Starting /dee2/code/volunteer_pipeline.sh SRR6958206 current disk space = 1550512173056 free memory = 1602538000 SRR6958206 SRAfilesize edc59c5f938c5daa44e96aa349ab40fe SRR6958206.sra SRR6958206.sra file validated SRR6958206 is paired end SRR6958206 is conventional basespace SRR6958206 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.4285 18.0 18.0 25.0 2.0 32.0 2 28.4365 29.0 27.0 31.0 25.0 33.0 3 30.85775 31.0 30.0 33.0 27.0 33.0 4 31.53575 33.0 32.0 33.0 30.0 33.0 5 32.5155 33.0 33.0 33.0 32.0 34.0 6 36.20125 38.0 36.0 38.0 33.0 38.0 7 37.07425 38.0 38.0 38.0 36.0 38.0 8 37.39425 38.0 38.0 38.0 37.0 38.0 9 37.3525 38.0 38.0 38.0 37.0 38.0 10-14 37.263400000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.27805 38.0 38.0 38.0 36.6 38.0 20-24 36.6057 38.0 37.8 38.0 34.0 38.0 25-29 36.6991 38.0 38.0 38.0 35.0 38.0 30-34 37.090250000000005 38.0 38.0 38.0 36.2 38.0 35-39 37.308949999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.30645 38.0 38.0 38.0 37.0 38.0 45-49 37.19075 38.0 38.0 38.0 36.6 38.0 50-54 36.9898 38.0 38.0 38.0 36.0 38.0 55-59 36.885200000000005 38.0 38.0 38.0 35.2 38.0 60-64 37.06245 38.0 38.0 38.0 36.0 38.0 65-69 37.130849999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.12245 38.0 38.0 38.0 36.0 38.0 75-79 37.03375 38.0 38.0 38.0 36.0 38.0 80-84 36.9556 38.0 38.0 38.0 35.6 38.0 85-89 36.4674 38.0 38.0 38.0 34.0 38.0 90-94 35.928250000000006 38.0 37.2 38.0 32.2 38.0 95-99 35.0039 38.0 35.8 38.0 26.4 38.0 100-104 34.84335 38.0 35.6 38.0 25.2 38.0 105-109 34.859500000000004 38.0 35.4 38.0 25.8 38.0 110-114 35.26865 38.0 36.0 38.0 28.4 38.0 115-119 35.63885 38.0 36.6 38.0 30.2 38.0 120-124 35.88445 38.0 37.0 38.0 32.2 38.0 125-129 35.9099 38.0 36.8 38.0 32.6 38.0 130-134 35.7251 38.0 36.2 38.0 31.8 38.0 135-139 35.42855 38.0 36.0 38.0 31.0 38.0 140-144 34.423449999999995 38.0 34.6 38.0 26.8 38.0 145-149 32.351800000000004 37.6 31.4 38.0 16.8 38.0 150-151 28.502625000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 1.0 21 6.0 22 1.0 23 9.0 24 11.0 25 15.0 26 14.0 27 29.0 28 48.0 29 58.0 30 62.0 31 82.0 32 105.0 33 148.0 34 193.0 35 376.0 36 874.0 37 1955.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.57481648785997 9.373235460191982 11.462450592885375 36.58949745906268 2 24.9 14.45 32.725 27.925 3 22.675 16.925 24.6 35.8 4 25.724999999999998 25.224999999999998 20.3 28.749999999999996 5 25.8 29.15 24.2 20.849999999999998 6 23.150000000000002 31.05 23.7 22.1 7 16.650000000000002 23.175 40.675 19.5 8 19.075 23.200000000000003 29.225 28.499999999999996 9 21.099999999999998 21.25 33.475 24.175 10-14 23.315 26.295 26.215 24.175 15-19 23.058458768815324 25.048757313597044 26.563984597689654 25.328799319897982 20-24 22.645 25.335 26.540000000000003 25.480000000000004 25-29 23.06 24.95 26.665 25.324999999999996 30-34 23.185 25.525 26.279999999999998 25.009999999999998 35-39 22.38 25.75 26.384999999999998 25.485000000000003 40-44 22.705000000000002 25.16 26.284999999999997 25.85 45-49 22.825 25.264999999999997 26.085 25.825 50-54 23.330000000000002 25.674999999999997 25.855 25.14 55-59 22.53 25.25 26.345000000000002 25.874999999999996 60-64 23.005 26.075 25.45 25.47 65-69 23.06 25.540000000000003 26.1 25.3 70-74 23.525 25.77 25.705 25.0 75-79 22.8 25.005 26.405 25.790000000000003 80-84 23.275000000000002 24.990000000000002 25.88 25.855 85-89 22.6 25.069999999999997 26.46 25.869999999999997 90-94 22.98 25.355 26.815 24.85 95-99 23.415 25.945 25.474999999999998 25.165 100-104 23.150000000000002 25.515 25.855 25.480000000000004 105-109 23.305 25.235000000000003 26.255 25.205 110-114 23.0 25.590000000000003 26.200000000000003 25.21 115-119 22.555 25.39 26.455000000000002 25.6 120-124 24.005000000000003 24.59 25.775 25.629999999999995 125-129 23.32 24.595 26.529999999999998 25.555 130-134 23.02 24.895 26.064999999999998 26.02 135-139 23.985 25.380000000000003 24.93 25.705 140-144 23.39 25.655 25.759999999999998 25.195 145-149 23.505000000000003 25.56 25.7 25.235000000000003 150-151 23.5875 24.6875 26.6 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 2.0 28 2.5 29 2.5 30 5.0 31 12.0 32 14.0 33 14.5 34 30.5 35 51.0 36 57.5 37 62.0 38 77.5 39 105.0 40 135.5 41 168.0 42 176.5 43 189.0 44 203.5 45 208.0 46 214.5 47 208.5 48 203.0 49 173.0 50 167.0 51 167.5 52 131.5 53 111.5 54 104.5 55 100.0 56 95.5 57 90.5 58 83.0 59 86.0 60 81.5 61 66.5 62 59.5 63 55.5 64 51.5 65 41.0 66 35.5 67 28.5 68 25.0 69 23.5 70 20.0 71 18.5 72 14.0 73 7.0 74 6.0 75 6.5 76 2.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.450000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.525 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9749999999999999 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.6 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.1375 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGT 10 0.0047684857 163.25352 1 >>END_MODULE SRR6958206 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73375 33.0 33.0 34.0 32.0 34.0 2 32.85775 33.0 33.0 34.0 32.0 34.0 3 32.888 33.0 33.0 34.0 32.0 34.0 4 32.849 34.0 33.0 34.0 32.0 34.0 5 32.92225 34.0 33.0 34.0 32.0 34.0 6 37.0455 38.0 38.0 38.0 36.0 38.0 7 36.9515 38.0 38.0 38.0 36.0 38.0 8 36.92 38.0 38.0 38.0 36.0 38.0 9 36.79 38.0 38.0 38.0 35.0 38.0 10-14 36.564499999999995 38.0 38.0 38.0 34.4 38.0 15-19 36.40390000000001 38.0 38.0 38.0 33.6 38.0 20-24 36.565549999999995 38.0 38.0 38.0 34.6 38.0 25-29 36.74765 38.0 38.0 38.0 35.2 38.0 30-34 36.9537 38.0 38.0 38.0 36.0 38.0 35-39 37.01695 38.0 38.0 38.0 36.0 38.0 40-44 36.97975 38.0 38.0 38.0 36.0 38.0 45-49 36.81045 38.0 38.0 38.0 35.6 38.0 50-54 36.4251 38.0 38.0 38.0 34.0 38.0 55-59 36.36155 38.0 38.0 38.0 33.8 38.0 60-64 36.67605 38.0 38.0 38.0 34.8 38.0 65-69 36.295249999999996 38.0 38.0 38.0 33.4 38.0 70-74 36.1862 38.0 38.0 38.0 33.4 38.0 75-79 35.91315 38.0 37.6 38.0 31.8 38.0 80-84 35.5583 38.0 37.2 38.0 29.4 38.0 85-89 35.48315000000001 38.0 37.0 38.0 29.2 38.0 90-94 35.97445 38.0 37.6 38.0 32.8 38.0 95-99 36.158699999999996 38.0 38.0 38.0 33.6 38.0 100-104 36.17985 38.0 38.0 38.0 33.4 38.0 105-109 36.0492 38.0 38.0 38.0 33.2 38.0 110-114 35.69945 38.0 37.0 38.0 31.6 38.0 115-119 35.359300000000005 38.0 36.2 38.0 30.0 38.0 120-124 33.84824999999999 38.0 34.2 38.0 22.6 38.0 125-129 33.58585 38.0 33.0 38.0 20.0 38.0 130-134 28.265800000000002 31.4 20.4 37.2 13.8 38.0 135-139 33.558299999999996 38.0 32.8 38.0 22.8 38.0 140-144 33.944849999999995 38.0 33.8 38.0 23.6 38.0 145-149 33.26975 38.0 33.0 38.0 19.2 38.0 150-151 27.947 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 1.0 5 0.0 6 3.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 0.0 14 2.0 15 4.0 16 1.0 17 3.0 18 7.0 19 9.0 20 6.0 21 10.0 22 17.0 23 12.0 24 29.0 25 24.0 26 29.0 27 45.0 28 53.0 29 52.0 30 69.0 31 90.0 32 112.0 33 135.0 34 228.0 35 354.0 36 841.0 37 1848.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 18.425 11.425 31.35 2 29.099999999999998 24.025 26.924999999999997 19.950000000000003 3 23.325000000000003 26.674999999999997 27.224999999999998 22.775000000000002 4 26.05 31.0 20.5 22.45 5 27.075 31.95 20.625 20.349999999999998 6 23.225 35.175 21.75 19.85 7 23.225 20.075000000000003 34.225 22.475 8 24.45 24.125 23.925 27.500000000000004 9 23.225 23.599999999999998 26.950000000000003 26.224999999999998 10-14 26.08 26.314999999999998 23.635 23.97 15-19 25.509999999999998 25.629999999999995 24.745 24.115000000000002 20-24 25.564999999999998 26.064999999999998 24.610000000000003 23.76 25-29 26.14 26.105 23.830000000000002 23.925 30-34 25.5 26.61 24.08 23.810000000000002 35-39 25.25 26.16 24.529999999999998 24.060000000000002 40-44 25.650000000000002 25.224999999999998 25.36 23.765 45-49 26.045 25.915 24.55 23.49 50-54 25.374999999999996 26.435 24.279999999999998 23.91 55-59 25.64 25.545 24.6 24.215 60-64 25.83 25.16 25.080000000000002 23.93 65-69 24.845 26.16 25.03 23.965 70-74 25.485000000000003 25.45 25.330000000000002 23.735 75-79 25.259999999999998 25.869999999999997 25.34 23.53 80-84 25.385 26.295 24.875 23.445 85-89 25.515 25.83 24.865000000000002 23.79 90-94 25.074999999999996 26.105 25.295 23.525 95-99 26.36 26.02 24.675 22.945 100-104 25.385 26.205000000000002 25.240000000000002 23.169999999999998 105-109 25.505 26.340000000000003 24.95 23.205000000000002 110-114 25.88 26.325 24.975 22.82 115-119 25.735000000000003 26.105 24.565 23.595 120-124 26.215 26.31 24.32 23.155 125-129 26.334999999999997 26.305 24.565 22.795 130-134 25.585 26.44 24.875 23.1 135-139 26.26 26.55 24.645 22.545 140-144 26.275 26.135 24.775 22.814999999999998 145-149 26.08 26.165 24.529999999999998 23.225 150-151 25.974999999999998 26.174999999999997 25.474999999999998 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 5.0 28 7.0 29 7.0 30 7.5 31 9.5 32 13.5 33 16.5 34 26.0 35 39.5 36 42.5 37 48.5 38 65.5 39 86.0 40 125.5 41 159.0 42 168.0 43 171.5 44 184.0 45 195.5 46 203.5 47 211.5 48 205.0 49 178.0 50 166.5 51 163.0 52 130.5 53 116.5 54 113.5 55 109.0 56 101.0 57 86.0 58 84.0 59 89.5 60 78.0 61 71.5 62 71.5 63 58.5 64 48.0 65 51.5 66 55.0 67 49.0 68 44.0 69 36.0 70 28.5 71 19.0 72 13.5 73 11.0 74 8.0 75 6.0 76 3.5 77 3.0 78 2.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5040322580645161 1.0 3 0.15120967741935484 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.1 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCAAA 10 0.006830828 145.0 9 >>END_MODULE Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337506 spots for SRR6958206.sra Written 1337506 spots for SRR6958206.sra Read 1337507 spots for SRR6958206.sra Written 1337507 spots for SRR6958206.sra SRR ids: ['SRR6958206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r8pxn_co SRR6958206.sra spots: 26750121 blocks: [[1, 1337506], [1337507, 2675012], [2675013, 4012518], [4012519, 5350024], [5350025, 6687530], [6687531, 8025036], [8025037, 9362542], [9362543, 10700048], [10700049, 12037554], [12037555, 13375060], [13375061, 14712566], [14712567, 16050072], [16050073, 17387578], [17387579, 18725084], [18725085, 20062590], [20062591, 21400096], [21400097, 22737602], [22737603, 24075108], [24075109, 25412614], [25412615, 26750121]] SRR6958206 file size 9043037 SRR6958206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958206 SRR6958206_1.fastq SRR6958206_2.fastq Input file: SRR6958206_1.fastq Paired file: SRR6958206_2.fastq trimmed: SRR6958206-trimmed-pair1.fastq, SRR6958206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:09:58 2024 >> started Fri Dec 6 16:10:24 2024 >> done (26.530s) 26750121 read pairs processed; of these: 23001 ( 0.09%) short read pairs filtered out after trimming by size control 18282 ( 0.07%) empty read pairs filtered out after trimming by size control 26708838 (99.85%) read pairs available; of these: 9742818 (36.48%) trimmed read pairs available after processing 16966020 (63.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 8 0.00% 24 9 0.00% 25 2 0.00% 26 6 0.00% 27 12 0.00% 28 7 0.00% 29 8 0.00% 30 10 0.00% 31 8 0.00% 32 12 0.00% 33 15 0.00% 34 11 0.00% 35 7 0.00% 36 7 0.00% 37 7 0.00% 38 9 0.00% 39 7 0.00% 40 16 0.00% 41 20 0.00% 42 20 0.00% 43 13 0.00% 44 16 0.00% 45 23 0.00% 46 8 0.00% 47 23 0.00% 48 23 0.00% 49 33 0.00% 50 22 0.00% 51 38 0.00% 52 34 0.00% 53 46 0.00% 54 44 0.00% 55 58 0.00% 56 61 0.00% 57 69 0.00% 58 63 0.00% 59 81 0.00% 60 104 0.00% 61 113 0.00% 62 113 0.00% 63 132 0.00% 64 147 0.00% 65 157 0.00% 66 188 0.00% 67 236 0.00% 68 240 0.00% 69 267 0.00% 70 307 0.00% 71 357 0.00% 72 437 0.00% 73 507 0.00% 74 517 0.00% 75 538 0.00% 76 735 0.00% 77 719 0.00% 78 837 0.00% 79 930 0.00% 80 1112 0.00% 81 1208 0.00% 82 1422 0.01% 83 1734 0.01% 84 2715 0.01% 85 3516 0.01% 86 3780 0.01% 87 3843 0.01% 88 4040 0.02% 89 4111 0.02% 90 4468 0.02% 91 4836 0.02% 92 5098 0.02% 93 5542 0.02% 94 5986 0.02% 95 6474 0.02% 96 6875 0.03% 97 7155 0.03% 98 7807 0.03% 99 8314 0.03% 100 9306 0.03% 101 9464 0.04% 102 10444 0.04% 103 11215 0.04% 104 12005 0.04% 105 13116 0.05% 106 13749 0.05% 107 14527 0.05% 108 15470 0.06% 109 16268 0.06% 110 17155 0.06% 111 18467 0.07% 112 19516 0.07% 113 20838 0.08% 114 22238 0.08% 115 23953 0.09% 116 25219 0.09% 117 26128 0.10% 118 27193 0.10% 119 28360 0.11% 120 29874 0.11% 121 31048 0.12% 122 32599 0.12% 123 34996 0.13% 124 36725 0.14% 125 39506 0.15% 126 41014 0.15% 127 42920 0.16% 128 45128 0.17% 129 46645 0.17% 130 49264 0.18% 131 51293 0.19% 132 54734 0.20% 133 58265 0.22% 134 61657 0.23% 135 65899 0.25% 136 70070 0.26% 137 74482 0.28% 138 78656 0.29% 139 85063 0.32% 140 91845 0.34% 141 101446 0.38% 142 113517 0.43% 143 127141 0.48% 144 147808 0.55% 145 176562 0.66% 146 220688 0.83% 147 302346 1.13% 148 459109 1.72% 149 893679 3.35% 150 5625712 21.06% 151 16966020 63.52% 26708838 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=54.68 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=35.22 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.0 sequence=CACGGGGAAACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGCGGAGCCATCCCTCCGCAGCTAGCTTCTTAGAGGGACTATCGCCGTTTAGGCGACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCTT SRR6958206 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:11:14 Started mapping on | Dec 06 16:11:14 Finished on | Dec 06 16:14:08 Mapping speed, Million of reads per hour | 552.60 Number of input reads | 26708838 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 25766835 Uniquely mapped reads % | 96.47% Average mapped length | 297.26 Number of splices: Total | 29900880 Number of splices: Annotated (sjdb) | 28103781 Number of splices: GT/AG | 29494325 Number of splices: GC/AG | 356269 Number of splices: AT/AC | 11382 Number of splices: Non-canonical | 38904 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252860 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 24708 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 704402 704402 704402 N_multimapping 252860 252860 252860 N_noFeature 994155 25047391 1210547 N_ambiguous 610809 3764 109415 UnstrandedReadsAssigned:24161871 PositiveStrandReadsAssigned:715680 NegativeStrandReadsAssigned:24446873 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958206-trimmed-pair1.fastq SRR6958206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,708,838 reads, 24,478,879 reads pseudoaligned [quant] estimated average fragment length: 267.364 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR6958206.ke.tsv 35125 SRR6958206.se.tsv 88098 total ==> SRR6958206.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.162 0 0 PNS24247 1044 777.636 85.9261 6.96221 PNS24249 1928 1661.64 59.737 2.2652 PNS24246 1044 777.636 85.9261 6.96221 PNS24248 1044 777.636 85.9261 6.96221 PNS24244 1471 1204.64 51.4849 2.69291 PNS24243 293 82.8404 0 0 KQK14069 1603 1336.64 6307.42 297.329 KQK14071 474 222.916 145.694 41.1812 ==> SRR6958206.se.tsv <== BRADI_1g14170v3 7674 BRADI_1g53295v3 480 BRADI_1g59795v3 428 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 295 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR6958206 completed mapping pipeline successfully