.7 15-19 24.87 26.39 25.814999999999998 22.925 20-24 24.73 27.215 25.590000000000003 22.465 25-29 25.474999999999998 26.695 25.44 22.39 30-34 24.04 27.310000000000002 25.729999999999997 22.919999999999998 35-39 24.735 26.88 25.85 22.535 40-44 24.8 26.889999999999997 25.900000000000002 22.41 45-49 24.349999999999998 26.86 26.155 22.634999999999998 50-54 24.77 26.735 26.6 21.895 55-59 24.325 26.965 25.97 22.74 60-64 24.535 26.88 26.314999999999998 22.27 65-69 24.825 27.034999999999997 26.245 21.895 70-74 24.815 26.474999999999998 26.665 22.045 75-79 24.05 27.045 26.52 22.384999999999998 80-84 24.625 26.85 26.584999999999997 21.94 85-89 24.535 27.27 25.89 22.305 90-94 23.98 26.919999999999998 26.779999999999998 22.32 95-99 24.43 27.415 26.064999999999998 22.09 100-104 24.345 27.605 26.505000000000003 21.545 105-109 24.675 26.865 26.665 21.795 110-114 24.6 27.57 26.119999999999997 21.709999999999997 115-119 24.6 27.21 26.090000000000003 22.1 120-124 24.825 27.685 26.169999999999998 21.32 125-129 25.240000000000002 26.69 26.174999999999997 21.895 130-134 24.63 27.465 25.905 22.0 135-139 24.795 27.639999999999997 26.229999999999997 21.335 140-144 24.67 27.125 26.77 21.435000000000002 145-149 24.92 27.389999999999997 26.265 21.425 150-151 25.900000000000002 27.250000000000004 26.35 20.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 4.5 27 6.5 28 4.5 29 6.0 30 11.0 31 16.0 32 21.5 33 25.5 34 34.0 35 50.0 36 62.5 37 74.5 38 90.0 39 116.0 40 142.5 41 178.0 42 210.5 43 220.0 44 230.5 45 245.0 46 242.5 47 228.5 48 233.0 49 205.5 50 162.0 51 140.5 52 122.0 53 104.0 54 88.0 55 81.5 56 75.5 57 72.0 58 66.5 59 55.0 60 51.5 61 55.0 62 44.5 63 38.0 64 35.0 65 33.0 66 32.0 67 21.0 68 15.5 69 10.0 70 8.0 71 9.5 72 7.0 73 5.5 74 3.5 75 1.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0125 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.0875 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.1 0.025 0.0 0.0 0.0 92-93 0.1 0.025 0.0 0.0 0.0 94-95 0.125 0.025 0.0 0.0 0.0 96-97 0.175 0.025 0.0 0.0 0.0 98-99 0.25 0.025 0.0 0.0 0.0 100-101 0.3125 0.025 0.0 0.0 0.0 102-103 0.4 0.025 0.0 0.0 0.0 104-105 0.5 0.025 0.0 0.0 0.0 106-107 0.5125 0.025 0.0 0.0 0.0 108-109 0.575 0.025 0.0 0.0 0.0 110-111 0.8500000000000001 0.025 0.0 0.0 0.0 112-113 0.9625 0.025 0.0 0.0 0.0 114-115 1.0375 0.025 0.0 0.0 0.0 116-117 1.1124999999999998 0.025 0.0 0.0 0.0 118-119 1.225 0.025 0.0 0.0 0.0 120-121 1.375 0.025 0.0 0.0 0.0 122-123 1.5125000000000002 0.025 0.0 0.0 0.0 124-125 1.6 0.025 0.0 0.0 0.0 126-127 1.725 0.025 0.0 0.0 0.0 128-129 1.9874999999999998 0.025 0.0 0.0 0.0 130-131 2.1875 0.025 0.0 0.0 0.0 132-133 2.4375 0.025 0.0 0.0 0.0 134-135 2.5625 0.025 0.0 0.0 0.0 136-137 2.7625 0.025 0.0 0.0 0.0 138-139 3.0125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAACA 10 0.006830828 145.0 2 >>END_MODULE Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732802 spots for SRR6958205.sra Written 732802 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra Read 732790 spots for SRR6958205.sra Written 732790 spots for SRR6958205.sra SRR ids: ['SRR6958205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pjs0fjtb SRR6958205.sra spots: 14655812 blocks: [[1, 732790], [732791, 1465580], [1465581, 2198370], [2198371, 2931160], [2931161, 3663950], [3663951, 4396740], [4396741, 5129530], [5129531, 5862320], [5862321, 6595110], [6595111, 7327900], [7327901, 8060690], [8060691, 8793480], [8793481, 9526270], [9526271, 10259060], [10259061, 10991850], [10991851, 11724640], [11724641, 12457430], [12457431, 13190220], [13190221, 13923010], [13923011, 14655812]] SRR6958205 file size 4944673 SRR6958205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958205 SRR6958205_1.fastq SRR6958205_2.fastq Input file: SRR6958205_1.fastq Paired file: SRR6958205_2.fastq trimmed: SRR6958205-trimmed-pair1.fastq, SRR6958205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:08:28 2024 >> started Fri Dec 6 16:11:17 2024 >> done (169.721s) 14655812 read pairs processed; of these: 3679 ( 0.03%) short read pairs filtered out after trimming by size control 3014 ( 0.02%) empty read pairs filtered out after trimming by size control 14649119 (99.95%) read pairs available; of these: 5889862 (40.21%) trimmed read pairs available after processing 8759257 (59.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 5 0.00% 30 2 0.00% 31 3 0.00% 32 2 0.00% 33 4 0.00% 34 3 0.00% 35 5 0.00% 36 0 0.00% 37 4 0.00% 38 5 0.00% 39 3 0.00% 40 11 0.00% 41 6 0.00% 42 8 0.00% 43 5 0.00% 44 8 0.00% 45 20 0.00% 46 18 0.00% 47 9 0.00% 48 8 0.00% 49 26 0.00% 50 15 0.00% 51 17 0.00% 52 15 0.00% 53 25 0.00% 54 20 0.00% 55 27 0.00% 56 33 0.00% 57 29 0.00% 58 44 0.00% 59 46 0.00% 60 40 0.00% 61 49 0.00% 62 64 0.00% 63 94 0.00% 64 95 0.00% 65 102 0.00% 66 120 0.00% 67 140 0.00% 68 154 0.00% 69 191 0.00% 70 206 0.00% 71 205 0.00% 72 278 0.00% 73 293 0.00% 74 347 0.00% 75 422 0.00% 76 441 0.00% 77 480 0.00% 78 582 0.00% 79 644 0.00% 80 696 0.00% 81 790 0.01% 82 929 0.01% 83 1000 0.01% 84 1261 0.01% 85 1567 0.01% 86 1684 0.01% 87 1845 0.01% 88 2062 0.01% 89 2327 0.02% 90 2353 0.02% 91 2597 0.02% 92 2881 0.02% 93 3166 0.02% 94 3436 0.02% 95 3678 0.03% 96 3860 0.03% 97 4420 0.03% 98 4705 0.03% 99 5773 0.04% 100 5870 0.04% 101 6773 0.05% 102 6030 0.04% 103 6256 0.04% 104 6906 0.05% 105 7058 0.05% 106 7691 0.05% 107 8183 0.06% 108 8746 0.06% 109 9314 0.06% 110 9706 0.07% 111 10156 0.07% 112 10844 0.07% 113 11233 0.08% 114 12047 0.08% 115 12917 0.09% 116 13793 0.09% 117 13994 0.10% 118 14728 0.10% 119 15339 0.10% 120 16319 0.11% 121 17027 0.12% 122 17733 0.12% 123 18580 0.13% 124 19717 0.13% 125 20470 0.14% 126 21659 0.15% 127 22611 0.15% 128 24028 0.16% 129 25378 0.17% 130 26922 0.18% 131 28065 0.19% 132 29495 0.20% 133 31859 0.22% 134 33058 0.23% 135 35918 0.25% 136 38340 0.26% 137 40891 0.28% 138 42915 0.29% 139 47199 0.32% 140 51050 0.35% 141 55844 0.38% 142 63150 0.43% 143 70342 0.48% 144 82123 0.56% 145 99531 0.68% 146 125429 0.86% 147 174548 1.19% 148 276263 1.89% 149 575260 3.93% 150 3504136 23.92% 151 8759257 59.79% 14649119 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=72.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=23 prefix-density=0.45 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=22.70 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958205 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:16:23 Started mapping on | Dec 06 16:16:23 Finished on | Dec 06 16:34:43 Mapping speed, Million of reads per hour | 47.94 Number of input reads | 14649119 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14375985 Uniquely mapped reads % | 98.14% Average mapped length | 297.48 Number of splices: Total | 16852565 Number of splices: Annotated (sjdb) | 15873904 Number of splices: GT/AG | 16640071 Number of splices: GC/AG | 193336 Number of splices: AT/AC | 6888 Number of splices: Non-canonical | 12270 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 103491 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 10508 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 172294 172294 172294 N_multimapping 103491 103491 103491 N_noFeature 663519 13977034 791580 N_ambiguous 322059 1592 52265 UnstrandedReadsAssigned:13390407 PositiveStrandReadsAssigned:397359 NegativeStrandReadsAssigned:13532140 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958205-trimmed-pair1.fastq SRR6958205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,649,119 reads, 13,557,506 reads pseudoaligned [quant] estimated average fragment length: 245.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6958205.ke.tsv 35125 SRR6958205.se.tsv 88098 total ==> SRR6958205.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.495 0 0 PNS24247 1044 799.082 56.6243 8.39405 PNS24249 1928 1683.08 0 0 PNS24246 1044 799.082 56.6243 8.39405 PNS24248 1044 799.082 56.6243 8.39405 PNS24244 1471 1226.08 30.127 2.9107 PNS24243 293 83.2723 0 0 KQK14069 1603 1358.08 1938.52 169.085 KQK14071 474 234.88 29.6564 14.9566 ==> SRR6958205.se.tsv <== BRADI_1g14170v3 2350 BRADI_1g53295v3 300 BRADI_1g59795v3 268 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 250 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 168 BRADI_1g48960v3 0 SRR6958205 completed mapping pipeline successfully